• 검색 결과가 없습니다.

Development of loop-mediated isothermal amplification method for the rapid and sensitive detection of bovine tuberculosis in Korea native cattle

N/A
N/A
Protected

Academic year: 2021

Share "Development of loop-mediated isothermal amplification method for the rapid and sensitive detection of bovine tuberculosis in Korea native cattle"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

333

Korean J Vet Serv 34(4) : 333~339 (2011)

*Corresponding author: Ho-Seong Cho, Tel. +82-63-270-4872, Fax. +82-63-270-3780, E-mail. [email protected]

한우 결핵의 신속 감별진단을 위한 등온증폭법 개발

황은숙ㆍ이태욱1ㆍ정대영1ㆍ조호성*

전북대학교 수의과대학 및 생체안전성연구소, 1전라남도축산위생사업소

(접수 2011. 11. 24; 수정 2011. 12. 2; 게재승인 2011. 12. 5)

Development of loop-mediated isothermal amplification method for the rapid and sensitive detection of

bovine tuberculosis in Korea native cattle

Eun-Suk Hwang, Tae-Uk Lee1, Dae-Young Jung1, Ho-Seong Cho*

College of Veterinary Medicine and Bio-Safety Research Institute, Chonbuk National University, Jeonju 561-756, Korea

1Jeollanam-do Livestock Sanitation Office, Gangjin 522-822, Korea

(Received 24 November 2011; revised 2 December 2011; accepted 5 December 2011)

Abstract

Loop-mediated isothermal amplification (LAMP) was developed to detect Mycobacterium tuberculosis complex (MTC) and non-tuberculous mycobacterium (NTM) genomic DNA in blood samples of Korea native cattle. A set of four primers, two outer and two inner, were designed from M. bovis and M.

avium genomic DNA targeting the IS6110 and 16S rRNA gene, respectively. Based on 85 Intradermal Tuberculin Test (ITT) positive blood sample and using conventional PCR and LAMP, the agreement quotient (kappa), which measures agreement beyond chance were 0.93 (conventional PCR) and 0.97 (LAMP), respectively. The detection limit of the LAMP method was 2.0×102 copy/ml M. bovis and M.

avium cells, compared to 2.0×103 copy/ml M. bovis and M. avium cells for conventional PCR. These results suggest that the LAMP is a powerful tool for rapid, sensitive, and practical detection of MTC and NTM in blood samples of Korea native cattle.

Key words : Bovine tuberculosis, Loop-mediated isothermal amplification (LAMP), Mycobacterium bovis

서 론

결핵은 Mycobacterium속 균의 감염에 의해 전신 장 기에 결핵결절을 형성하는 만성 소모성 질환으로 사 람을 포함한 많은 동물에서 발생되는 인수공통전염 병이다(LoBue 등, 2010). 결핵을 일으키는 결핵균은 인형 결핵균군(Mycobacterium tuberculosis complex;

MTC, M. bovis, M. canettii, M. africanum, M. microti를 포함)과 한센병을 유발하는 M. leparae 및 이 둘을 제

외한 모든 항산성균인 비결핵성 마이코박테리움 (Non-tuberculous mycobacterium, NTM)으로 분류되고 있다(Ryoo 등, 2008).

소 결핵(Bovine tuberculosis)은 M. bovis 감염에 의 해 유발되는데 우리나라를 포함한 많은 나라에서 오 랫동안 퇴치를 위한 노력을 하고 있음에도 불구하고 전 세계적으로 연간 30억만 달러의 경제적 피해를 주 는 것으로 추정되고 있다(Schiller 등, 2010). 소 결핵 박멸을 위해 대부분의 나라에서 양성우 살처분 정책 및 도축장 예찰방법을 적용하고 있다. 그러나 근절이 쉽지 않은데 이는 한우, 사슴 같은 동물들에 대한 체

(2)

에 대해 살처분이 의무화 되어 있다. 그러나 단일 피 내검사법(Intradermal tuberculin test, ITT)의 경우 양성 에 대한 특이성의 문제점이 종종 야기되고 있는데 이 는 M. paratuberculosis와 M. avium 감염이나, 소 결핵 균과 항원구조가 유사한 세균(Norcardiae, Corynebac- teriae, Actinomyces)등에 의하여 튜버클린의 교차반응 으로 비특이 반응에 의해 양성으로 판정되기 때문이 다. 따라서 이러한 비특이 양성 반응우가 살처분됨으 로써 축산 농가의 경제적 손실을 가져오고 있다(Ryoo 등, 2008).

