• 검색 결과가 없습니다.

Pan-serotype reverse transcription loop-mediated isothermal amplification (RT-LAMP) for the rapid detection of foot-and-mouth disease virus

N/A
N/A
Protected

Academic year: 2021

Share "Pan-serotype reverse transcription loop-mediated isothermal amplification (RT-LAMP) for the rapid detection of foot-and-mouth disease virus"

Copied!
11
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

ISSN 1225-6552, eISSN 2287-7630 https://doi.org/10.7853/kjvs.2018.41.1.29

< Original Article >

Veterinary Service

Available online at http://kjves.org

*Corresponding author: Choi-Kyu Park, Tel. +82-53-950-5973, Fax. +82-53-950-5973, E-mail. [email protected]

구제역바이러스 신속진단을 위한 pan-serotype reverse transcription loop-mediated isothermal amplification

(RT-LAMP) 진단법

임다래

1

ㆍ박유리

1

ㆍ박선영

1,2

ㆍ김혜령

1

ㆍ박민지

1

ㆍ구복경

2

ㆍ나진주

2

유소윤

2

ㆍ위성환

2

ㆍ전효성

3

ㆍ김지정

3

ㆍ전보영

4

ㆍ이형우

5

ㆍ박최규

1

*

경북대학교 수의과대학 & 수의전염병제어센터1, 농림축산검역본부 구제역진단과2,

(주)엠모니터3, 연세대학교 보건과학대학 임상병리학과4, 스콜피오진(주)5

Pan-serotype reverse transcription loop-mediated isothermal amplification (RT-LAMP) for the rapid detection of

foot-and-mouth disease virus

Da-Rae Lim

1

, Yu-Ri Park

1

, Sun-Young Park

1,2

, Hye-Ryung Kim

1

, Min-Ji Park

1

, Bok-Kyung Ku

2

, Jin-Ju Nah

2

, So-Yoon Ryoo

2

, Sung-Hwan Wee

2

, Hyo-Sung Jeon

3

,

Ji-Jeong Kim

3

, Bo-Young Jeon

4

, Hyeong-Woo Lee

5

, Choi-Kyu Park

1

*

1College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, Daegu 41566, Korea

2Foot-and-Mouth Disease Research Division, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea

3M Monitor Inc., Daegu 47213, Korea

4Department of Biomedical Laboratory Science, College of Health Science, Yonsei University, Wonju 26493, Korea

5Institute of Research and Development, Scorpiogen Co., Hankyong National University, Anseong 17579, Korea (Received 8 December 2017; revised 22 January 2018; accepted 24 January 2018)

Abstract

In this study, we developed a sensitive and specific reverse transcription loop-mediated isothermal am- plification (RT-LAMP) assay for rapid visual detection of foot-and-mouth disease virus (FMDV) circu- lated in Korea. The RT-LAMP was completed in 40 min at 62°C and the results of the assay were directly detected by naked eye without any detection process. The assay specifically amplified all 7 se- rotypes of FMDV RNAs but not amplified other viral and cellular nucleic acids. The sensitivity of the RT-LAMP was 102, 103 and 103 TCID50/mL for serotype O, A and Asia 1 FMDV, respectively, which was comparable to conventional reverse transcription polymerase chain reaction (RT-PCR) and relatively lower than that of real time quantitative RT-PCR (qRT-PCR). Clinical evaluation of the RT-LAMP us- ing different serotypes of Korean and foreign FMDV strains showed a 100% (35/35) agreement with the results of the RT-PCR and qRT-PCR. These results indicated that RT-LAMP assay developed in this study could be a valuable diagnostic method for FMDV monitoring and surveillance.

Key words : Foot-and-mouth disease virus, Reverse transcription loop-mediated isothermal amplification (RT-LAMP), Reverse transcription polymerase chain reaction (RT-PCR), Real time quantitative RT-PCR (qRT-PCR)

(2)

서 론

구제역(foot-and-mouth disease; FMD)은 우제류 가 축 및 야생동물에 감염되는 고전염성의 바이러스성 질병으로 발생 국가는 감염 가축의 생산성 저하는 물 론 동ㆍ축산물의 국제 교역 제한으로 인해 심각한 경 제적 피해를 입게 된다(Jamel과 Belsham, 2013; OIE, 2016). FMD의 원인체인 FMD virus (FMDV)는 Picor- naviridae과, Aphthovirus속에 속하는 RNA 바이러스로 면역학적 및 유전적으로 구별되는 7가지 혈청형 즉, O, A, Asia 1, C, SAT (Southern African Territorries) 1, SAT 2, and SAT 3형으로 구분되고, 동일 혈청형 내 에서도 다양한 지역형(topotypes) 및 유전형(genetic line- ages)이 존재하며, 혈청형 및 지역형별로 발생지역의 분포가 다른 특징을 가지고 있다(Knowles와 Samuel, 2003). 7개 혈청형 중에서 C 혈청형은 2004년 케냐 및 브라질 발생 이후 더 이상 발생이 없는 상태이며, SAT 1, 2 및 3 혈청형은 아프리카 지역 국가에서 그 리고 Asia 1 혈청형은 아시아 지역의 국가에서 주로 발생하고 있다. 반면에 O 및 A 혈청형의 FMDV는 지 역 제한 없이 광범위한 발생 분포를 보이고 있으며, 유럽, 북미, 아시아 및 아프리카 지역의 국가들에서 지속적으로 발생하고 있다(Jamel과 Belsham, 2013;

Brito 등, 2017).

한국은 지리적으로 O, A 및 Asia 1 혈청형의 FMDV가 주로 발생하는 pool 1 지역에 속하며(Brito 등, 2017), 2000년 이후 O 혈청형(2000, 2002, 2010, 2014, 2016 및 2017년)과 A 혈청형(2010 및 2017년)의 FMDV가 주기적으로 발생하여 왔다(Shin 등, 2003; Wee 등, 2004; Park 등, 2013; Park 등, 2016; Kim 등, 2017;

OIE, 2017). 특히 2010년 O 혈청형의 FMDV 발생 시 에는 약 3백 50만두의 가축이 살처분되어 막대한 경 제적 피해는 물론 심각한 동물 복지 문제를 야기한 바 있다(Park 등, 2013). 이후 한국 정부에서는 방역정 책의 방향을 기존의 살처분 정책에서 예방접종 정책 으로 전환하였으며, 감수성 우제류 가축에 대한 전국 적인 예방접종을 실시하고 있다.

