• 검색 결과가 없습니다.

Effect of Fibroblast Growth Factor 23 on Osteoblastic Differentiation and Mineralization of D1 Mesenchymal Stem Cells

N/A
N/A
Protected

Academic year: 2021

Share "Effect of Fibroblast Growth Factor 23 on Osteoblastic Differentiation and Mineralization of D1 Mesenchymal Stem Cells"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

Effect of Fibroblast Growth Factor 23 on Osteoblastic Differentiation and Mineralization of D1 Mesenchymal Stem Cells

Kyeong-Lok Park*

Department of Dentistry, Kosin University Gospel Hospital, Busan 602-702, Korea

Received November 11, 2015 /Revised January 22, 2016 /Accepted March 17, 2016

Although fibroblast growth factor 23 (FGF23) is exclusively produced in osteoblasts and osteocytes, its main target is the kidney, where it decreases phosphate reabsorption by suppressing Na-phosphate cotransporters. Independently of its action on phosphate homeostasis, FGF23 also inhibits bone for- mation in vivo. In a calvarial osteoblastic cell model, FGF23 was shown to negatively affect ex- tracellular matrix mineralization. This study investigated whether FGF23 had similar effects on osteo- blast maturation, including differentiation and mineralization of bone marrow-derived mesenchymal stem cells (MSCs). D1 MSCs were cultured in an osteogenic medium containing β-glycerophosphate, ascorbic acid, and dexamethazone. Osteoblastic differentiation was evaluated by alkaline phosphatase (Alp) staining, and matrix mineralization was evaluated by alizarin red staining and calcium deposition. The expression of differentiation-stimulating genes Runx2, Alp, and osteocalcin and mineral- ization-inhibiting genes Enpp1 and Ank was analyzed using semiquantitative RT-PCR. Supraphysiological doses of FGF23 did not stimulate proliferation or osteoblastic differentiation of MSCs. Matrix minerali- zation 1, 2, and 3 weeks after the FGF23 treatment did not vary between control and FGF23 groups, although time-dependent enhancement of mineralization was obvious. Calcium deposition was also unchanged after the FGF23 treatment. mRNA expression levels of differentiation- and mineraliza- tion-related genes were also similar between the groups. Despite these negative findings, FGF23 sig- naling through FGF receptors seemed to function normally, with phosphorylation of the Erk protein more evident in the FGF23 group than in controls. These findings suggest that unlike calvarial osteo- blasts, FGF23 is not likely to affect osteoblastic differentiation and mineralization of MSCs.

Key words : Differentiation, fibroblast growth factor 23, mesenchymal stem cell, mineralization

*Corresponding author

*Tel : +82-51-990-5150, Fax : +82-51-990-3029

*E-mail : [email protected]

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Journal of Life Science 2016 Vol. 26. No. 3. 331~337 DOI : http://dx.doi.org/10.5352/JLS.2016.26.3.331

서 론

Fibroblast growth factor 23 (FGF23)은 fibroblast growth factor 계열에 속하지만 독특하게도 호르몬의 특성을 갖고 있 다. 이것은 주로 골격 조직의 조골세포(osteoblast)에서 생성되 어 혈류를 통해 전신 순환되며, 체내 무기인산염(inorganic phosphate, Pi)의 항상성 유지에 중요한 역할을 담당한다[13, 21]. 인산염은 칼슘과 복합체를 형성하여 수산화인회석 (hydroxyapatite)을 만들어 뼈와 치아의 광화(mineralization) 나 병적인 상태에서 연부조직의 석회화(calcification)에 중요 한 역할을 담당하는 전해질이다. 혈액의 인산염 조절은 주로 신장에서 이루어지기 때문에 FGF23의 주된 표적 기관은 신장 이다. FGF23은 신장과 소장에 분포하는 Na-Pi 공동수송체

(cotransporter)의 발현을 감소시켜 인산염 재흡수를 감소시키 고, 다른 한편으로는 신장에서 1α-hydroxylase의 합성을 억제 시켜 활성비타민 D3인 1,25(OH)2D3의 생성을 감소시킴으로 써 간접적으로 소장에서 인산염 흡수를 저해한다[3, 12, 15].

드물긴 하지만 인산뇨성 간엽조직 종양(phosphaturic mesen- chymal tumor)에 의한 골연화증(osteomalacia)나 X 염색체 연 관 저인산혈증(X-linked hypophosphatemia, XLH)에 의한 구 루병에서 FGF23의 생성이 증가되어 있다[7, 26]. 또한 FGF23 유전자가 결여된 마우스는 혈중 인산염 농도가 증가하지만 역설적으로 피질골의 무기질 함량이 감소하며, FGF23이 과발 현된 마우스는 인산염 농도가 감소하고 골연화증을 나타낸다 [9, 18]. 따라서 FGF23은 혈액의 인산염의 조절과는 무관하게 뼈의 성숙과 광화에 부정적인(negative) 영향을 미칠 것으로 추정하고 있다. 그러나 in vivo에서 보여준 뼈에 대한 부정적인 영향은 FGF23 이외에 부갑상샘 호르몬, 비타민 D3 등 여러 요인들의 변화가 복합적으로 나타난 결과일 수도 있다. 그리 고 골조직 및 조골세포주, 일차 배양 조골세포에 대한 FGF23 의 직접적인 영향을 조사한 연구에서 FGF23이 조골세포의 증 식에 미치는 영향은 적으나 분화에는 서로 다른 결과들이 발 표되었다[17, 23]. 반면에 조골세포의 성숙에 의한 기질 광화의 억제는 공통적으로 나타났다[17, 19, 23]. 이로 미루어 in vivo와

