• 검색 결과가 없습니다.

재래돼지에서 6개 SNP와 경제형질, 고기품질 간의 연관성 분석

N/A
N/A
Protected

Academic year: 2021

Share "재래돼지에서 6개 SNP와 경제형질, 고기품질 간의 연관성 분석"

Copied!
8
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

www.earticle.net

재래돼지에서 6개 SNP와 경제형질, 고기품질 간의 연관성 분석

김훈1․김진우1․박새롬1․이영섭1․홍민욱1․이승규1․이경수1․원정일1․이정구1․이성기1․이학교2

․이성진1*

강원대학교 동물생명과학대학1, 한경대학교 생명공학과2

Association of 6 SNPs and Economic and Meat Quality Traits in Korean Native Pigs

Hun Kim1, Jin-woo Kim1, Sairom Park1, Young-Sub Lee1, Min-Wook Hong1, Seung-Kyu Lee1, Kyung Soo Lee1, Jung-Il Won1, Jeong-Koo Lee1, Sung Ki Lee1, Hak-Kyo Lee2 and Sung-Jin Lee1*

1College of Animal Life Science, Kangwon National University,

2Dept. of Biotechnology, Hankyong National University

ABSTRACT1)

The aim of this study is to investigate the genetic interrelationships between economic or meat quality traits (birth weight, weaning weight, average daily gain, market weight, carcass weight, backfat thickness, water, ash, fat, protein, water holding capacity and pH) and 6 SNPs located on six selected candidate genes (MC4R, PGK2, TNNI1, TNNI2, PIK3C3, and CTSK) in Korean native pigs. The genotypes were identified in the 6 SNPs by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) procedure, and association of the genotype on economically important traits was analyzed by general liner model. According to the analyzed results, the MC4R c.1426A>G was correlated with birth weight (p=0.032) and the PGK2 g.122T>G was associated with pH (p=0.026). These findings obtained in the present revealed that the each SNPs of MC4R and PGK2 could be useful as potential genetic markers for birth weight and pH in Korean native pigs, respectively.

(Key words: PCR-RFLP, SNP, Korean native pig, MC4R, PGK2)

Ⅰ. 서론

한국의 재래돼지는 크게 제주도에서 사육되는 제주재래 흑돼지와 한반도에서 사육되는 재래돼지로 분류되며(Yoo , 2012), 그 중 한반도에서 사육되는 재래돼지의 기원은 2000 여 년 전으로 만주지역에서 서식하던 소형종 돼지 가 고구려 시대부터 한반도로 유래, 정착된 것으로 알려져

있다. 재래돼지는 피부와 피모가 흑색으로 털이 거칠고 길 , 배가 처지고 옆구리에는 주름이 있는 외형적인 특징을 가지며 다른 특징으로 질병 저항성이 매우 뛰어난 것으로 알려져 있으며, 한 배 새끼의 수는 6~8두 정도이다. 또한 조직이 쫄깃쫄깃하고 지방은 단단하고 백색이며, 육색은 선 홍 빛을 띄고 부드러우며 향미가 좋다고 알려져 있다(Choi , 2004). 그 때문에 일부 소비자층에서 그 특유의 쫄깃함

* Corresponding author: Sung-Jin Lee, Dept. of Animal Biotechnology, College of Animal Life Sciences, Kangwon National University, Chuncheon 200-701, Korea. Tel: +82-33-250-8636, E-mail: [email protected]

This is an Open Access journal distributed under the teams of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses(by-nc/3.0) which permits unrestricted non-commercial use, and reproduction in any medium, provided the original work is properly cited.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(2)

www.earticle.net

과 부드러움, 담백함 등으로 큰 호응을 얻고 있다(Kwon 등, 2001; Cho 등, 2007b). 하지만 국내의 상업용 돈육에 비하여 사료효율이 낮으며 사육기간이 길며, 몸집이 외소하고, 지 방층이 두꺼워 경제성에서 상업용 돈육에 비해 불리할 뿐 만 아니라 유통거래방식에서 직거래에 의존하는 경우가 많 아 소비자와 생산자 모두에게 외면되고 있는 추세로 사육 규모가 많이 축소된 상태이다(Jin 등, 2001). 또한 구한말까 지 국내에서 사육되는 돼지의 주종을 차지하던 재래돼지는 일제 강점기를 거치면서 동물성 단백질의 확보 및 생산성 을 높이기 위한 방법으로 berkshire, yorkshire, landrace, duroc 등 외래품종을 도입하여 개량형 상업용 교잡 돼지가 주를 이루면서 순수한 국내 재래돼지의 수가 점점 감소하 고 있는 추세이다.