FMD는 전파가 매우 빠른 질병이기 때문에 효율적 인 초기 방역을 위해서는 감염 가축을 신속ㆍ정확하 게 진단할 수 있는 진단법의 개발 및 적용이 필수적 이다(OIE, 2016). 이러한 진단 목적을 달성하기 위하 여 최근 reverse transcription polymerase chain reaction (RT-PCR) 및 real time quantitative RT-PCR (qRT-PCR) 과 같은 PCR 기반 진단법들이 개발되어 널리 활용되

고 있으며(Reid 등, 2000; Callahan 등, 2002; Le 등, 2011; Le 등, 2012; OIE, 2016), 한국의 방역기관에서 도 현재 Le 등(2011) 및 Reid 등(2000)이 보고한 RT-PCR 과 Callahan 등(2002)이 보고한 qRT-PCR을 표준 진단 법으로 활용하고 있다. 그러나 PCR 기반 진단법은 고가의 전용 장비와 시약을 필요로 하며, 숙련된 인 력이 갖추어진 전문 실험실에서만 활용이 가능하므 로 일선 임상실험실이나 현장 진단용으로 사용하기 에는 제한이 있어 왔다. 이러한 PCR 기반 진단법의 단점을 극복할 수 있는 방법 중의 하나로 Notomi 등 (2000)은 높은 특이도와 민감도를 가지면서도 등온조 건하에서 신속하게 목표 유전자를 증폭할 수 있는 loop-mediated isothermal amplification (LAMP)기법을 개발하였다. LAMP는 기존의 PCR 기반 진단법에서 사용되는 Taq DNA polymerase와 달리 목표유전자를 strand displacement 방식에 의해 대량 증폭할 수 있는 Bst DNA polymerase를 이용함으로써 유전자 증폭효 율이 월등하게 높을 뿐만 아니라 기존 PCR 기반 진 단법과는 달리 온도 변화가 없는 등온조건에서 유전 자 증폭이 이루어지기 때문에 검사시간이 단축되며, 항온수조와 같은 저가의 장비로도 반응이 가능하다 (Notomi 등, 2000; Dhama 등, 2014). 따라서 전문 진단 실은 물론 고가의 장비와 시약 및 전문 인력이 확보 되지 않은 소규모의 진단실에서도 활용이 가능한 장 점이 있다. 또한 LAMP 반응액에 단순히 역전사효소 를 첨가함으로써 RNA template를 증폭할 수 있는 RT-LAMP가 가능하기 때문에 다양한 세균, 기생충 및 바이러스성 질병의 진단에 널리 이용되고 있다(Mori와 Notomi, 2009; Dhama 등, 2014).

FMDV 진단을 위한 RT-LAMP는 2006년 Duke 등 (2006)에 의해 처음 보고되었으며, 이후 여러 연구자 들에 의해 7개 혈청형의 FMDV를 공통 진단할 수 있 는 RT-LAMP (Duke 등, 2006; Shao 등, 2010; Chen 등, 2011a; Guan 등, 2013; Yamazaki 등, 2013; Waters 등, 2014)와 특정 혈청형을 감별 진단할 수 있는 RT-LAMP (Chen 등, 2011b; Madhanmohan 등, 2013;

Ding 등, 2014)가 개발되었으며, 이를 FMDV 현장진 단법으로 활용하기 위한 시도가 이루어져 왔다(Waters 등, 2014; Howson 등, 2015).

한국에서도 최근 수의학 분야의 여러 연구자들이 다양한 세균 및 바이러스성 병원체 진단을 위한 LAMP 및 RT-LAMP 기법을 개발하여 왔으나(Cho 등, 2005;

Hwang 등, 2011; Koh 등, 2013; Dong 등, 2014; Kim 등, 2015; Kim 등, 2016; Park 등, 2016; Park 등, 2017)

(3)

Table 1. Virus strains used in this study

No. Serotype Topotype/lineage Isolate name GenBank

Accession No.

Viral titer

(TCID50/mL) Notice

1 O SEA/Mya-98 O/Andong/KOR/2010 KC503937 8.4×106 Korean isolate

2 O ME-SA/ind-2001 O/Boeun/KOR/2017 Unregistered 1.4×107 Korean isolate

3 O ME-SA  O/Manisa/Turkey/69 AY593823 1.1×106 Vaccine strain

4 A Asia/Sea-97 A/Pocheon/SKR/2010 KC588943 4.7×106 Korean isolate

5 A Asia/Sea-97 A/Yeoncheon/KOR/2017 Unregistered 1.5×106 Korean isolate

6 A Asia/Sea-97 A/VN15/2014 Unregistered 2.7×106 Foreign isolate

7 Asia 1 Asia As1/Shamir/89 JF739177 1.1×107 Vaccine strain

8 C EURO-SA C3/Resende/BRA/55 AY593807 4.7×107 Foreign isolate

9 SAT 1 III-WZ SAT1/BOT/1/68 AY593845 2.0×107 Foreign isolate

10 SAT 2 II-WZ SAT2/ZIM/5/81 KF112972 6.3×106 Foreign isolate

11 SAT 3 I-SEZ SAT3/ZIM/4/81 KY825732 2.7×107 Foreign isolate

12 Seneca A virus ATCC (PTA-5343) DQ641257 1.5×105 Foreign isolate

아직 FMDV의 진단에는 응용된 바가 없다. 따라서 이 연구에서는 7개 혈청형의 FMDV를 공통적으로 진 단할 수 있는 pan-serotype RT-LAMP (RT-LAMP) 진 단법을 개발하여 FMDV 표준진단법으로 활용하고 있는 RT-PCR 및 qRT-PCR과 진단효율을 비교함으로 써 국내 발생 FMDV에 대한 진단 효용성을 검토하였 기에 보고한다.

재료 및 방법

공시 바이러스 및 핵산 추출

국내분리주, 백신주 및 외국분리주를 포함한 총 11 주의 FMDV를 농림축산검역본부의 협조를 받아 시 험에 공시하였다(Table 1). O 혈청형은 한국에서 발생 한 바 있는 SEA (South-East Asia) 지역형에 속하는 국내분리주 1주(O/Andong/KOR/2010)와 ME-SA (Middle East-South Asia) 지역에 속하는 국내분리주 1주(O/

Boeun/KOR/2017) 및 백신주 1주(O/Manisa/Turkey/69) 를 공시하였다. A 혈청형은 한국에서 발생한 바 있는 Asia 지역형에 속하는 국내분리주 2주(A/Pocheon/

SKR/2010 및 A/Yeoncheon/KOR/2017)와 베트남 분리 주 1주(A/VN15/2014)를 공시하였다. Asia1 혈청형은 백신주 1주(As1/Shamir/89), 그리고 C 혈청형은 외국 분리주 1주(C3/Resende/BRA/55)를 공시하였다. SAT1 혈청형은 3개 topotype 중 topotype III-WZ (western Zimbabwe, Botswana and Namibia)에 속하는 SAT1/BOT/1/68, SAT2 혈청형은 II-WZ에 속하는 SAT2/ZIM/5/81, 그리 고 SAT3 혈청형은 SAT3/ZIM/4/81 바이러스주를 사

용하였다(Knowles and Samuel, 2003). 또한 FMD과 유 사한 증상을 유발하는 것으로 알려져 있는 Seneca A virus 1주를 추가로 공시하였다. 공시 바이러스를 이 용한 모든 실험은 농림축산검역본부 구제역진단과의 협조를 받아 biosafety level 3급의 차폐실험실에서 실 시하였다. 진단법 개발 및 효능 검증시험에 필요한 바이러스 핵산은 해당 바이러스 배양액으로부터 시 판 RNA추출키트(Inclone biotech, Korea)를 이용하여 RNA를 추출한 다음 −80°C에 보관하면서 시험에 사 용하였다.