(2)

Table 1. Primer sequences

Gene Sequence Size

(bp)

Runx2 forward CCCTGAACTCTGCACCAAGT

reverse ATGAAATGCTTGGGAACTGC 336

Alp forward ATGGGCGTCTCCACAGTAAC

reverse TCACCCGAGTGGTAGTCACA 325

Ocn forward GCGCTCTGTCTCTCTGACCT

reverse TTTGTAGGCGGTCTTCAAGC 224

Enpp1 forward TGAGAAGAGGCTGTCCAGGT

reverse TTGGGAAACGTCTTGGTAGG 312

Ank forward CATCACCAACATAGCCATCG

reverse GGCTATCAGGGTGTGGAAGA 253

β-actin forward GACGGCCAGGTCATCACTAT

reverse CTTCTGCATCCTGTCAGCAA 216

Alp; (tissue-nonspecific) alkaline phosphatase, Ocn; osteocalcin, Enpp1; ectonucleotide pyrophosphatase/phosphodiesterase 1, Ank; progressive ankylosis

마찬가지로 in vitro에서도 FGF23의 조골세포 광화에 대한 영 향은 동일함이 확인되고 있다.

조골세포는 간엽줄기세포로부터 분화되는데, Li 등은 마우 스의 골수 유래 C3H10T1/2 간엽줄기세포주를 사용하여 FGF 23이 지방세포로의 분화를 억제하고 조골세포로의 분화를 유 도한다고 처음으로 보고하였다[10]. 그러나 이 세포에서 기질 의 광화에 대한 연구는 더 이상 진행되지 않았다. 이에 저자는 마우스의 골수에서 유래된 다른 종류의 간엽줄기세포주인 D1 세포를 사용하여 FGF23이 D1 세포의 증식, 분화 및 성숙에 따른 광화에 미치는 영향을 관련된 유전자의 발현 변화와 연 계하여 조사하였다.

재료 및 방법

세포배양

D1 세포주는 ATCC (Manassas, VA, USA)로부터 구입하였 다. 세포 배양은 Juffroy 등[8]의 방법에 의거하여 10% 혈청 (FBS, Gibco, Grand Island, NY, USA)이 함유된 DMEM-F12 (Invitrogen, Calsbad, CA, USA) 완전배지에 10 mM β-glycer- ophosphate, 50 ug/ml ascorbic acid, 10 nM dexamethasone 을 첨가한 조골배지(osteogenic medium)에 1 ng/ml, 100 ng/

ml의 사람 FGF23 (recombinant human fibroblast growth fac- tor-23, Prospec, East Brunswick, NJ, USA) 또는 vehicle을 처 리하고 37℃, 5% CO2배양 조건에서 격일로 배지를 교환하여 조골세포 분화를 유도하였다. 세포 증식과 알칼리성 탈인산효 소 (alkaline phosphatase, Alp) 염색을 시행한 실험에서는 50 ng/ml의 마우스 Klotho (R&D system, Minieapolis, MN, USA)를 별도로 첨가하였다.

세포증식

세포증식은 96-well plate (3×104/well)에 세포를 분주하고 MTT 시약(Sigma-Aldrich, St. Louis, MO, USA)을 사용하여 분주 4일째 측정하였다. FBS와 조골배지가 포함되어 있지 않 은 DMEM-F12 배지 150 μl에 MTT 용액(5 mg/ml) 15 μl를 첨가하여 37℃, 4시간 동안 반응시켰다. MTT 용액을 제거하고 dimethyl sulfoxide 150 μl를 첨가하여 37℃, 5분 동안 반응시 킨 후, 540 nm에서 흡광도를 측정하였다.

염색

Alp 염색을 위해 24-well plate (5×103 /well)에 세포를 분주 하고 조골배지에 약물을 처리하였다. 배양 1주 후 TRACP &

Alp double stain kit (TaKaRa-Korea biomedical, Seoul, Korea)를 사용하여 염색을 시행하였다. 60% acetone과 10%

methanol이 들어있는 고정액을 상온에서 5분 동안 처리한 후, 키트 내 기질 용액을 사용하여 37℃에서 40분 동안 염색을 시행하였다. Alizarin 염색 또한 상기 기술대로 세포를 분주,

배양한 다음 10% formalin 용액으로 고정하고, 2% alizarin red 용액(pH 4.0)을 어두운 곳에서 30분 동안 처리하였다. 세 포 기질의 Ca2+과 결합한 alizarin은 자황색(purple-yellow)을 나타내었다.