최근 분자유전학의 발전과 그에 따른 분자유전학적 기법 을 이용한 가축의 개량의 시도가 늘고 있는 동시에 우리나라 고유의 재래 품종에 대한 유전자원의 복원 및 보호에 대한 중요성이 대두되고 있으며, 이러한 재래 가축의 산업의 활성 화를 위해서 고품질의 육류와 상업적 생산성을 갖추기 위한 개량이 절실한 실정이다(Cho 등, 2007a; Jang 등, 2011).

본 연구에서는 기존에 국내외에서 이미 다른 품종 및 개 량종에서 경제형질과 연관성이 보고된 후보유전자 중 MC4R(Melanocortin 4 receptor), PGK2(Phosphoglycerate kinase 2), TNNI1(Troponin Ⅰ type 1), TNNI2(Troponin

Ⅰ type 2), PIK3C3(Phosphatidylinositol 3-kinase, catalytic subunit type 3), CTSK(Cathepsin K) 총 6가지의 후보유전 자를 선발하여 국내 재래돼지에서 경제형질과 연관성을 확 인하기 위하여 본 실험을 실시하였다. 먼저 MC4R 유전자는 돼지의 성장(growth rate)및 체조성(body composition)에 영향을 미칠 수 있는 주요한 유전자로 알려져 있으며(Kim , 2006), PGK2 유전자는 돼지의 7번 염색체에 위치하며 에너지 대사에 영향을 주어 성장률 및 출하일령에 영향을 준다고 알려져 있다(Jang 등, 2011). 또한 TNNI1, 2유전자는 근섬유와 관련된 유전자로 지방함량 및 등지방두께, 정육비 율 등과 연관성이 보고되었다(Xu 등, 2010). PIK3C3유전자 는 일당증체량, 등지방두께, 배최장근단면적에서 연관성이 보고되었고(Hirose 등, 2011), CTSK 유전자는 돼지 염색체 4번에 위치하는 유전자로서 등지방두께, 일당증체량과 연관 성이 있는 것으로 보고되었다(Fontanesi 등, 2010).

따라서 본 연구에서는 이전에 보고된 돼지의 경제형질과 연관된 후보유전자 6가지(MC4R, PGK2, TNNI1, TNNI2, PIK3C3, CTSK)를 선발하여 국내 재래돼지에 적용하여 각 후보유전자의 SNP들과 주요 경제형질간의 연관성을 확인

하여 재래돼지의 육종개량의 기초 자료로 제시하고자 본 연구를 실시하였다.

Ⅱ. 재료 및 방법

1. 공시재료 및 genomic DNA 추출

본 연구는 홍천의 재래돼지 농가에서 사육중인 재래돼지 68두의 모근을 채취하여 본 연구의 공시 축으로 선정하여 실험을 수행하였다. 재래돼지의 경제형질 자료는 생시 체중 (birth weight; BW), 이유체중(weaning weight; WW), 2주 차 일당 증체량(average daily gain 2week; ADG2), 4주차 일당 증체량(Average daily gain 4week; ADG4), 10주차 일 당 증체량(average daily gain 10week; ADG10), 18주차 일 당 증체량(average daily gain 18week; ADG18), 출하체중 (market weight; MW), 도체중(carcass weight; CW), 등지 방 두께(backfat thickness; BFT)를 이용하였고 육질형질 자 료는 수분함량, 회분, 지방함량, 단백질함량, 보습력(water holding capacity; WHC), 산도(pH)를 이용하였다. 그 중 수 분함량, 회분, 지방 및 단백질 함량 등 일반 성분 함량 분석 은 조섬유정량(AOAC)법으로 산도는 Seyfert 등(2007)의 방 법을 Hofmann 등 (1982)의 filter paper press method을 이 용하여 측정하였다. 각 공시축의 모근을 이용하여 i-genomic CTB DNA Extraction Mini kit(Intron Biotechnology, Korea)를 이용하여 DNA를 추출하였다. 추출한 genomic DNA는 Thermo사의 Nanodrop 2000 spectrophotometer를 이용하여 흡광도를 측정 후 A260, A280 약 1.8인 DNA를 1% agaross gel에서 전기영동을 실시하여 확인 후 PCR의 주형으로 이용하였다

2. 중합효소연쇄반응(polymerase chain reaction, PCR)