RT-LAMP용 프라이머 설계

7개 혈청형의 FMDV를 특이적으로 증폭할 수 있는 RT-LAMP용 primer set를 설계하기 위하여 2000년 이 후 NCBI (National Center for Biotechnology Information) 의 GenBank database에 등록된 FMDV의 3D polymer- ase 유전자 염기서열 정보 중에서 혈청형별로 지역형 및 유전형이 고루 포함되도록 하여 총 109개(O 혈청 형 57, A 혈청형 21, Asia 1 혈청형 14, C 혈청형 2, SAT1 혈청형 5, SAT2 혈청형 7 및 SAT3 혈청형 3)의 유전자염기서열 정보를 수집하였다. 수집된 유전자염 기서열을 DNASTARLasergene (DNASTAR, Inc, USA) 프로그램으로 비교분석하여 가장 안정적인 부위를 선발한 다음, LAMP용 primer 설계 프로그램인 Primer- Explorer V4 software (http://primerexplorer.jp/e/index.html;

Eiken Chemical Co. Ltd, Japan)를 이용하여 2종의 내 부 primer [forward inner primer (FIP)와 backward inner primer (BIP)], 2종의 외부 primer (F3와 B3) 및 2종의 loop primer [forward loop primer (LF)와 backward loop

(4)

Table 2. Primers and probe used in this study

Method (target gene) Primer Sequence (5’-3’)* Genome position Reference

RT-LAMP (3D) F3 CATYACTCCAGCTGACAA 7686∼7703 In this study

B3 CCAACGCAGGTAAAGTGA 7966∼7983

FIP (F1C+F2) GCAAAGGAGAGGATAGCYTCR CATGGAYTATGGAACTGGGT

7821∼7841 +7770∼7789 BIP (B1C+B2) CGTGGGACCATACAGGAGAAG

GTACTCGTCAGGTCCRGA

7846∼7866 +7897∼7914

LF RGTCTTCGAAGCCATCACA 7800∼7818

LB GAYCTCCGTGGCAGGRCT 7869∼7886

qRT-PCR (3D) Forward ACTGGGTTTTACAAACCTGTGA 7783∼7804 Callahan et al. (2002)

Reverse GCGAGTCCTGCCACGG 7873∼7889

Probe FAM-TCCTTTGCACGCCGTGGGAC-BHQ1 7834∼7853

RT-PCR (5'UTR) 1F GCCTGGTCTTTCCAGGTCT 597∼615 Reid et al. (2000)

1R CCAGTCCCCTTCTCAGATC 904∼922

*Bold text in sequences of F3, FIP, BIP, LF and LB primers represent a degenerative base: Y, C or T; R, A or G. FAM, 6-carboxyfluorescein. BHQ1, Black Hole Quencher 1. Locations of the all primers and probe sequences for reverse transcription loop-mediated isothermal amplification (RT-LAMP), reverse transcription polymerase chain reaction (RT-PCR) and real time quantitative RT-PCR (qRT-PCR) were derived from the complete genome sequence of Koran representative FMDV isolate O/SKR/JC/2014 (GenBank accession no. KX162590.1).

primer (LB)]를 설계하였다. 분석한 FMDV의 혈청형 및 지역형간 유전적 다양성 때문에 일부 바이러스의 경우, primer 결합부위의 염기서열이 일치하지 않았 으며, 이를 보완하기 위하여 해당 염기서열은 Table 2 와 같이 적절히 변성시켜 가능한 모든 FMDV를 검출 할 수 있도록 하였다. 설계한 primer 염기서열들에 대 하여 BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) 검 색을 통하여 특이도를 검증한 결과, FMDV의 3D 유 전자와 특이적으로 반응함이 확인되었다. 설계한 pri- mer set는 primer 제조업체(Bioneer Co, Korea)에 의뢰 하여 합성하였다(Table 2).

Conventional RT-PCR

RT-PCR은 농림축산검역본부에서 FMDV의 혈청형 공통진단용으로 사용하고 있는 Reid 등(2000)의 RT-PCR방법을 준용하여 FMDV의 5’UTR 유전자 부 위를 특이적으로 증폭할 수 있는 primer set를 이용하 여 시판 IncloneTM one-step RT-PCR 키트(Inclone bio- tech, Korea)를 이용하여 실시하였다(Table 2). 12.5 L 의 Reaction mix용액에 각각 forward primer, reverse primer를 0.2 M이 되게 첨가하고 Enzyme mix를 1

L 첨가한 후 공시 재료로부터 추출한 RNA 5 L를 첨가하여 최종 용량을 25 L으로 조정하였다. PCR 증폭기(Biometra, Germany)를 이용하여 45°C에서 50 분간 역전사반응을 거친 다음, 95°C에서 15분간 처리 하였고, 35 회전의 PCR 과정(denaturation 95°C, 20초;

annealing 55°C, 40초; extension 72°C, 45초)를 수행하 였고, 72°C에서 5분간 최종 반응하였다. PCR 증폭산 물은 NEO green 염색액(NEO science, Korea)을 첨가 한 1.5% agarose gel에 전기 영동한 다음, 자외선판독 기(Bio-Rad, USA)로 326 bp (O/SKR/JC/2014 국내분리 주 대비)의 특이 밴드를 관찰하여 판독하였다.

Real time quantitative RT-PCR (qRT-PCR)

qRT-PCR은 농림축산검역본부에서 FMDV 혈청형 공통진단용 표준진단법으로 사용하고 있는 Callahan 등(2002)의 방법을 준용하여 FMDV의 3D polymerase gene을 검출할 수 있는 AccuPower FMDV Real-Time RT-PCR MasterMix Kit (Bioneer, Korea)와 CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad, USA)을 사용하여 실시하였다(Table 1). 44.0 L의 FMDV Mastermix 용액에 internal positive control (IPC) 1.0 L와 RNA template 5.0 L를 첨가하여 최종 용량 을 50 L로 조정하였다. qRT-PCR 반응은 45°C에서 30분간 역전사반응을 거친 다음, 95°C에서 5분간 처 리하였고, 45 회전의 PCR 과정(denaturation 95°C 15 초, annealing 55°C 50초)을 거친 다음, 최종 72°C에서 5분간 처리하였다. 형광신호가 배경 값(background)이 상으로 검출되는 경우 양성으로 판정하여 해당 thresh- old cycle (Ct)value를 확인하였고, 형광신호가 배경 값 이상으로 검출되지 않는 경우에는 음성으로 판정하 였다(Callahan 등, 2002).

(5)

RT-LAMP의 반응조건

RT-LAMP를 위한 반응액의 조성은 기존 연구자들 이 보고한 반응액의 조성을 준용하였다(Dukes 등, 2006; Shao 등, 2010; Yamazaki 등, 2013). 즉, 1 L의 Bst DNA polymerase (8 U/L, NEW England Biolabs, USA), 0.2 L의 AMV reverse transcriptase (10 U/L, Promega, Durham, NC, USA), 0.8 M betaine (Sigma- Aldrich, USA), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 4 mM MgSO4, 10 mM (NH4)2SO4, 0.1% Triton X-100, 1.6 mM dNTPs, 0.12 mM hydroxy naphthol blue (HNB:

Lemongreen, Shanghai, China), 1.6 M의 FIP와 BIP, 0.8 M의 LF와 LB, 그리고 0.2 M의 F3와 B3 primer 를 첨가하여 반응액을 제조하였으며, 제조한 반응액 에 검사시료에서 추출한 RNA 시료 5 L를 첨가한 다음, 멸균증류수로 최종 용량을 25 L로 조정하였 다. FMDV RNA 검출에 적합한 최적 RT-LAMP 조건 을 확립하기 위하여 국내분리주(O/Andong/KOR/2010) 배양액으로부터 추출한 RNA을 이용하여 반응온도 (56∼68°C)와 반응시간(20∼60분)을 달리하여 RT-LAMP 를 실시한 다음, 80°C에서 5분간 처리하여 반응액 내 의 효소 활성을 제거하였다. 반응이 끝난 다음, 육안 으로 HNB의 작용에 의한 반응액의 색깔 변화(음성 보라색, 양성 연청색)를 관찰하여 결과를 판독하였으 며(Goto 등, 2009), 동시에 2.0% agarose gel에 전기영 동을 실시한 다음, 자외선판독기(Bio-Rad, USA)를 이 용하여 LAMP 반응에서 특이적으로 나타나는 사다리 모양의 유전자 증폭 밴드를 확인하여 양성 여부를 판 정하였다.