세포외 기질의 Ca2+측정

기질에 축적된 Ca2+ 함량을 정량적으로 분석하기 위해 6-well plate (2×105 /well)에 2주 동안 배양한 세포를 alizarin 염색한 후 0.6 N HCl 용액 0.8 ml을 첨가하여 24시간 용해시켰 다. 스크래퍼(scraper)로 세포를 긁어 모아 원심 분리한 후 상 등액을 회수하였다. Calcium (CPC) Liquicolor kit (Stanbio Lab., Boerne, TX, USA) 내에 cresolphthalein-complexone 복 합체가 함유된 용액을 사용하여 반응시키고 550 nm에서 흡광 도를 측정하여 Ca2+ 함량을 정량하였다.

RT-PCR

TRIzol 용액(Invitrogen)을 사용하여 RNA를 추출하고, 총 RNA 1 μg으로부터 cDNA를 합성하고 AccuPower® HotStart PCR PreMix (Bioneer, Daejeon, Korea)를 이용하여 standard PCR를 시행하였다. PCR 과정은 pre-denaturation; 94℃, 5분, denaturation; 95℃, 30초, annealing; 55℃, 30초, extension;

72℃, 30초, final extension; 72℃, 5분으로 시행하였다. β-actin 은 25주기로 설정하였고 나머지 primer는 32주기로 설정하였 다. 사용한 primer의 염기서열은 Table 1에 표시하였다.

Western blotting

6-well plate에 세포를 배양한 후 FGF23를 처리하기 24시간 전에 혈청이 없는 배지로 교환하였다. 이후 FGF23를 1시간

(3)

Fig. 1. Effect of FGF23 and/or Klotho on the proliferation of D1 cells. Cells were cultured in osteogenic medium con- taining different concentrations of FGF23 in the presence or absence of 50 ng/ml Klotho. Proliferation assay was performed on day 4 preconfluent cells. Data were ex- pressed as the mean ± SD of 5-6 wells in two separate experiments. Two-way ANOVA failed to demonstrate significant differences between and within groups.

Fig. 2. Differentiation of D1 cells into osteoblasts by FGF23.

Differentiation was induced for 1 week in FGF23-con- taining medium in the presence or absence of 50 ng/ml Klotho and was visualized on alkaline phosphatase staining. Levels of staining did not vary between groups. The image is representative of two different experiments.

처리하고 단백분해 억제제 혼합물(protease inhibitor mixture, G-bioscience, St. Louis, MO, USA)이 포함된 세포용해액 (RIPA buffer, Thermo-Scientific, Waltham, MA, USA)에 세포 를 스크래퍼로 모은 후 세포 균등액을 만들고 단백질 농도를 측정하였다. 30 μg의 단백질을 SDS-PAGE하여 PVDF mem- brane으로 전이시켰다. Tris-buffered saline (TBS, 25 Mm Tris, 137 Mm NaCl, 2.7 Mm KCl, pH 7.4)용액에 1% Tween- 20과 5% skim milk가 함유된 blocking 용액에서 1시간 block- ing하였다. 1차 항체로는 rabbit polyclonal Erk 2 (Santa Cruz Biotechnology, Dallas, TX, USA), rabbit polyclonal Phospho- p44/42 MAPK (Erk1/2) (Thr202/tyr204) (Cell signaling, Danvers, MA, USA), rabbit monoclonal β-actin (Cell signal- ing)를 사용하였으며, 1차 항체를 4°C에서 24시간 동안 반응시 켰다. 그리고 HRP (horseradish peroxidase conjugated)가 결 합된 2차 항체를 반응시킨 후 ECL (Advansta, Menlo Park, CA, USA)을 사용하여 단백질 발현을 관찰하였다.

통계처리

자료는 평균 ± 표준편차로 표시하였다. 집단 간의 비교를 one-way 또는 two-way ANOVA로 시행한 후 집단 내 차이는 Scheffe 검정법으로 분석하였다. p<0.05인 경우 통계적으로 유 의한 것으로 판정하였다.

결 과

세포 증식에 미치는 영향

FGF23이 D1 세포의 증식에 미치는 영향을 보기 위해 배양 4일째 preconfluent 상태에서 MTT 분석을 시행하였다. FGF23 의 작용은 FGF 수용체 1형 또는 3형과 결합하는데, 신장 근위 세관에서는 이 수용체의 보조수용체인 Klotho 또한 중요한 역할을 담당한다[11, 22]. 따라서 D1 세포에서 Klotho를 추가 한 조건과 추가하지 않은 조건에서 FGF23의 세포 증식 효과를 조사하였다. Fig. 1에서 보듯 FGF23은 고농도(100 ng/m)에서 도 세포 증식에 대한 영향은 없었을 뿐만 아니라 Klotho 추가 에 의한 영향도 관찰되지 않았다.