재래돼지에서 국내외에 알려진 유전자 마커 6종에 대한 primer의 염기서열, PCR 산물의 크기, annealing 온도에 대한 정보를 Table 1에 제시하였다. PCR 증폭을 위해 DNA 50 ng, Taq polymerase 0.5 U, dNTP 1 mM, 10 PCR buffer(50 mM Tris-HCl, pH9.0; 15 mM MgCl2)과 각 10 pM의 primer를 총 20 ㎕로 하여 PCR를 수행하였다. PCR GeneAmp PCR system 9700(Applied Biosystem, USA) 을 사용하여 증폭을 실시하였다. PCR 조건은 pre- enaturation 95℃에서 5분간을 시작으로 denaturation 95℃

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(3)

www.earticle.net

Table 1. Primer of each individual SNP of the 6 candidate genes in Korean native pigs

Gene (SNP) Primer sequences (5'→3') Product Size

(bp) Annealing temp.

(℃) Reference

MC4R (c.1426A>G)

F: TACCCTGACCATCTTGATTG

226 64 Kim et al, 2000

R: ATAGGAACAGATGATCTCTTT PGK2

(g.122T>G)

F: TTCCCAATAACGATAAAT

542 50 Jang et al, 2011

R: GATGTGGTTCCTTACTGTTCC TNNI1

(g.5174T>C)

F: GAGTGGTAGGAGATTGACGGA

190 60 Xu et al, 2010

R: GTAGCGAGCCTTCTCAGCC TNNI2

(g.1167C>T)

F: GGGTGGGACTTCGAAGGGA

425 64 Xu et al, 2010

R: AGAGGAGACAGAGTCAGGGC PIK3C3

(C2604T)

F: ATTTCGTCTAGACCTGTCCG

102 57 Hirose et al, 2011

R: TGAATCTGTTCTACCACCGC CTSK

(g.15G>A)

F: CTCAAAGGCAGACAGCAATG

361 59 Fontanesi et al, 2010

R: TCATTTTGATCCCCAAGTCA

Table 2. Details of RFLP (restriction fragment length polymorphism) of SNPs

Gene (SNP) Restriction enzyme Restriction site Activation temp. (℃)

MC4R

(c.1426A>G) TaqⅠ 5'- T / CGA -3'

3'- AGC / T -5' 65 PGK2

(g.122T>G) MboⅡ 5'- GAAGA(N)8 / -3'

3'- CTTCT(N)7 / -5' 37 TNNI1

(g.5174T>C) XbaⅠ 5'- T / CTAGA -3'

3'- AGATC / T -5' 37 TNNI2

(g.1167C>T) SmaⅠ 5'- CCC / GGG -3'

3'- GGG / CCC -5' 25 PIK3C3

(C2604T) Hpy8Ⅰ 5'- CTN / NAC -3'

3'- CAN / NTG -5' 37 CTSK

(g.15G>A) FspⅠ 5'- TGC / GCA -3'

3'- ACG / CGT -5' 37

에서 30초, annealing 50~64℃에서 30초, extension 72℃에서 10분간 실시하였다. PCR증폭 산물은 2% agarose gel에서 전 기영동을 실시하여 증폭의 여부 및 크기를 확인하였다.

3. 유전자형 분석

PCR-RFLP(restriction fragment length polymerphism)방 법을 이용하여 유전자형을 결정하였다. 증폭된 PCR 생성물 Table 2에 제시된 제한효소를 각각의 온도(TaqⅠ: 65℃, MboⅡ, XbaⅠ, MscⅠ, FspBⅠ: 37℃, SmaⅠ: 25℃에서 5시

간동안 처리하였으며, 3% agarose gel를 이용하여 전기영 동 후 UV상에서 유전자형을 결정하였다.

4. 통계분석

SNP의 유전자형 분석에서 allele frequencies는 Cervus Ver. 2.0 program(Marshall 등, 1998)을 이용하였으며 PCR-RFLP를 통하여 조사한 유전자형들과 재래돼지의 경 제형질 측정치와의 연관성을 분석하기 위해 SAS ver. 9.2를 이용하여 GLM(general liner model) 방법으로 통계분석을

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(4)

www.earticle.net

실시하였다.

통계분석에 이용한 모형은 다음과 같다. Yij= µ + Gi + Maj+ℬij

위 식에서,

Yij = 경제형질 관측치 µ = 형질의 전체평균 Gi = 유전자형의 효과 Maj = 측정 나이의 회귀변수 ij = 임의오차

를 나타낸다.