개발 RT-LAMP의 특이도

개발 RT-LAMP 진단법의 특이도를 확인하기 위하 여 Table 1에 제시된 11종의 FMDV 배양액, Seneca A virus 배양액 및 3종의 배양세포(BHK21, PK-15, Vero cell)로부터 시판 핵산추출키트(Inclone biotech, Korea) 를 이용하여 핵산을 추출한 다음, 개발된 RT-LAMP 를 이용하여 확립된 조건으로 반응을 실시하였고, 전 술한 방법으로 유전자 증폭 여부를 확인하였다.

진단법간 검출한계 비교

FMDV의 혈청형간 염기서열의 차이에 따른 검출 한계 변화의 가능성을 염두에 두고 혈청형 O

(O/Boeun/KOR/2017), A (A/Yeoncheon/KOR/2017) 및 Asia 1 (As1/Shamir/89) FMDV 배양액을 PBS (pH 7.2) 로 106 TCID50/mL에서 10−1 TCID50/mL까지 10배수 단 계희석한 다음, 100 L씩 들어내어 시판 핵산 추출키 트(Inclone biotech, Korea)를 이용하여 핵산을 추출하 여 50 L의 증류수에 용출하였고, 그 중 5 L를 tem- plate로 사용하여 표준 RT-PCR과 qRT-PCR 및 개발 RT-LAMP를 각각 실시한 다음, 진단법간 검출한계를 비교하였다.

국내ㆍ외 FMDV 분리주를 이용한 진단법간 검출효율 비교

현재와 같은 국내 FMD 비발생 상황에서는 개발 RT-LAMP의 진단효율을 실제 야외시료를 대상으로 평가하기가 불가능하였기 때문에 차선책으로 농림축 산검역본부에서 보유하고 있는 국내ㆍ외 FMDV 배 양시료 35점(O 혈청형 21주, A 혈청형 10주, Asia 1 혈청형 3주 및 C 혈청형 1주)을 대상으로 진단효율을 평가하였다. 평가의 공정성을 확보하기 위하여 농림 축산검역본부의 차폐실험실에서 추출한 각 바이러스 의 RNA 시료를 내역을 알 수 없도록 무작위로 선발 하여 이 연구의 평가팀에 제공하였고, 평가팀에서는 별도의 실험실에서 내역을 알지 못하는 상태에서 각 RNA시료를 대상으로 RT-PCR, qRT-PCR 및 개발 RT-LAMP를 각각 실시하여 그 결과를 비교하였다.

결 과

RT-LAMP의 반응조건 확립

공시 FMDV에서 추출한 핵산을 이용하여 개발 RT-LAMP의 적정 반응온도를 탐색한 결과, 육안으로 는 56°C를 제외한 58∼68°C 반응온도에서 연청색(sky blue)의 HNB 특유 양성 색깔 변화가 관찰되었으며 (Fig. 1A), 증폭산물을 전기영동한 결과에서도 해당 반응온도에서 특유의 사다리꼴 모양의 양성밴드가 관찰되었다(Fig. 1B). 또한 최적 반응시간을 탐색하기 위하여 반응온도를 62°C로 고정한 다음, 104, 103 및 102 TCID50/mL로 10배수 단계희석한 FMDV (O/Andong/

KOR/2010)에서 추출한 RNA를 대상으로 RT-LAMP 반응시간을 달리하여 증폭효율을 확인한 결과, 육안 적으로는 30분 이후부터 양성반응이 관찰되었으나

(6)

Fig. 1. Optimization of reverse transcription loop-mediated isothermal amplification (RT-LAMP) condition for amplification of the FMDV RNA with different reaction temperatures (A and B) and reaction times (C and D). (A and B) Visual detection (A) and electrophoretic detection (B) of the RT-LAMP results. Tubes and lanes 1∼7, different reaction temperature of 56, 58, 60, 62, 64, 66 and 68°C, respectively; tube and lane NC, negative control; lane M, 100 bp DNA marker. (C and D) Visual detection (C) and electrophoretic detection (D) of the RT-LAMP results. Lanes and tubes 1

∼3, 10-fold dilutions of FMDV (O/Andong/KOR/2010) with viral titers of 104, 103 and 102 TCID50/mL; tube and lane NC, negative control; lane M, 100 bp DNA marker.

Fig. 2.Specificity of the reverse transcription loop-mediated iso- thermal amplification (RT-LAMP) assay for different serotypes of foot-and-mouth disease virus. (A and B) Visual detection (A) and electrophoretic detection (B) of the RT-LAMP results. Tubes and lanes 1∼3, serotype O FMDV O/Andong/KOR/2010, O/Boeun/KOR/2017 and Manisa/Turkey/69, respectively; tubes and lanes 4∼6, serotype A FMDV A/Pocheon/SKR/2010, A/Yeoncheon/KOR/2017 and A/VN/

15/2009, respectively; tube and lane 7, serotype Asia1 FMDV As1/

Shamir/89; tube and lane 8, serotype C FMDV C3/Resende/BRA/55;

tube and lane 9, serotype SAT1 SAT1/BOT/1/68; tube and lane 10, se- rotype SAT2 SAT2/ZIM/5/81; tube and lane 11, serotype SAT3 SAT3/ZIM/4/81; tube and lane 12 Seneca A virus; tubes and lanes 13∼15; BHK21, PK-15 and Vero cell control, respectively; tube and lane NC, negative control.

40분 이상 반응하였을 때 가장 선명한 양성 색깔 변 화를 관찰 할 수 있었다(Fig. 1C). 해당 RT-LAMP 증 폭산물을 전기영동하여 관찰한 결과, 20분 반응시간 때부터 특이 양성밴드가 관찰되었으나 40분 이상 반 응시켰을 때 모든 희석배율에서 양성 밴드가 뚜렷하 게 관찰되었다(Fig. 1D). 따라서 이후의 모든 RT-LAMP 실험은 반응온도와 시간을 62°C와 40분으로 설정하 여 시험을 진행하였다.

RT-LAMP의 특이도

개발 RT-LAMP의 특이도를 확인하기 위하여 FMDV 11주와 Seneca A virus 및 3종의 배양세포에서 추출한 핵산을 이용하여 개발된 RT-LAMP를 실시한 결과, 전체 11주의 FMDV 시료에서 모두 육안 및 전기영동 으로 양성 증폭산물이 확인되었으며, Seneca A virus 및 배양세포 대조군에서는 증폭산물이 확인되지 않 아 개발된 RT-LAMP가 모든 혈청형의 FMDV 3D 유전 자를 특이적으로 증폭할 수 있음을 확인하였다(Fig. 2).

RT-LAMP, RT-PCR 및 qRT-PCR간 검출한계 비교 개발 RT-LAMP의 검출한계를 측정하기 위하여 공

(7)

Fig. 3. Comparison of limit of detection between RT-LAMP, RT-PCR and qRT-PCR for amplification of the foot-and-mouth disease virus RNAs.

(A) Visual detection of reverse transcription loop-mediated isothermal amplification (RT-LAMP) results. (B) Electrophoresis of reverse tran- scription polymerase chain reaction (RT-PCR) products. (C) Amplification curves of real time quantitative RT-PCR (qRT-PCR). Tubes, lanes and lines 1∼8; 10-fold serial dilutions (from 106 to 10−1 TCID50/mL) of FMDV serotype O (O/Andong/KOR/2010), A (A/Yeoncheon/KOR/2017) and Asia 1 (As1/Shamir/89), respectively; NC: negative control, M: 100 bp DNA marker.