이에 반해 국내 한우에서의 결핵검진은 젖소와는 달리 의무화되어 있지 않고 농가의 자율적인 요청에 의해 수행되고 있다. 그러나 국내 한우에서의 결핵 발병 증례는 도축장에서의 도축 검사시 결핵 결절이 확인된 예로 2007년 광주에서 1두, 충북에서 8두가 보고된바 있다(고 등, 2007; 변 등, 2007). 이와는 대 조적으로 2009년 경기도의 총 2,693농가 한우 32,385 두에 대해 ITT 결핵 검진 결과 전 두수에서 음성 결 과를 얻었다고 보고(신 등, 2011)한 바 있어서 한우에 서의 결핵에 대한 연구는 지속적으로 수행되어야 하 며 기존의 진단법과 병용할 간편하고 현장에서도 활 용이 가능한 진단법의 개발도 필요할 것으로 생각된다.

등온증폭법(Loop-mediated isothermal amplifica- tion, LAMP)은 기존의 중합효소 연쇄반응법과 유사 하지만 기존의 중합효소 연쇄반응이 변성(denatura- tion), 접합(annealing), 신장(extension)의 세 가지 단 계를 거치면서 온도의 변화를 주어야 하는 반면, 일정한 단일 온도에서 접합 및 신장이 가능하다는 특징이 있는 방법으로 원리는 Fig. 1과 같다(Notomi 등, 2000). 이 방법은 일정한 단일 온도만 유지시켜 주면 주형 DNA의 증폭이 가능하기에 기존의 PCR 증폭법보다 진단 소요시간도 1시간 이내로 줄일 수 있으며 무엇보다 고가의 PCR 장비가 아닌 등온 유 지가 가능한 항온 수조나 오븐, 온장고 등 저가의 간이 장비만으로도 유전자 증폭이 가능하기 때문 에 현장 중심의 진단이 가능하다는 장점을 갖고 있 다(Cho 등, 2006a).

재료 및 방법

공시재료

이번 연구에서는 2010년부터 2011년까지 전남지역 에서 우형결핵균 배양액에서 준비한 purified protein derivaives (PPD) 항원을 이용한 피내반응 검사(intra- dermal tuberculin test, ITT)결과 소결핵 양성으로 진단 된 38마리와 한우와 음성으로 진단된 47마리 동거 한 우의 혈액 시료를 대상으로 하였다. 또한, 실험에 이 용된 균주는 농림수산검역검사본부에서 Mycobacte- rium tuberculosis (ATCC 27294), M. bovis (ATCC 19210), M. avium subsp. avium (ATCC 25291) 및 M.

intracellulare (ATCC 13950), Escherichia coli (ATCC 10536)를 분양받아 사용하였다.

DNA 추출

실험 재료로부터 DNA의 추출은 QIAamp DNA Mini kit (QIAGEN, Germany)을 이용하여 제시된 방 법을 따라 수행하였다. 추출된 DNA는 LAMP와 PCR 에 이용할 때까지 󰠏20oC에 보관하였다.

Primer

LAMP와 PCR에 이용한 primer는 Table 1과 같다.

각각 4개의 primer (F3, B3, FIP 및 BIP)와 2개의 loop primer를 LAMP primer design 프로그램(http://primer- explorer.jp/e/index.html)을 이용하여 제작하였고 PCR primer는 DNA star 프로그램(Dnastar Inc., USA)을 이 용하여 디자인하였다.