Ⅲ. 결론 및 고찰

1. 재래돼지에서 총 6개의 유전자의 PCR-RFLP

돼지에서 경제형질과 연관성이 확인된 후보유전자를 국 내 재래돼지에 적용이 가능한지 알아보기 위해 선발된 후 보유전자들의 각각의 SNP들의 유전자형을 PCR-RFLP (Polymerase chain reaction-restriction fragment length polymorphism) 방법을 이용하여 확인하였다. Table 3은 재 래돼지에서 PCR-RFLP방법을 이용하여 각 유전자 별 집단 내 유전자형 빈도와 대립유전자 빈도를 조사한 결과를 제 시하였다. 본 연구에서는 국내 재래돼지 68마리를 사용하여 실험을 하였다. 먼저 MC4R의 유전자형의 비율은 CC유전 자형은 0.78, CT는 0.19, TT는 0.03으로 나타났으며, 대립유

전자 빈도는 C대립유전자가 0.88, T대립유전자가 0.12으로 조사되었다. 다음으로 PGK2에서는 유전자형의 비율은 GG 유전자형이 0.46으로 GT유전자형이 0.36, TT유전자형이 0.18로 나타났으며, 대립유전자의 비율은 G와 T 대립유전 자형이 각각 0.64, 0.36임이 조사되었다. TNNI1의 유전자형 의 비율은 CC유전자형에서 0.97으로 CT유전자형이 0.03임 이 조사되었고 TT유전자형은 본 연구에서는 나타나지 않았 . 또한 대립유전자의 빈도는 C대립유전자가 0.98로 T대 립유전자는 0.02로 큰 차이가 남을 확인할 수 있었다.

TNNI2의 SNP의 유전자형의 비율은 CC 0.64, CT 0.31, TT 0.05의 유전자형 비율이 조사되었고 대립유전자 비율은 C 대립유전자가 0.64, T 대립유전자가 0.36으로 나타났다. 마 지막으로 CTSK유전자에서는 GG유전자형이 0.96으로 나타 났으며 GA 유전자형은 0.04로 나타났고 AA유전자형은 본 실험에서는 확인할 수 없었다.

2. 6가지 유전자의 SNP과 경제형질과의 관련성 분석

국내 재래돼지에서 6가지 후보유전자의 SNP들과 경제형 질간의 연관성의 분석은 Table 4, 5에 제시하였다. Table 4 에 제시한 경제형질은 생시체중 및 이유체중, 2주차 일당 증체량, 4주차 일당 증체량, 10주차 일당 증체량, 18주차 일 당 증체량, 생시체중, 도체중, 등지방 두께와 6가지의 후보 유전자의 SNP들과의 연관성 분석결과 MC4R의 c.1426A>G (p<0.032)에서 유의적인 차이를 확인 할 수 있었다. 이때 CC 유전자형의 평균값은 1.176 kg, CT 유전자형의 평균값 1.317 kg, TT 유전자형은 1.500 kg으로 나타나 TT 유전

Table 3. Genetic characterization based on, genotype and allele frequencies of each individual SNP in the 6 candidate genes of Korean native pigs

Gene

(SNP) No. of pig Genotype Allelic frequency

Ho1) PIC2)

AA AB BB A B

MC4R

(c.1426A>G) 64 0.78 0.19 0.03 0.88 0.12 0.188 0.195

PGK2

(g.122T>G) 66 0.46 0.36 0.18 0.64 0.36 0.364 0.356

TNNI1

(g.5174T>C) 59 0.97 0.03 0.00 0.98 0.02 0.034 0.033

TNNI2

(g.1167C>T) 61 0.64 0.31 0.05 0.80 0.20 0.311 0.273

PIK3C3

(C2604T) 65 0.46 0.35 0.19 0.64 0.36 0.354 0.355

CTSK

(g.15G>A) 68 0.96 0.04 0.00 0.98 0.02 0.044 0.042

1) Observed heterozygosity; 2) Polymorphic information contents

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(5)

www.earticle.net

자형에서 좀 더 높은 생시체중이 확인되었다.