Table 3.Comparative diagnostic efficiency between RT-PCR, qRT-PCR and RT-LAMP for the detection of different serotypes of Korean and foreign FMDV strains

Serotypes of FMDV

Results (No. of positive/tested)

RT-PCR qRT-PCR RT-LAMP

O 21/21 21/21 21/21

A 10/10 10/10 10/10

Asia 1 3/3 3/3 3/3

C 1/1 1/1 1/1

Total 35/35 35/35 35/35

RT-PCR: reverse transcription polymerase chain reaction, qRT-PCR:

real time quantitative RT-PCR, RT-LAMP: reverse transcription loop-mediated isothermal amplification.

시한 혈청형 O, A, 및 Asia 1 FMDV 배양액을 PBS로 10배수 단계 희석한 다음, 각 희석액에서 추출한 유 전자를 대상으로 RT-LAMP와 RT-PCR 및 qRT-PCR 을 실시한 결과, RT-LAMP의 검출한계는 각각 102, 103 및 103 TCID50/mL로 A 및 Asia1 혈청형에 비하여 O 혈청형의 민감도가 10배 높았다(Fig. 3A). 표준진단 법인 RT-PCR의 검출한계는 O, A, 및 Asia 1 혈청형 에 대하여 각각 103, 104 및 102 TCID50/mL로 O 및 A 혈청형의 경우에는 개발 RT-LAMP에 비해 10배 낮은 민감도를 나타낸 반면에 Asia 1 혈청형에 대해서는 개발 RT-LAMP보다 10배 높은 민감도를 나타내었다 (Fig. 3B). qRT-PCR의 검출한계는 O, A, 및 Asia 1 혈 청형에 대하여 각각 101, 102 및 103 TCID50/mL로 개 발 RT-LAMP에 비해 동일하거나(Asia 1 혈청형) 10배 (O 및 A 혈청형) 높은 민감도를 나타내었다(Fig. 3C).

국내ㆍ외 FMDV 분리주를 이용한 진단법간 검출효율 비교

국내ㆍ외 FMDV 분리주 총 35주(O 혈청형 21주, A 혈청형 10주, Asia 1 혈청형 3주 및 C 혈청형 1주)를 대상으로 개발 RT-LAMP와 표준 RT-PCR 및 qRT-PCR 을 실시하여 진단효율을 비교한 결과, 개발 RT-LAMP 와 RT-PCR 및 qRT-PCR 공히 공시한 FMDV 시료에서 모두 양성반응을 나타내어 개발 RT-LAMP가 표준 RT-PCR이나 qRT-PCR과 동일하게 공시한 O, A 및

Asia 1 혈청형의 FMDV를 특이적으로 진단할 수 있 음을 확인하였다(Table 3).

고 찰

FMD는 전파속도가 매우 빠른 질병이기 때문에 발 생 당시 질병 확산을 효과적으로 통제하기 위해서는 신속하면서도 정확한 진단법의 개발 및 적용이 필수 적이며(OIE, 2016), 현재 이를 위하여 RT-PCR이나 qRT-PCR과 같은 PCR 기반 실험실 진단법들이 보편 적으로 이용되고 있다(Reid 등, 2000; Callahan 등, 2002;

OIE, 2016). PCR 기반의 실험실 진단법은 일단 실험

(8)

실에 시료가 도착하면 수 시간 이내에 신속 정확하게 검사결과를 확인할 수 있지만 검사시료를 실험실로 수송하는 데 따른 번거로움은 물론 현장에서의 진단 즉시 즉각적인 방역대책 적용이 곤란한 문제점이 있 다(Howson 등, 2017). 이러한 문제점을 해결하기 위 하여 FMD 감염이 의심되는 현장에서 바로 RNA 추 출과 qRT-PCR을 수행하여 검사결과를 도출할 수 있 는 이동식 진단시스템이 보고된 바 있으나(Madi 등, 2012; Howson 등, 2015) PCR 기반 진단법의 특성상 고가의 PCR 증폭장비를 현장에서 구동하여야 한다 는 한계가 있어 왔다. RT-LAMP와 같은 등온증폭법 은 반응 온도의 변화 없이 일정한 온도 즉, 등온에서 목표 유전자의 증폭이 가능하기 때문에 PCR 기반 진 단법의 한계점을 극복할 수 있는 대안으로 인식되고 있으며, 실제 FMD 발생현장에서 유용하게 활용될 수 있음이 증명되었다(Abd El Wahed 등, 2013; Howson 등, 2015). 또한 최근 Howson 등(2017)이 다양한 FMDV 현장시료에 대하여 RT-LAMP의 현장진단법으로서의 효용성을 검토한 결과, RT-LAMP의 검출 민감도는 RNA 추출과정을 거칠 경우에는 기존의 qRT-PCR과 유사하였으며, RNA 추출 과정 없이도 10배 정도의 민감도 감소 수준에서 FMDV의 RNA를 성공적으로 검출할 수 있어 실험실진단법은 물론 현장진단법으 로서의 효용성이 높다고 보고한 바 있다.

이와 같이 RT-LAMP가 FMDV 진단에 있어 기존 PCR 기반 진단법을 대체할 수 있는 장점을 가지고 있어 해외에서 여러 연구자들에 의해 FMDV 진단용 RT-LAMP가 개발되어 왔음에도 불구하고 아직 한국 에서는 FMDV 진단을 위한 RT-LAMP 개발에 대한 보고가 없다(Duke 등, 2006; Shao 등, 2010; Chen 등, 2011a; Chen 등, 2011b; Guan 등, 2013; Madhanmohan 등, 2013; Yamazaki 등, 2013; Ding 등, 2014; Waters 등, 2014). 따라서 이 연구에서는 7개 혈청형의 FMDV 를 공통적으로 진단할 수 있는 RT-LAMP를 개발하여 기존 PCR 기반 진단법과 진단효율을 비교분석함으 로서 국내 발생 FMDV의 실험실진단법은 물론 향후 현장진단법으로서의 활용 가능성을 평가하였기에 보 고한다.

이 연구에서 개발하고자 하는 RT-LAMP는 증폭하 고자 하는 목표 유전자 염기서열의 8개 부위를 인식 하는 6종의 primer를 유전자 증폭에 이용하기 때문에 고도의 특이도를 가지는 장점이 있지만 한정된 목표 유전자 염기서열 내에서 해당 유전자에 특이적으로 반응하는 6종의 primer를 설계해야 하는 primer 설계

상의 어려움이 RT-LAMP 진단법 개발을 제한하는 요 인이 되어 왔다(Dhama 등, 2014). 특히 FMDV와 같이 다양한 혈청형과 유전형으로 진화되어 바이러스간 유전적 변이가 심한 바이러스인 경우에는 RT-LAMP 용 primer를 설계할 때 더욱 각별한 주의가 필요하다.

그간 RT-LAMP 개발자들은 7개 혈청형의 FMDV를 공통적으로 진단할 수 있는 특이 primer를 설계하기 위해 노력해왔으며, 일부는 2B 유전자(Chen 등, 2011a) 또는 P1 유전자(Madhanmohan 등, 2013)를 대상으로 설계하였으나 대부분은 FMDV의 유전자 중에서 가 장 안정하다고 알려진 3D 유전자를 대상으로 공통진 단용 primer를 설계하여 진단법을 개발하여 왔다 (Duke 등, 2006; Shao 등, 2010; Guan 등, 2013;

Yamazaki 등, 2013; Waters 등, 2014; Farooq 등, 2015).