LAMP 반응

등온증폭반응은 Cho 등(2006a)의 방법을 이용하여 시행하였다. DNA 각각 2 ul, 각각 1.6 μM의 FIP와 BIP, 0.2 μM의 F3와 B3, 0.8 μM의 LF와 LB, 1.4 mM

(3)

Fig. 1.Schematic representation of the mechanism of LAMP. (A) Steps in the LAMP reaction. This figure shows the process that starts from primer FIP. However, it should be remembered that DNA synthesis can also begin from primer BIP.

(B) Schematic presen- tation of the structure of LAMP products in a lin- earized DNA form. B+, B󰠏, F+ and F– stand for the DNA structures shown in the boxes on the left. +, the target se- quence flanked by B1 and F1c; 󰠏, the comple- mentary sequence (Noto- mi et al, 2000).

dNTP, 8 U의 Bst DNA polymerase large fragment (New England BioLabs, Sumida, Tokyo, Japan), 8 mM MgSO4 및 SYBR Green (Invitrogen, USA) 2 μl를 넣어 총 25 ul가 최종 볼륨이 되도록 하고 65oC, 1시 간 인큐베이터에서 반응시켰다.

중합효소연쇄반응(PCR)

Table 1의 PCR primer set를 이용하여 각 시료의 증 폭 산물을 얻었다. 각각 20 μl의 반응 용액을 반응 튜

브에 넣은 후 DNA를 증폭한 다음 1.5% 아가로스에 서 전기영동으로 증폭산물을 확인하였다.

민감도 및 특이도 검사

M. tuberculosis, M. bovis, M. avium subsp. avium, M.

intracellulare 및 Escherichia coli 균 DNA (2.0×106 copy/ml)를 각각 10배 계단 희석하여 2.0×1062.0×100 copy/ml의 농도에서 PCR 및 LAMP의 민감도 및 특이 도 검사를 수행하였다.

(4)

LB_M CTCTCAGGCCGGCTACCCGT 20

MTC F3 CCACCAGCACCTAACCGG 18

B3 TCGAGTACGCCTTCTTGTTG 20

FIP (F1c+F2) GACAAAGGCCACGTAGGCGA-TGGGTAGCAGACCTCACC 38

BIP (B1c+B2) ACCGACGCCTACGTCGCAG-TCGATCGCGTCGAGGACC 37

LF_MTC CTGCCCAGGTCGACACATA 19

LB_MTC GCTTCCACGATGGCCACCT 19

PCR

M_common Mycgen_F AGAGTTTGATCCTGGCTCAG 20

Mycgen_R TGCACACAGGCCACAAGGGA 20

MTC MTC_F ATGCCCAAGAGAAGCGAATACAGGCAA 27

MTC_R CTATTGCTGCGGTGCGGGCTTCAA 24

Fig. 2. Detection limit of IS6110 using LAMP assay in M. bovis.

Varying dilutions of the IS6110 genomic DNA. Lane 1∼7:

2×106, 2×105, 2×104, 2×103, 2×102, 2×101 and 2×100 (copy/ml) of DNA, Lane M: Marker.

Fig. 3.Detection limit of 16S rRNA gene using LAMP assay in M.

avium. Varying dilutions of the 16S rRNA gene genomic DNA. Lane 1∼7: 2×106, 2×105, 2×104, 2×103, 2×102, 2×101 and 2×100 (copy/ml) of DNA, Lane M: Marker.

통계 분석

일반 PCR과 LAMP의 민감도와 특이도를 비교하였 다. 이들 두 검사 사이의 일치도는 Cohen’s Kappa 분 석을 실시하였다(Altman, 1999).