조골세포로의 분화에 대한 영향

FGF23에 의해 D1 세포가 조골세포로 분화되는데 어떤 영 향을 받는지 보기 위해 Fig. 1과 동일한 실험 조건에서 조골세 포 분화의 표지자(marker)인 Alp의 발현 정도를 염색을 통해 조사하였다. 조골배지에서 1주 배양한 후 Alp 염색을 시행한 결과를 Fig. 2에 나타내었다. 육안적으로 보아 Klotho 존재 시 가 부재 시보다 염색 강도가 커지는 경향을 보였지만 FGF23의 농도가 증가하더라도 Alp 활성은 대조군(FGF23: 0 ng/ml)과 비슷하였다. 배양 2주 후 시행한 염색에서도 염색의 강도가 전체적으로는 증가하였으나 1주와 마찬가지로 대조군과 차이

를 보이지 않았다(자료는 표시하지 않음).

기질의 광화에 대한 영향

조골세포의 분화와 성숙의 최종 단계는 칼슘과 인산이 기질 내에 과포화됨으로써 수산화인회석 결정을 생성하는 광화 과 정이다. 세포 배양에서 광화의 정도는 alizarin red로 염색된 소결절(nodule)의 생성에 비례한다. Fig. 1과 Fig. 2에서 보듯 Klotho는 조골세포의 성장과 분화에 영향을 미치지 않았기 때문에 광화에 대한 실험에서는 Klotho를 생략하였다. FGF23 이 기질의 광화에 미치는 영향을 1주, 2주, 3주에 걸쳐 조사한 것을 Fig. 3A에 표시하였다. 시간이 지남에 따라 소결절의 생 성은 증가하여 D1 세포로부터 조골세포로의 분화와 성숙이 증가되어 광화가 촉진됨이 관찰되었다. 그러나 FGF23에 의한

(4)

A B

Fig. 3. Mineralization of D1 cell cultures by FGF23. (A) Mineralization was visualized by alizarin red staining 1, 2, and 3 weeks after FGF23 treatment. Mineralized areas were macroscopically similar between vehicle and FGF23 groups, and became wider over time in each group. (B) Quantification of calcium deposition in the culture matrix 2 weeks after FGF23 treatment. Calcium deposition was comparable between groups. Data are expressed as the mean ± SD of three wells in each group. One-way ANOVA failed to demonstrate significant differences between groups.

Fig. 4. mRNA expression of differentiation marker genes and mineralization-inhibiting genes 1 and 2 weeks after FGF23 treatment. Runx2, Ocn and Alp genes were used as differentiation markers, while Enpp1 and Ank genes were used as mineralization inhibitors.

광화의 변화는 육안적으로 관찰되지 않았다. 소결절 생성의 차이를 보이지 않는 것이 칼슘 침착의 변화 때문인지를 조사 하기 위해 alizarin red로 염색된 세포배양을 산(acid)으로 녹 여 칼슘 함량을 조사한 결과를 Fig. 3B에 표시하였는데 FGF23 은 칼슘 침착에도 영향을 미치지 않았다.

조골세포의 분화 및 기질의 광화와 관련된 유전자에 대한 영향

간엽줄기세포로부터 조골세포로 분화되는데 Runx2와 같 은 전사인자의 발현은 매우 중요하며, 조골세포가 성숙됨에 따라 osteocalcin 발현이 증가되고, osteoid를 만드는 collgen 합성도 증가된다. 분화된 조골세포로부터 광화가 촉진될 경우 Alp 등의 발현이 증가되고, 광화가 억제될 경우 수산화인회석 생성을 저해하는 pyrophosphate와 관련된 Enpp1, Ank 등의 발현이 증가된다. Fig. 4는 FGF23이 조골세포로의 분화와 광 화와 관련된 유전자의 발현에 영향을 미치는지를 반정량적 방법으로 조사한 것이다. 앞서 분화와 광화와 관련된 염색의 결과와 유사하게 FGF23은 이와 관련된 여러 유전자의 발현에 영향을 주지 않았다.

Erk 인산화에 대한 영향

상기의 결과들은 모두 FGF23이 D1 간엽줄기세포의 조골세 포로의 분화와 성숙, 광화에 대한 영향을 주지 않음을 보여주 었다. 이러한 무영향이 마우스로부터 유래한 세포에 마우스 FGF23과 70% 상동성을 보이는 인간 FGF23을 사용함으로써 세포의 신호전달의 반응장애로부터 비롯되었는지를 확인하 기 위해 혈청이 들어있지 않은 기본배지(DMEM-F12)나 조골 배지에 FGF23을 첨가하여 Erk 인산화(phospho-Erk)를 조사 하였다. 기존 논문에 의하면 FGF23/FGF 수용체/phospho- Erk 과정은 잘 알려져 있고[17, 22], 또한 인간 FGF23에 의한

마우스 세포의 신호전달도 정상적으로 이루어짐이 밝혀져 있 다[10, 20]. Fig. 5에서 보듯 FGF23을 1 ug/ml 농도로 1시간 처리한 후 Erk 인산화는 대조군에 비해 약간 강하게 유도되었 다. 그러나 FGF23 농도를 더 증가시켜도 Erk 인산화는 더 이상 증가하지 않은 것으로 보아 FGF 수용체는 이미 포화된 것으로 여겨진다.