Table 5에서는 재래돼지의 육질을 평가하는 수분함량, 회 , 지방함량, 단백질함량, 보습력), 산도와 6가지 SNP 마커 와의 연관성 분석자료를 제시하였다. 이때 사용된 수분함 , 회분, 지방 및 단백질 함량 등의 일반성분함량 분석은 조섬유정량(AOAC)법으로 산도는 Seyfert 등(2007)의 방법 Hofmann 등(1982)의 filter paper press method을 이용 하여 측정하여 나온 측정값을 이용하여 연관성 분석을 실 시하였다. 연관서 분석 결과 PGK2 유전자의 g.122T>G와 산도(p=0.026)에서 유의적 차이가 확인하였고, 이때 GG, GT, TT의 각각의 유전자형의 평균값은 5.6, 5.8, 5.5로 나타 GT유전자형에서 가장 높은 측정치의 평균값을 확인할 수 있었다.

MC4R 유전자는 에너지의 항상성 및 음식 섭취의 조절에 중추적인 역확을 하며 에너지의 중심 조절에 중요한 G-protein 쌍의 receptor를 중심으로 발현하는 것으로 알려

져 있으며(Cone, 1999; Benoit 등, 2000), 인간에서 에너지 대사와 비만과 연관성이 보고되었고(Kim 등, 1999), 가축에 서도 MC4R 유전자는 leptin 유전자와 함께 지방 축척 및 체중에 관여하는 중요한 역할을 하는 것으로 알려져 있다 (Kim 등, 2004). 또한 이전의 연구에서 다양한 종의 돼지의 MC4R의 c.1426A>G SNP이 등지방 두께, 일당증체량 및 사 료섭취량 등에서 연관성이 있음을 보고하였다(Kim 등, 2000; Henandez-Sanchez 등, 2003; Houston 등, 2004;

Meidtner 등, 2006; Kim 등, 2006; Cho 등, 2007a). 하지만 Large White 종과 Wild Boar의 F1과 MC4R의 SNP와의 연 관성 분석을 한 Park 등(2002)의 보고에서는 연관성을 확인 할 수 없었다. 본 연구에서는 재래돼지와 MC4R의 SNP과 의 연관성 분석에서 생시체중(p=0.032)에서 유의성이 확인 되었지만 각 주차별 측정한 일당 증체량에서 그리고 등지 방 두께에서는 연관성을 확인 할 수 없었다. 이러한 차이는 강력한 후보유전자라도 집단과 품종에 따라 미치는 영향의

Table 4. Associations of 6 genes with economic traits in Korean native pigs (n=69) Gene

(SNP)

Genotype (n)

Trait*

BW WW ADG2 ADG4 ADG10 ADG18 MW CW BFT

MC4R CC (50) 1.176±0.01b 5.242±0.21 0.164±0.01 0.135±0.01 0.338±0.01 0.430±0.01 71.700±2.50 50.267±1.90 26.333±1.80 (c.1426A>G) CT (12) 1.317±0.11ab 5.691±0.32 0.170±0.02 0.147±0.03 0.353±0.01 0.457±0.11 69.500±4.20 48.000±3.40 28.000±2.00 TT (2) 1.500±0.04a 6.600±0.41 0.150±0.17 0.145±0.01 0.395±0.02 0.470±0.31 60.800±2.20 43.000±1.20 20.000±1.10

P-value 0.032 0.192 0.950 0.719 0.436 0.356 0.525 0.578 0.541

PGK2 GG (30) 1.223±0.041 5.186±0.225 0.170±0.014 0.135±0.007 0.348±0.012 0.446±0.012 72.100±3.01 50.818±2.51 27.818±2.20 (g.122T>G) GT (24) 1.195±0.042 5.445±0.287 0.156±0.020 0.139±0.012 0.336±0.015 0.427±0.013 72.800±3.51 50.500±2.70 25.000±2.90 TT (12) 1.208±0.082 5.425±0.283 0.164±0.023 0.138±0.012 0.343±0.020 0.428±0.018 63.300±0.61 43.750±0.62 24.750±0.60

P-value 0.911 0.721 0.844 0.955 0.811 0.505 0.223 0.233 0.602

TNNI1 CC (57) 1.207±0.100 5.356±0.21 0.167±0.01 0.137±0.11 0.345±0.01 0.438±0.10 71.100±2.22 49.684±1.72 26.368±1.52 (g.5174T>C) CT (2) 1.100±0.100 5.300±1.82 0.161±0.12 0.130±0.01 0.310±0.1 0.390±0.10 67.4±1.26 48.000±1.26 29.000±1.21