결 과

LAMP법에 의한 마이코박테리움균의 민감도

Table 1의 등온증폭반응 primer set을 이용하여 사 다리 형태의 증폭산물을 얻었다. 2×106부터 2×100

지 10배씩 희석한 시료에서 IS6110 gene을 증폭한 M.

bovis의 검출한계는 2×102 (copy/ml)이었고(Fig. 2), 16S rRNA gene을 증폭한 M. avium의 검출한계도 2×102 (copy/ml)까지였다(Fig. 3).

PCR에 의한 Mycobacterium 균의 검출

Table 1의 PCR primer set을 이용한 conventional PCR법으로 1,030 bp (Mycobacteria spp.) 및 786 bp (MTC) 크기의 증폭산물을 확인하였다. M. bovis와 M.

avium의 검출한계는 모두 2×103 (copy/ml)이었다.

(5)

Fig. 4. Results of LAMP assay to detect Mycobacterium using bo- vine blood samples. (A) Visualization on a light box. (B) Visualization under UV irradiation : bright fluorescence in- dicates a positive reaction. (C) Visualization in agarose gel electrophoresis: amplification shows a ladder-like pattern. 1, Positive control (M. avium); 2, Positive control (M. bovis);

3, Negative control (no template with NTM primers); 4, Negative control (no template with MTC primers), 5, NTM positive in case no. 1; 6, MTC positive in case no. 1; 7, NTM positive in case no. 2; 8, MTC negative in case no. 2; M:

DNA ladder.

Table 2. Comparison of the sensitivity and specificity of LAMP, conventional-PCR and intradermal tuberculin test (ITT) for the diagnosis of bovine tuberculosis in Korea native cattle

Conventional PCR LAMP

+ 󰠏 + 󰠏

ITT + 36 2 34 4

󰠏 1 46 2 45

Kappa index 0.93 0.86

형광을 이용한 시료에서의 LAMP 결과

107개의 시료를 대상으로 SYBR Green을 이용하여 LAMP 결과를 형광반응으로 확인한 결과 양성 반응 의 경우 형광을 확인하였다(Fig. 4).

시료에서의 LAMP 및 PCR의 결과 비교

피내검사법(Intradermal tuberculin test, ITT) 검사상 양성으로 확인된 38마리와 음성으로 확인된 47마리, 총 85마리의 혈액 시료에서 LAMP 및 PCR 검사 결과 Fig 4와 같다. 검사결과는 동일 시료를 대상으로 두 개의 tube를 한 세트로 분석하였다. 두 개의 tube 에서 모두 형광의 양성반응을 보이면 MTC (Fig. 4B, 5, 6)로 두 번째 tube에서만 형광양성인 경우 NTM (Fig. 4B, 7, 8)으로 진단하였다. 형광 양성 반응은 전 기영동 결과(Fig. 4C)를 통해 결과를 확인하였다.

또한, ITT 검사와 LAMP 및 PCR 검사의 일치도 (kappa)는 각각 0.93과 0.86으로 우수함을 확인할 수 있었다(Table 2).

고 찰

국내에서는 소결핵 근절을 위해 지속적으로 ITT검 사를 통해 도태 정책을 유지하고 있으며 최근에는 젖 소에서의 결핵 진단 검사의 정확도를 높이기 위해 감 마 인터페론 검사를 도입하여 진단을 하고 있다(신 등, 2011). 그러나 젖소와 달리 한우는 결핵검진이 의 무화되어 있지 않아서 일부에서만 검사가 수행되고 있다. 그러나 한우에서의 결핵도 최근 증가 추세에 있어서 이에 대한 지속적이고 체계적인 검사가 필요 하다.