고 찰

본 연구는 체내 인산염 항상성을 조절하는 FGF23이 간엽줄 기세포에서 조골세포로의 증식, 분화와 성숙에 미치는 영향을

(5)

A B

Fig. 5. Erk phosphorylation by FGF23. D1 cells were serum starved for 24 hr and then in- cubated with vehicle or FGF23 (1 ng/ml) for the indicated time (A), or with varying concentrations of FGF23 for 1 hr (B) in se- rum-free medium. Erk phosphorylation was analyzed via Western blot.

관련된 유전자들의 발현과 연계하여 조사한 것이다. 세포 증 식의 측면에서 FGF23의 영향은 비슷하게 보고되고 있다. 생리 학적 범위의 FGF23 농도는 100 pg/ml 이하로 추정되는데[16, 22], Shalhoub 등에 의하면 FGF23의 농도를 1,000 ng/ml까지 증가시켜도 MC3T3 조골세포의 증식에 영향을 주지 않았으며 [17], Wang 등의 연구에서 두개골의 미성숙 조골세포에 FGF23을 과발현시킨 경우에서도 세포 증식의 효과는 보이지 않았다[23]. 반면, 골수 유래 간엽줄기세포주인 C3H10T1/2 세 포는 FGF23의 농도 1-2 ng/ml에서 세포 증식이 약간 감소하 는 것으로 보고되었다[10]. 따라서 전반적인 관점에서 FGF23 의 농도가 생리학적 범위를 훨씬 초과하더라도 세포 증식에 영향을 주지는 않는 것으로 추정되는데 본 연구도 유사한 결 과를 보였다(Fig. 1).

조골세포로의 분화는 전사인자인 Runx2, osterix 등을 비롯 하여 골 형성의 생체지표로 활용되는 Alp의 활성과 발현 및 osteocalcin 발현이 특이적으로 나타나는 것으로 보고되고 있 다[2]. 따라서 이들의 변화는 조골세포의 성장과 분화를 충실 히 반영한다. Shalhoub 등에 의하면 MC3T3 조골세포에 고농 도의 FGF23을 처리한 경우 Alp 활성이 증가하거나 변화 없으 며 Runx2와 Alp 유전자 발현은 오히려 감소하였다[17]. Wang 등에 따르면 FGF23이 과발현된 조골세포에서는 Alp 활성과 유전자, 그리고 Runx2 유전자 발현이 감소되었다[23]. 고분자 FGF2는 세포 내에만 존재하는 물질로서 세포 내에 한정된 신 호전달 기전을 통해 FGF23의 기능을 조절함으로써 골량(bone mass)과 골무기질 밀도(bone mineral density)를 감소시키는 것으로 보고된 바 있다[25]. Xiao 등은 고분자 FGF2가 과발현 된 골수 중간엽줄기세포에서 Alp 염색 양성의 정도는 대조군 과 차이가 없었지만 Runx2와 osterix 유전자의 발현은 오히려 감소한다고 보고하였다[24]. 반면 Li 등은 FGF23을 처리한 C3H10T1/2 간엽줄기세포에서 Alp 활성 및 Alp와 Runx2 유 전자의 발현이 모두 증가함을 밝힌 바 있다[10]. D1 간엽줄기 세포를 사용한 본 연구에서는 Alp 염색, Alp 와 Runx2 유전자 발현이 전혀 영향을 받지 않았는데(Fig. 2, Fig. 4), 연구자에 따라 그리고 사용된 세포의 종류 및 실험 조건에 따라 조골세 포 분화를 조절하는 요소들의 발현이 각기 다른 이유는 명확 하지 않다.

조골세포가 분화되어 완전한 성숙 단계에 이르면 기질의 광화가 진행된다. 광화는 콜라겐성 osteoid 위에 Ca-Pi 복합체 로 이루어진 수산화인회석이 침착하는 과정이다. Alp 유전자 는 조골세포의 분화 표지자로 사용되는 것 외에도 골 광화에 중요한 역할을 담당한다. Alp에 의해 phosphoethanolamine, ATP, pyrophosphate 등이 분해되어 기질 내 무기인산염의 농 도가 증가함으로써 수산화인회석 생성이 촉진된다[5, 6]. 이 중에서 pyrophosphate는 수산화인회석 표면에 작용하여 수 산화인회석의 생성 자체를 저해하는 물질인데, Enpp1은 py- rophosphate 생성을 촉진하는 효소이며 Ank는 생성된 py- rophosphate를 골기질로 이동시키는 운반 단백질이다. 따라 서 Alp, Enpp1, Ank 세 가지의 조절은 광화에 중요한 변수로 작용한다. Sitara 등은 마우스 두개골에서 분리한 1차 배양 조 골세포에 FGF23을 처리했을 때 alizarin 염색된 소결절의 수가 감소하여 광화가 억제됨을 관찰하였고, 사람의 XLH 구루병과 유사한 특성을 갖고 동시에 FGF23의 농도가 매우 증가되어 있는 Hyp 마우스로부터 분리한 조골세포에서도 광화가 감소 됨을 보고한 바 있다[20]. 그러나 이들의 연구에서 Enpp1이나 Ank 유전자의 변화는 조사되지 않았다. 현재까지 간엽줄기세 포에서 조골세포로 분화될 때 FGF23의 광화에 대한 효과를 조사한 연구는 보고된 바 없다. 골수 간엽줄기세포를 이용한 본 연구에서 FGF23은 광화에 전혀 영향을 주지 않았으며(Fig.