이 연구에서도 대부분의 연구자들이 선택한 3D 유전 자를 대상으로 특이 primer를 설계하기로 하고, 2000 년 이후 GenBank에 등록된 109개의 다양한 혈청형의 FMDV 3D 유전자 염기서열을 수집하여 분석한 다음, 가장 안정적인 유전자 부위를 탐색하여 6종의 FMDV 검출용 primer set를 설계 및 제작하였다(Table 2). 설 계한 primer set를 이용하여 Table 1의 다양한 혈청형 및 지역형의 FMDV를 대상으로 RT-LAMP를 실시한 결과, 7개 혈청형의 FMDV RNA를 모두 증폭할 수 있었으며, 음성대조군에서는 증폭반응이 일어나지 않 아 개발한 RT-LAMP용 primer set가 FMDV에만 특이 적으로 작동할 뿐만 아니라 모든 혈청형의 FMDV를 검출하는데 적합함을 확인하였다(Fig. 2).

개발 RT-LAMP의 검출한계를 확인하기 위하여 O, A, 및 Asia 1 혈청형의 FMDV를 대상으로 RT-LAMP 를 실시한 결과, 개발 RT-LAMP의 검출한계는 공시 바이러스(혈청형)에 따라 차이가 있었으며, 현재 한 국에서 표준진단법으로 사용하고 있는 RT-PCR의 민 감도와 비교하였을 때 O 및 A 혈청형의 FMDV에 대 해서는 10배 더 민감한 반면에 Asia 1 혈청형에 대해 서는 10배 낮았다. 또한 qRT-PCR의 민감도에 비해서 는 개발 RT-LAMP의 민감도가 O 및 A 혈청형에 대 해서는 10배 낮았으나 Asia 1 혈청형에 대해서는 동 일한 민감도를 나타내었다(Fig. 3). 이는 이전 연구자 들이 개발한 FMDV 진단용 RT-LAMP의 민감도가 전 반적으로 RT-PCR보다는 높고, qRT-PCR보다는 낮거 나 유사하다는 보고와 일치하였다(Duke 등, 2006;

Shao 등, 2010; Chen 등, 2011a; Guan 등, 2013; Waters 등, 2014; Farooq 등, 2015). 그러나 일부 보고자들이 개발한 RT-LAMP의 민감도가 qRT-PCR에 비해 높았

(9)

다는 보고도 있어(Yamazaki 등, 2013) 향후 개발 RT-LAMP의 민감도를 개선하는 추가 연구가 필요하 다고 생각된다. 한편 Fig. 3의 결과에서 보듯이 개발 RT-LAMP와 RT-PCR 및 qRT-PCR의 민감도는 공시 바이러스(혈청형)에 따라 10∼100배 차이가 나기 때 문에 개발자가 어떤 바이러스를 대상으로 진단의 민 감도를 검증하는가에 따라 결과가 달라질 수가 있다.

따라서 향후 다양한 표준 바이러스를 이용하여 기 개 발된 진단법들의 민감도를 비교 검증하는 연구도 필 요할 것으로 생각된다. 또한 적용 진단법별로 공시 바이러스에 따른 검출 민감도가 각기 다르게 나타나 는 것이 확인되어 향후 야외 시료에 대한 FMDV 검 사 시에는 1종 이상의 진단법을 동시에 적용하는 것 이 진단의 정확도를 높일 수 있을 것으로 생각된다.

야외 FMDV 시료에 대한 개발 RT-LAMP의 진단효 율을 평가하기 위하여 농림축산검역본부의 협조를 받 아 O, A, Asia 1 혈청형 및 다양한 국내ㆍ외 FMDV 분리주 35주를 무작위로 공시하여 개발 RT-LAMP와 한국에서 현재 표준진단법으로 사용하고 있는 RT-PCR (Reid 등, 2000) 및 qRT-PCR (Callahan 등, 2002)을 각 각 실시하여 진단효율을 비교하였다. 그 결과, 개발 RT-LAMP와 RT-PCR 및 qRT-PCR의 결과가 100% 일 치하여 개발 RT-LAMP가 바이러스 시료 수준에서는 기존 PCR 기반 진단법을 충분히 대체할 수 있는 것 으로 확인되었다(Table 3). 그러나 개발 RT-LAMP의 현장 진단법으로서의 활용 가능성을 확인하기 위해 서는 향후 다양한 야외 의심시료에 대한 추가 검증이 이루어져야 할 것으로 생각된다.

유전자진단법의 증폭결과를 판독하는 방법은 해당 진단법의 효용성을 결정짓는 중요한 요소이다. 기존 RT-PCR은 증폭산물을 전기영동하여 결과를 판독해 야 하기 때문에 현장진단법으로서 활용하는 데 제한 이 있다(Reid 등, 2000; Le 등, 2011). 또한 qRT-PCR의 경우 실시간 판독을 위한 고가의 장비를 구동하여야 하기 때문에 역시 현장진단법으로서 활용에 한계가 있다(Callahan 등, 2002). 반면에 RT-LAMP의 경우에 는 판독장비를 이용한 판독뿐만 아니라 별도의 판독 장비 없이 육안으로도 증폭결과를 바로 판독할 수 있 기 때문에 실험실진단법은 물론 향후 현장진단법으 로 활용하는데 유리한 측면이 있다(Goto 등, 2009;

Zhang 등, 2014). 그간 개발된 FMDV 진단용 RT-LAMP 의 판독방법으로는 Chen 등(2011a)과 Chen 등(2011b) 은 전기영동으로, Yamazaki 등(2013)은 탁도계를 이 용한 탁도 변화로, 그리고 Duke 등(2006)와 Guan 등

(2013) 및 Shao 등(2010)은 반응 후에 DNA 염색액를 반응튜브에 첨가한 다음, 색깔 변화를 관찰하여 판독 하였다. 그러나 RT-LAMP 반응산물을 전기영동하여 판독하거나 반응산물에 DNA 염색액을 첨가하여 확 인하는 방법은 반응산물을 직접 취급하거나 반응 튜 브를 개봉하여 염색액을 첨가해야하기 때문에 대량 으로 증폭된 DNA가 실험실 환경을 오염시켜 다음 LAMP 과정에서 핵산 오염에 의한 오증폭을 유발할 가능성이 높다. 또한 LAMP 반응산물의 탁도 변화를 관찰하여 판독하는 방법은 실험자에 따라 판독에 오 류를 유발할 가능성 있어 문제점으로 지적되어 왔다 (Zhang 등, 2014). 이 연구에서는 Goto 등(2009)과 Farooq 등(2015)이 보고한 HNB를 사전에 반응액에 첨가하여 반응결과를 육안으로 판독하는 방법을 이용하였으며, 그 결과, Fig. 2와 같이 음성인 보라색과 양성인 연청 색의 반응액 색깔 변화를 육안으로 바로 판독할 수 있었다. 특히 HNB는 RT-LAMP 이전의 반응액에 혼 합하여 반응을 수행할 수 있고, 반응이 끝난 후 바로 판독이 가능하기 때문에 반응튜브의 개봉 및 증폭산 물의 취급에 따른 오염문제를 원천적으로 차단할 수 있어 이전의 FMDV 진단용 RT-LAMP 방법과 비교할 때 더욱 활용도가 높을 것으로 생각된다. 한편, 진단 의 신속성에 있어서 이 연구에서 개발한 RT-LAMP는 40분 안에 전체 증폭반응 및 판독이 가능한 반면에 기존 RT-PCR은 별도의 전기영동 판독과정을 제외하 고도 약 3시간의 반응시간이 소요되었으며, qRT-PCR 은 증폭 및 판독에 약 1.5시간이 소요되어 개발 RT-LAMP가 진단 소요시간에 있어서도 강점이 있을 것으로 판단된다.