최근 소결핵의 진단의 정확성을 높이고자 ITT 검 사와 더불어 감마 인터페론 검사법이 스크리닝 방법 으로 도입되고 있으며, 사람의 경우는 실험실 검사방 법인 PCR 진단법이 널리 활용되고 있다(Shin 등, 2007). 그러나 PCR법은 여전히 현장에서 활용하기에 는 장비를 이용해하는 단점을 갖고 있다. 따라서 유 전자 증폭 장비 없이도 동일한 수준의 민감도를 가진 진단법을 적용하거나 기존의 소결핵 진단법과 병용 할 수 있다면 매우 효과적이라 생각되었다. 이번 연 구에 사용된 LAMP법은 PCR법에서 사용하던 Taq DNA polymerase와는 달리 65oC 온도에서 활성을 갖 는 Bst DNA polymerase를 사용하기 때문에 일정한 온 도가 유지되는 수조, 오븐, 손난로 등을 이용하는 것 만으로도 결과를 확인할 수 있는 매우 획기적인 진단 법이며 실험 결과(Fig. 2, 3)를 통해서도 이를 확인할 수 있었다(Cho 등, 2006a; Notomi 등, 2000).

또한, ITT에서 양성 또는 음성 판정을 받은 85개의 혈액 시료를 대상으로 LAMP법과 기존의 PCR을 비

(6)

인 것으로 판단할 수 있었다.

동물에서뿐 아니라 사람의 결핵도 우리나라에서는 높은 유병률을 보이고 있으며, 제 3종 법정 전염병으 로 관리 하고 있는 감염성 질환이다(Ryoo 등, 2008).

최근에는 면역 결핍 환자들에 있어서의 결핵균 감염 약제 내성 결핵균의 등장, 비결핵항산균에 의한 감염 의 증가 등으로 결핵균의 신속한 검출과 동정에 대한 관심이 커지고 있는 실정이다. 최근에는 NTM이 질 병의 원인으로 부각되고 있는데 NTM은 결핵균과 달 리 병원성은 낮고 사람 간에는 전염이 되지 않는 것 으로 알려져 있다(LoBue 등, 2010; Ryoo 등, 2008). 그 러나 면역이 저하된 경우 다양한 질환을 일으킬 수 있으며, 이러한 질환 중 90% 이상이 폐질환으로 나 타난다고 하였다(LoBue 등, 2010). 우리나라의 경우 1993년부터 2006년까지 조사된 자료에 의하면, 미국 과 일본과 마찬가지로 Mycobacterium avium complex 에 의한 감염이 가장 많았고, M. abscessus, M. fortu- itum complex, M. chelonae complex 및 M. kansasii 등 의 순으로 보고되고 있다(Biet 등, 2005; Ryoo 등, 2008). 따라서 추후 한우를 포함한 동물에서의 MTC 뿐 아니라 NTM들에 대한 분포와 함께 결핵 치료제 로 쓰이는 약물에 대한 내성 패턴의 연구등도 공중보 건학적 측면에서 매우 중요하리라 생각된다.

이와 같이 사람의 결핵 확산의 과정에 가축을 포함 한 다양한 동물의 결핵 발생이 밀접하게 연관되어 있 으며 결핵병의 근절을 위해서는 한우를 포함한 다양 한 동물에서의 진단검사가 필수적이다. 따라서 이번 연구에서 제시한 LAMP법의 적용은 결핵균을 현장 상황에서도 손쉽게 검출할 수 있게 해줄 것이며, 이 진단법의 활용을 통해 소결핵병 근절에 일조할 것으 로 확신한다.

결 론

이번 연구에서는 소결핵을 진단할 수 있는 LAMP 진단법을 개발하고 이를 ITT 검사에서 양성으로 확

서 이번 연구에서 개발된 LAMP법은 현장에서 소 결 핵균을 신속하고, 정확하게 감별 진단하는데 효과적 이며 추후 현장 중심의 진단에 활용 가능성이 매우 높을 것으로 전망한다.

감사의 글

이 논문은 2011년도 정부(교육과학기술부)의 재원 으로 한국연구재단의 지원을 받아 수행된 기초연구 사업임(No. 2011-0014054).

참 고 문 헌

고바라다, 김현중, 박덕웅, 박성도, 김재익, 박종태, 김용환.

2007. PCR 기법을 이용한 도축 소의 결핵병 신속진 . 한국가축위생학회지 30: 393-406.

변현섭, 이현주, 이상명, 한성태, 곽학구, 최해연, 조윤상, 안병 . 2007. 도축 한우에서 발견된 결핵병. 한국가축위 생학회지 30: 407-414.