3), 광화에 관여하는 Alp, Enpp1, Ank 유전자 발현에도 변화 가 없었다(Fig. 4). 이처럼 광화에 대한 FGF23의 기능이 본 연 구와 다른 연구자들의 것과 확연히 다른데, 그 이유는 정확히 알 수 없지만 두개골에서 분리한 조골세포와 골수 간엽줄기세 포로부터 분화한 조골세포의 특성의 차이에서 비롯된 것으로 추정된다. 발생학적으로 두개안면골(craniofacial bone)의 형 성은 신경능(neural crest)과 중배엽(mesoderm)에서 유도되고 막내골화 과정을 통해 골화되는 반면, 사지골(appendicular bone)의 형성은 중배엽에서만 유도되고 연골내골화를 거친다 [4]. Quarto 등은 신경능에서 분화된 전두골 조골세포와 중배 엽에서 분화된 측두골 조골세포의 광화 능력과 골 재생능이 차이가 있음을 보여 주었다[14]. 이러한 결과는 골수 유래 조골 세포와 두개골 유래 조골세포가 증식, 분화, 기질 형성과 광화 가 다를 수 있음을 암시한다[1].

(6)

결론적으로 간엽줄기세포에서 FGF23은 세포 내 신호전달 과정을 정상적으로 수행함에도 불구하고 조골세포로의 분화 및 기질의 광화, 그리고 이와 관련된 유전자 발현에 미치는 영향은 미약할 것으로 사료된다.

감사의 글

세포 배양을 비롯한 실험의 전체 과정을 도와주신 오다교 선생님과 통계분석에 도움을 주신 안도환 교수님께 감사드립 니다.

References

1. Akintoye, S. O., Lam, T., Shi, S., Brahim, J., Collins, M. T.

and Robey, P. G. 2006. Skeletal site-specific characterization of orofacial and iliac crest human bone marrow stromal cells in same individuals. Bone 38, 758-768.

2. Aubin, J. E. 2001. Regulation of osteoblast formation and function. Rev. Endocr. Metab. Disord. 2, 81-94.

3. Fukumoto, S. 2009. The role of bone in phosphate metabo- lism. Mol. Cell Endocrinol. 310, 63-70.

4. Helms, J. A. and Schneider, R. A. 2003. Cranial skeletal biology. Nature 423, 326-331.

5. Hessle, L., Johnson, K. A., Anderson, H. C., Narisawa, S., Sali, A., Goding, J. W., Terkeltaub, R. and Millan, J. L. 2002.

Tissue-nonspecific alkaline phosphatase and plasma cell membrane glycoprotein-1 are central antagonistic regulators of bone mineralization. Proc. Natl. Acad. Sci. USA 99, 9445- 9449.

6. Hui, M. and Tenenbaum, H. C. 1998. New face of an old enzyme: alkaline phosphatase may contribute to human tis- sue aging by inducing tissue hardening and calcification.

Anat. Rec. 253, 91-94.

7. Jonsson, K. B., Zahradnik, R., Larsson, T., White, K. E., Sugimoto, T., Imanishi, Y., Yamamoto, T., Hampson, G., Koshiyama, H., Ljunggren, O., Oba, K., Yang, I. M., Miyauchi, A., Econs, M. J., Lavigne, J. and Juppner, H. 2003.

Fibroblast growth factor 23 in oncogenic osteomalacia and X-linked hypophosphatemia. N. Engl. J. Med. 348, 1656-1663.

8. Juffroy, O., Noel, D., Delanoye, A., Viltart, O., Wolowczuk, I. and Verwaerde, C. 2009. Subcutaneous graft of D1 mouse mesenchymal stem cells leads to the formation of a bone-like structure. Differentiation 78, 223-231.

9. Larsson, T., Marsell, R., Schipani, E., Ohlsson, C., Ljunggren, O., Tenenhouse, H. S., Juppner, H. and Jonsson, K. B. 2004.

Transgenic mice expressing fibroblast growth factor 23 un- der the control of the Alpha1 (I) collagen promoter exhibit growth retardation, osteomalacia, and disturbed phosphate homeostasis. Endocrinology 145, 3087-3094.