결 론

이 연구를 통하여 민감도와 특이도가 높으면서도 신속하게 모든 혈청형의 FMDV를 진단할 수 있는 RT-LAMP 진단법을 개발하였다. 개발 RT-LAMP는 62°C에서 40분간 반응으로 진단이 완료되었으며, HNB 를 이용함으로써 반응결과를 별다른 처리 과정 없이 바로 육안으로 판독할 수 있었다. 개발 RT-LAMP는 7개 혈청형의 FMDV RNA를 모두 증폭한 반면에 유 사 바이러스와 배양세포 대조군에서는 증폭반응이 일어나지 않아 모든 혈청형의 FMDV에 대하여 특이 적으로 반응함을 확인하였다. 개발 RT-LAMP의 검출 한계는 O, A 및 Asia 1 혈청형의 FMDV에 대하여 각

(10)

각 102, 103 and 103 TCID50/mL로 기존의 RT-PCR에 비해 유사하거나 높았으며, qRT-PCR에 비해서는 다 소 낮았다. 국내ㆍ외 다양한 혈청형의 FMDV를 대상 으로 개발 RT-LAMP와 RT-PCR 및 qRT-PCR을 실시 한 결과, 개발 RT-LAMP는 공시한 모든 혈청형의 FMDV를 모두 특이적으로 검출하였으며, RT-PCR 및 qRT-PCR의 결과와 100% (35/35) 일치하였다. 개발 RT-LAMP는 등온조건하에서 비교적 짧은 시간에 검 사가 완료되기 때문에 기존의 RT-PCR이나 qRT-PCR 을 대체할 수 있는 FMDV 진단법으로 유용하게 활용 될 수 있을 것으로 기대된다.

감사의 글

이 연구는 농림축산검역본부 학술연구용역과제(과 제번호 Z-1543082-2017-18-01) 및 농림축산식품부ㆍ 해양수산부ㆍ농촌진흥청ㆍ산림청 Golden Seed 프로 젝트 사업 (과제번호 PJ01281801 및 213010-05-2-SB610) 의 연구비를 지원 받아 수행되었습니다.

REFERENCES

Abd El Wahed A, El-Deeb A, El-Tholoth M, Abd El Kader H, Ahmed A, Hassan S, Hoffmann B, Haas B, Shalaby MA, Hufert FT, Weidmann M. 2013. A portable reverse transcription recombinase polymerase amplification as- say for rapid detection of foot-and-mouth virus. PLoS One 8: e71642.

Brito BP, Rodriguez LL, Hammond JM, Pinto J, Perez AM.

2017. Review of the global distribution of foot-and- mouth disease virus from 2007 to 2014. Transbound Emerg Dis 64: 316-332.

Callahan JD, Brown F, Osorio FA, Sur JH, Kramer E, Long GW, Lubroth J, Ellis SJ, Shoulars KS, Gaffney KL, Rock DL, Nelson WM. 2002. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. J Am Vet Med Assoc 220: 1636-1642.

Chen HT, Zhang J, Liu YS, Liu XT. 2011a. Detection of foot-and-mouth disease virus RNA by reverse tran- scription loop-mediated isothermal amplification. Virol J 8: 510.

Chen HT, Zhang J, Liu YS, Liu XT. 2011b. Rapid typing of foot-and-mouth disease serotype Asia 1 by reverse tran- scription loop-mediated isothermal amplification. Virol J 8: 489.

Cho HS and Park NY. 2005. Detection of canine distemper virus

in blood samples by reverse transcription loop-mediated isothermal amplification. J Vet Med B 52: 410-413.

Dhama K, Karthik K, Chakraborty S, Tiwari R, Kapoor S, Kumar A, Thomas P, 2014. Loop-mediated isothermal amplifi- cation of DNA (LAMP): a new diagnostic tool lights the world of diagnosis of animal and human pathogens: a review. Pak J Biol Sci 17: 151-166.

Ding YZ, Zhou JH, Ma LN, Qi YN, Wei G, Zhang J, Zhang YG.

2014. A reverse transcription loop-mediated isothermal amplification assay to rapidly diagnose foot-and-mouth disease virus C. J Vet Sci 15: 423-426.

Dong HJ, Cho AR, Hahn TW. Cho S. 2014. Development of a multiplex loop-mediated isothermal amplification assay to detect shiga toxin-producing Escherichia coli in cattle.

J Vet Sci 15: 317-325.

Dukes JP, King DP, Alexandersen S. 2006. Novel reverse tran- scription loop-mediated isothermal amplification for rap- id detection of foot-and-mouth disease virus. Arch Virol 151: 1093-1106.

Farooq U, Latif A, Irshad H, Ullah A, Zahur AB, Naeem K, Khan SUH, Ahmed Z, Rodriguez L, and Smoliga G.

2015. Loop-mediated isothermal amplification (RT-LAMP):

a new approach for the detection of foot-and-mouth dis- ease virus and its sero-types in Pakistan. Iranian J Vet Res 16: 331-334.

Goto M, Honda E, Ogura A, Nomoto A, Hanaki K. 2009.

Colorimetric detection of loop-mediated isothermal am- plification reaction by using hydroxy naphthol blue.

Biotechniques 46: 167-172.

Guan H, Li Z, Yin X, Zhang Y, Gao P, Bai Y, Liu J. 2013.

Rapid detection and differentiation of foot and mouth disease virus serotypes by antigen-capture reverse tran- scription loop-mediated isothermal amplification. Asian J Ani Vet Adv 8: 647-654.

Howson ELA, Armson B, Madi M, Kasanga CJ, Kandusi S, Sallu R, Chepkwony E, Siddle A, Martin P, Wood J, Mioulet V, King DP, Lembo T, Cleaveland S, Fowler VL. 2015.

Evaluation of two lyophilized molecular assays to rap- idly detect foot-and-mouth disease virus directly from clinical samples in field settings. Transbound Emerg Dis.

Howson ELA, Kurosaki Y, Yasuda J, Takahashi M, Goto H, Gray AR, Mioulet V, King DP, Fowler VL. 2017.

Defining the relative performance of isothermal assays that can be used for rapid and sensitive detection of foot-and-mouth disease virus. J Virol Methods 249:

102-110.

Hwang ES, Lee TU, Jung EY, Cho HS. 2011. Development of loop-mediated isothermal amplification method for the rapid and sensitive detection of bovine tuberculosis in Korea native cattle. Korean J Vet Serv 34: 333-339.

Jamel SM, Belsham GJ, 2013. Food-and-mouth disease: past, present and future. Vet Res 44: 116.

Kim EM, Jeon HS, Kim JJ, Kim HJ, Shin YK, Song JY, Yeo SG, Park CK. 2015. Loop-mediated isothermal amplifi- cation assay for the rapid detection of swine influenza

(11)

virus. Korean J Vet Serv 38: 107-116.

Kim EM, Jeon HS, Kim JJ, Shin YK, Lee YJ, Yeo SG, Park CK.

2016. Uracil-DNA glycosylase-treated reverse tran- scription loop-mediated isothermal amplification for rap- id detection of avian influenza virus preventing car- ry-over contamination. J Vet Sci 17: 421-425.