신승원, 신민경, 차승빈, 우종태, 이성모, 구복경, 조윤상, 정석 , 유한상. 2011. 국내 우군에서 소 결핵 진단을 위한 피내검사법과 Interferon-γ 생성 검사의 비교. 대한수 의학회지 51: 117-122.

유한상. 2007. 소 결핵병의 국제 연구 동향. 한국수의공중보건 학회지 31: 69-82.

Altman DG. 1999. Practical statistics for medical research.

Chapman & Hall/CRC Press, Boca Raton/London/New York/Washington, DC.

Biet F, Boschiroli ML, Thorel MF, Guilloteau LA. 2005.

Zoonotic aspects of Mycobacterium bovis and Mycobac- terium avium-intracellulare complex (MAC). Vet Res 36: 411-436.

Cho HS, Kang JI, Park NY. 2006a. Detection of canine parvovi- rus in fecal samples using loop-mediated isothermal amplification. J Vet Diagn Invest 18: 81-84.

Cho HS, Kim YH, Park NY. 2006b. Disseminated mycobacter- iosis due to Mycobacterium avium in captive Bengal ti- ger (Panthera tigris). J Vet Diagn Invest 18: 312-314.

LoBue PA, Enarson DA, Thoen CO. 2010. Tuberculosis in hu- mans and animals: an overview. Int J Tuberc Lung Dis

(7)

14: 1075-1078.

Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. 2000. Loop-mediated isothermal am- plification of DNA. Nucleic Acids Res 28: E63.

Ryoo SW, Shin S, Shim MS, Park YS, Lew WJ, Park SN, Park YK, Kang S. 2008. Spread of nontuberculous mycobac- teria from 1993 to 2006 in Koreans. J Clin Lab Anal 22:

415-420.

Schiller I, Oesch B, Vordermeier HM, Palmer MV, Harris BN,

Orloski KA, Buddle BM, Thacker TC, Lyashchenko KP, Waters WR. 2010. Bovine tuberculosis: a review of cur- rent and emerging diagnostic techniques in view of their relevance for disease control and eradication. Trans- bound Emerg Dis 57: 205-220.

Shin JB, Park NY, Kim YH, Cho HS. 2007. Dual priming oligo- nucleotide system for the multiplex detection of tuber- culosis in Hanwoo. Kor J Vet Serv 30: 527-532.

수치

Fig. 1. Schematic representation  of the mechanism of  LAMP. (A) Steps in the  LAMP reaction
Fig. 2. Detection limit of IS6110 using LAMP assay in M. bovis.
Fig. 4. Results of LAMP assay to detect Mycobacterium using bo- bo-vine blood samples

참조

관련 문서

Rapid and simple method for detecting the toxin B gene of Clostri- dium difficile in stool specimens by loop-mediated iso- thermal amplification. Rapid and sensitive

Rapid, sensitive, and specific detection of the O4 group of Salmonella enterica by loop- mediated isothermal amplification. Pui CF, Wong WC, Chai LC, Lee HY, Noorlis A,

A two-tube reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was designed for the rapid visual detection of the M gene of all subtypes of

Detection limit of reverse tran- scription loop-mediated isothermal amplification (A and B), reverse transcription-polymerase chain reaction (RT-PCR) (C) and real time RT-PCR

A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to rapidly detect foot-and-mouth disease virus serotype C (FMDV C).. By

fastidiosa in the field, the loop-mediated isothermal amplification (LAMP) and polymerase chain reaction (PCR) assay were developed to mqsA gene of citrate-synthase (XF 1535)

A reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) assay was evaluated to monitor infectious hematopoietic necrosis virus (IHNV) from artificially

human Astrovirus (HuAstV) ensitivity test compare with outer primer conventional-nested polymerase chain reaction (PCR) and loop-mediated isothermal amplification