10. Li, Y., He, X., Olauson, H., Larsson, T. E. and Lindgren, U. 2013. FGF23 affects the lineage fate determination of mes- enchymal stem cells. Calcif. Tissue Int. 93, 556-564.

11. Murali, S. K., Roschger, P., Zeitz, U., Klaushofer, K.,

Andrukhova, O. and Erben, R. G. 2016. FGF23 regulates bone mineralization in a 1,25(OH) D and Klotho-Independ- ent manner. J. Bone Miner. Res. 31, 129-142.

12. Perwad, F., Zhang, M. Y., Tenenhouse, H. S. and Portale, A. A. 2007. Fibroblast growth factor 23 impairs phosphorus and vitamin D metabolism in vivo and suppresses 25- hy- droxyvitamin D-1Alpha-hydroxylase expression in vitro.

Am. J. Physiol. Renal Physiol. 293, F1577-1583.

13. Quarles, L. D. 2012. Skeletal secretion of FGF-23 regulates phosphate and vitamin D metabolism. Nat. Rev. Endocrinol.

8, 276-286.

14. Quarto, N., Wan, D. C., Kwan, M. D., Panetta, N. J., Li, S. and Longaker, M. T. 2010. Origin matters: differences in embryonic tissue origin and Wnt signaling determine the osteogenic potential and healing capacity of frontal and pa- rietal calvarial bones. J. Bone Miner. Res. 25, 1680-1694.

15. Razzaque, M. S. and Lanske, B. 2007. The emerging role of the fibroblast growth factor-23-Klotho axis in renal regu- lation of phosphate homeostasis. J. Endocrinol. 194, 1-10.

16. Saji, F., Shigematsu, T., Sakaguchi, T., Ohya, M., Orita, H., Maeda, Y., Ooura, M., Mima, T. and Negi, S. 2010. Fibroblast growth factor 23 production in bone is directly regulated by 1{Alpha},25-dihydroxyvitamin D, but not PTH. Am. J.

Physiol. Renal Physiol. 299, F1212-1217.

17. Shalhoub, V., Ward, S. C., Sun, B., Stevens, J., Renshaw, L., Hawkins, N. and Richards, W. G. 2011. Fibroblast growth factor 23 (FGF23) and Alpha-Klotho stimulate osteoblastic MC3T3.E1 cell proliferation and inhibit mineralization.

Calcif. Tissue Int. 89, 140-150.

18. Shimada, T., Kakitani, M., Yamazaki, Y., Hasegawa, H., Takeuchi, Y., Fujita, T., Fukumoto, S., Tomizuka, K. and Yamashita, T. 2004. Targeted ablation of Fgf23 demonstrates an essential physiological role of FGF23 in phosphate and vitamin D metabolism. J. Clin. Invest. 113, 561-568.

19. Sitara, D. 2007. Correlation among hyperphosphatemia, type II sodium phosphate transporter activity, and vitamin D me- tabolism in Fgf-23 null mice. Ann. N Y Acad. Sci. 1116, 485- 493.

20. Sitara, D., Kim, S., Razzaque, M. S., Bergwitz, C., Taguchi, T., Schuler, C., Erben, R. G. and Lanske, B. 2008. Genetic evidence of serum phosphate-independent functions of FGF-23 on bone. PLoS Genet. 4, e1000154.

21. Takei, Y., Minamizaki, T. and Yoshiko, Y. 2015. Functional diversity of fibroblast growth factors in bone formation. Int.

J. Endocrinol. 2015, 729352.

22. Urakawa, I., Yamazaki, Y., Shimada, T., Iijima, K., Hasega- wa, H., Okawa, K., Fujita, T., Fukumoto, S. and Yamashita, T. 2006. Klotho converts canonical FGF receptor into a spe- cific receptor for FGF23. Nature 444, 770-774.

23. Wang, H., Yoshiko, Y., Yamamoto, R., Minamizaki, T., Kozai, K., Tanne, K., Aubin, J. E. and Maeda, N. 2008.

Overexpression of fibroblast growth factor 23 suppresses os- teoblast differentiation and matrix mineralization in vitro.

J. Bone Miner. Res. 23, 939-948.

24. Xiao, L., Esliger, A. and Hurley, M. M. 2013. Nuclear fibro- blast growth factor 2 (FGF2) isoforms inhibit bone marrow

(7)

초록:섬유모세포성장인자-23이 D1 간엽줄기세포에서 조골세포로의 분화 및 기질 광화에 미치는 영향

박경록*

(고신대학교 복음병원 치과)