Kim T, Ryoo S, Nah JJ, Sagong MG, Lee S, Lee KN, Ko YJ, Park JH, Lee MH, Wee SH, Tark D, Ku BK. 2017.

Complete genome sequence of a foot-and-mouth disease virus of serotype O, isolated from Gochang, Republic of Korea, in 2016. Genome Announc 5: e01671-16.

Knowles NJ, Samuel AR. 2003. Molecular epidemiology of foot-and-mouth disease virus. Virus Res 91: 65-80.

Koh BRD, Kim JM, Sung CM, Ji TK, Na HM, Park SD, Kim YH, Kim ES. 2013. Loop-mediated isothermal amplifi- cation assay for differentiation of Mycobacterium bovis and M. tuberculosis. Korean J Vet Serv 36: 79-86.

Le VP, Lee KN, Nguyen T, Kim SM, Cho IS, Khang DD, hien NB, Quyen DV, Park JH. 2012. A rapid molecular strat- egy for early detection and characterization of Vietnamese foot-and-mouth disease virus serotypes O, A, and Asia 1. J Virol Methods 180: 1-6.

Le VP, Lee KN, Nguyen T, Kim SM, Cho IS, Quyen DV, Khang DD, Park JH. 2011. Development of one-step multiplex RT-PCR method for simultaneous detection and differ- entiation of foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in Vietnam. J Virol Methods 175:

101-108.

Madhanmohan M, Nagendrakumar SB, Manikumar K, Yuvaraj S, Parida S, Srinivasan VA. 2013. Development and evalu- ation of a real-time reverse transcription-loop-mediated isothermal amplification assay for rapid serotyping of foot-and-mouth disease virus. J Virol Methods 187:

195-202.

Madi M, Hamilton A, Squirrell D, Mioulet V, Evans P, Lee M, King DP. 2012. Rapid detection of foot-and-mouth dis- ease virus using a field-portable nucleic acid extraction and real-time PCR amplification platform. Vet J 193:

67-72.

Mori Y, Notomi T. 2009. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J Infect Chemother 15:

62-69.

Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. 2000. Loop-mediated isothermal am- plification of DNA. Nucleic Acids Research 28: 63-69.

Office International des Epizooties (OIE), 2016. Foot and Mouth Disease, OIE Terrestrial Mannual, pp. 1-31 (Chapter 2.1.8).

Office International des Epizooties (OIE), 2017. Weekly Disease Information, https://www.oie.int/wahis_2/public/wahid.php/

Diseaseinformation/WI.

Park JH, Lee KN, Ko YJ, Kim SM, Lee HS, Shin YK, Sohn HJ,

Park JY, Yeh JY, Lee YH, Kim MJ, Joo YS, Yoon H, Yoon SS, Cho IS, Kim B. 2013. Control of foot- and-mouth disease during 2010-2011 epidemic, South Korea. Emerg Infect Dis 19: 655-659.

Park JH, Tark D, Lee KN, Lee SY, Ko MK, Lee HS, Kim SM, Ko YJ, Seo MG, Chun JE, Lee MH, Kim B. 2016.

Novel foot-and-mouth disease virus in Korea, July- August 2014. Clin Exp Vaccine Res 5: 83-87.

Park JY, Park S, Park YR, Kang DY, Kim EM, Jeon HS, Kim JJ, Kim WI, Lee KT, Kim SH, Lee KK, Park CK. 2016.

Reverse-transcription loop-mediated isothermal amplifi- cation (RT-LAMP) assay for the visual detection of European and North American porcine reproductive and respiratory syndrome viruses. J Virol Methods 237:

10-13.

Park YR, Kim EM, Han DH, Kang DY, Yeo SG, Park CK. 2017.

Reverse transcription loop-mediated isothermal amplifi- cation assay for the rapid and simultaneous detection of H5 and other subtypes of avian influenza viruses.

Korean J Vet Serv 40: 15-20.

Reid SM, Ferris NP, Hutchings GH, Samuel AR, Knowles NJ.

2000. Primary diagnosis of foot-and-mouth disease by reverse transcription polymerase chain reaction. J Virol Methods 89: 167-176.

Shao JJ, Chang HY, Zhou GQ, Cong GZ, Du JZ, Lin T, Gao SD, He JJ, Liu XT, Liu JX, Gao JL. 2010. Rapid detection of foot-and-mouth disease virus by reverse transcription loop-mediated isothermal amplification (RT-LAMP). Int J Appl Res Vet Med 8: 133-142.

Shin JH, Sohn HJ, Choi KS, Kwon BJ, Choi CU, Kim JH, Hwang EK, Park JH, Kim JY, Choi SH, Kim OK. 2003.

Identification and isolation of foot-and-mouth disease vi- rus from primary suspect cases in Korea in 2000. J Vet Med Sci 65: 1-7.

Waters RA, Fowler VL, Armson B, Nelson N, Gloster J, Paton DJ, King DP. 2014. Preliminary validation of direct de- tection of foot-and-mouth disease virus within clinical samples using reverse transcription loop-mediated iso- thermal amplification coupled with a simple lateral flow device for detection. PLoS One 9: e105630.

Wee SH, Park JY, Joo YS, Lee JH, An SH. 2004. Control meas- ures implemented during the 2002 foot-and-mouth dis- ease outbreak in the Republic of Korea. Vet Rec 154:

598-600.

Yamazaki W, Mioulet V, Murray L, Madi M, Haga T, Misawa N, Horii Y, King DP. 2013. Development and evaluation of multiplex RT-LAMP assays for rapid and sensitive detection of foot-and-mouth disease virus. J Virol Methods 192: 18-24.

Zhang X, Lowe SB, Gooding JJ. 2014. Brief review of monitor- ing methods for loop-mediated isothermal amplification (LAMP). Biosens and Bioelect 61: 491-499.

수치

Table 1. Virus strains used in this study
Table 2. Primers and probe used in this study
Fig. 1. Optimization of reverse transcription loop-mediated isothermal amplification (RT-LAMP) condition for amplification of the FMDV RNA  with different reaction temperatures (A and B) and reaction times (C and D)
Table 3. Comparative diagnostic efficiency between RT-PCR,  qRT-PCR and RT-LAMP for the detection of different serotypes of  Korean and foreign FMDV strains

참조

관련 문서

The aim of this study was to eval- uate the performance of the loop-mediated isothermal amplification kit (TB-LAMP) for TB diagnosis compared with conventional and molecular

Key words: MRSA (methicillin resistant Staphylococcus aureus), LAMP (loop mediated isothermal amplification), SYBR Green I, Bio-chip..

In this study, we evaluated the clinical diagnostic performances of a commercial real-time reverse transcription loop-mediated isothermal amplification (RRT-LAMP)

Detection limit of the loop-mediated isothermal amplifi- cation (A and B), polymerase chain reaction (PCR) (C) and real time PCR (D) for amplification of the porcine

A novel and more sensitive loop-mediated iso- thermal amplification assay targeting IS6110 for de- tection of Mycobacterium tuberculosis complex.. A rapid

Loop-mediated isothermal amplification (LAMP) was developed to detect Mycobacterium tuberculosis complex (MTC) and non-tuberculous mycobacterium (NTM) genomic DNA in blood

Loop-mediated isothermal amplification (LAMP) reaction results on five individuals of three rice planthoppers, white-backed planthopper (WBPH; Sogatella furcifera),

Loop-Mediated Isothermal Amplification (LAMP)법을 이용한 Pectobacterium carotovorum subsp.. carotovorum is the causative agent of soft rot in crops such as potato