섬유모세포성장인자-23(fibroblast growth factor 23, FGF23)은 뼈를 형성하는 세포에서 주로 생성되지만 그 작 용은 신장에서 이루어진다. FGF23은 신장의 나트륨-인산염 공동수송체(Na-phosphate cotransporter)를 억제하여 인산염 재흡수를 감소시킨다. 이렇게 함으로써 인산염 항상성을 조절하는 작용과는 별개로 이것은 in vivo에서 뼈 형성을 억제하는 것으로 알려져 있다. 두개골 조골세포를 이용한 연구에서도 FGF23은 조골세포의 발달, 즉 분화 및 기질의 광화(mineralization)에 악영향을 미쳤다. 본 연구는 FGF23이 골수 유래 간엽줄기세포에서 조골세 포로의 발달에 있어서도 유사한 영향을 줄 것인지를 조사한 것이다. 간엽줄기세포주인 D1 세포를 β -glycerophosphate, ascorbic acid, dexamethazone이 포함된 조골배지(osteogenic medium)에 배양하여 alkaline phosphatase (Alp) 염색으로 분화를, Alizarin red 염색과 기질의 칼슘 함량의 분석을 통해 광화를 평가하였다.

분화 촉진 유전자인 Runx2, osteocalcin, Alp와 광화 억제 유전자인 Enpp1, Ank의 발현은 RT-PCR로 분석하였다.

D1 세포의 증식과 조골세포로의 분화는 생리학적 농도를 훨씬 초과하는 FGF23의 농도에 의해서도 달라지지 않았 다. FGF23 처치 1주, 2주, 3주 후 Alizarin red 염색에 의한 광화 정도의 평가에서도 대조군과 실험군의 차이는 발견되지 않았다. 그러나 두 군 모두 시간이 경과함에 따라 광화는 증가되었다. 기질에 침착된 칼슘의 양 또한 차이가 없었다. 분화 촉진 유전자와 광화 억제 유전자의 발현도 양 군 간에 다르지 않았다. 이러한 부정적인 (negative) 결과는 FGF23에 의한 세포 내 신호전달의 장애가 아님이 Erk 인산화로 확인되었다. 이상의 결과로 미 루어 두개골의 조골세포와 달리 FGF23은 간엽줄기세포에서 조골세포로의 분화와 광화에는 영향을 미치지 않을 것으로 사료된다.

stromal cell mineralization through FGF23/FGFR/MAPK in vitro. J. Bone Miner. Res. 28, 35-45.

25. Xiao, L., Naganawa, T., Lorenzo, J., Carpenter, T. O., Coffin, J. D. and Hurley, M. M. 2010. Nuclear isoforms of fibroblast growth factor 2 are novel inducers of hypophosphatemia

via modulation of FGF23 and KLOTHO. J. Biol. Chem. 285, 2834-2846.

26. Zadik, Y. and Nitzan, D. W. 2012. Tumor induced osteoma- lacia: a forgotten paraneoplastic syndrome? Oral Oncol. 48, e9-10.

수치

Table  1.  Primer  sequences
Fig.  1.  Effect  of  FGF23  and/or  Klotho  on  the  proliferation  of  D1  cells.  Cells  were  cultured  in  osteogenic  medium   con-taining  different  concentrations  of  FGF23  in  the  presence  or  absence  of  50  ng/ml  Klotho
Fig.  3.  Mineralization  of  D1  cell  cultures  by  FGF23.  (A)  Mineralization  was  visualized  by  alizarin  red  staining  1,  2,  and  3  weeks  after  FGF23  treatment
Fig.  5.  Erk  phosphorylation  by  FGF23.  D1  cells  were  serum  starved  for  24  hr  and  then   in-cubated  with  vehicle  or  FGF23  (1  ng/ml)  for  the  indicated  time  (A),  or  with  varying  concentrations  of  FGF23  for  1  hr  (B)  in   se-

참조

관련 문서

In this study of using a low-intensity ultrasound (LIUS), investigated the effects of LIUS on chondrogenic differentiation of bone marrow-derived mesenchymal stem cells (BM-MSCs)..

In this study, we attempted to transdifferentiate Wharton’s jelly-derived mesenchymal stem cells (WJ-MSCs) into male germ cells using all-trans retinoic acid

human, ADSCs: adipose tissue-derived stem cells, (-) shRNA: gene silencing using short hairpin RNA, BMPs: bone morphogenetic proteins, DPSCs: dental pulp stem cells, r: rat,

In this review, we will empathize the topographic effect as stem cell niche on the mesenchymal stem cell (MSC) response (cell attachment, prolif- eration, and

Carnosol promotes osteoblast differentiation of mouse bone marrow-derived mesenchymal stem cells (mBMSCs) through the activa- tion of bone morphogenetic protein (BMP)

Extracts from Gracilaria vermiculophylla Prevent Cellular Senescence and Improve Differentiation Potential in Replicatively Senescent Human Bone Marrow Mesenchymal Stem Cells..

Mesenchymal Stem Cells Improve Wound Healing In Vivo via Early Activation of Matrix Metalloproteinase-9 and Vascular Endothelial Growth Factor.. We investigated the effects

Induction of osteogenic differentiation of human mesenchymal stem cells by histone deacetylase inhibitors.. Genome-scale DNA methylation pattern profiling of human