P-value 0.523 0.951 0.930 0.838 0.491 0.320 0.713 0.831 0.706

TNNI2 CC (39) 1.210±0.100 5.249±0.2 0.149±0.1 0.134±0.01 0.341±0.01 0.435±0.10 71.800±3.2 50.333±2.51 27.167±2.10 (g.1167C>T) CT (19) 1.184±0.100 5.253±0.3 0.168±0.1 0.129±0.01 0.325±0.01 0.419±0.11 68.900±2.5 48.143±2.01 26.000±1.41 TT (3) 1.333±0.100 6.000±0.5 0.195±0.1 0.183±0.02 0.393±0.02 0.473±0.01 61.800±0.01 43.000±0.02 16.000±0.01

P-value 0.600 0.605 0.531 0.187 0.284 0.374 0.553 0.594 0.262

PIK3C3 CC (2) 1.200±0.10 5.233±0.20 0.184±0.01 0.140±0.01 0.352±0.01 0.437±0.01 72.2±3.12 50.667±2.31 26.222±2.16 (C2604T) CT (20) 1.252±0.10 5.517±0.22 0.162±0.01 0.133±0.01 0.343±0.02 0.438±0.01 68.8±3.11 48.000±2.61 25.800±1.81 TT (26) 1.150±0.10 5.300±0.44 0.125±0.01 0.141±0.03 0.324±0.01 0.433±0.01 73.0±4.12 50.500±2.53 30.500±0.51

P-value 0.451 0.711 0.121 0.853 0.484 0.978 0.702 0.728 0.655

CTSK AG (3) 1.400±0.10 6.133±0.11 0.152±0.11 0.097±0.12 0.300±0.12 0.403±0.01 67.4±0.01 49.8±0.01 30.1±0.01 (g.15G>A) GG (65) 1.209±0.01 5.294±0.21 0.162±0.13 0.139±0.11 0.343±0.11 0.437±0.01 71.0±2.06 51.9±2.01 27.3±1.61

P-value 0.170 0.252 0.847 0.125 0.289 0.385 0.937 0.953 0.901

* Trait:BW=Birth weight; WW=Weaning weight; ADG2=Average daily gain 2week; ADG4=Average daily gain 4week; ADG10=Average daily gain 10week; ADG18=Average daily gain 18week; MW=Market weight; CW=Carcass weight; BFT=Backfat thickness;

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(6)

www.earticle.net

Table 5. Means±SD of meat quality trait for Korean native pigs fatteners of different 6 genes genotype (n=7) Gene

(SNP)

Genotype (n)

Trait

Water Ash Fat Protein WHC* pH

MC4R CC (6) 73.1±0.6 1.1±0.1 5.5±0.4 20.6±0.1 31.1±1.3 5.6±0.1

(c.1426A>G) TT (1) 72.3 1.1 6.3 20.5 26.8 5.6

P-value 0.624 0.463 0.502 0.754 0.373 0.769

PGK2 GG (3) 73.9±0.8 1.0±0.1 6.4±0.1 20.4±0.1 30.8±1.8 5.6±0.1

(g.122T>G) GT (2) 72.8±0.7 1.1±0.1 5.6±0.8 20.8±0.2 33.3±1.5 5.8±0.1

TT (2) 71.8±0.9 1.1±0.1 4.6±0.1 20.6±0.1 27.7±0.8 5.5±0.1

P-value 0.311 0.551 0.083 0.215 0.192 0.026

TNNI1 CC (7) 73.0±0.5 1.1±0.3 5.6±0.4 20.6±0.1 30.6±1.2 5.6±0.1

(g.5174T>C) P-value - - - -

TNNI2 CC (4) 73.1±0.6 1.1±0.1 6.0±0.4 20.6±0.2 32.1±1.6 5.7±0.1

(g.1167C>T) CT (2) 71.8±0.9 1.1±0.1 4.6±0.1 20.6±0.1 27.7±0.8 5.5±0.1

TT (1) 74.9 0.9 6.4 20.5 30.6 5.6

P-value 0.201 0.231 0.164 0.921 0.291 0.165

PIK3C3 CC (3) 72.6±1.0 1.1±0.1 5.8±0.5 20.7±0.2 29.5±2.2 5.6±0.1

(C2604T) CT (3) 73.7±0.6 0.1±0.1 5.8±0.6 20.7±0.2 31.3±1.9 5.6±0.1

TT (1) 72.1 1.1 4.7 20.6 31.8 5.7

P-value 0.573 0.949 0.651 0.947 0.792 0.749

CTSK AA (1) 71.0 1.0 4.8 20.7 26.8 5.6

(g.15G>A) GG (6) 73.3±0.5 1.1±0.1 5.8±0.4 20.6±0.1 31.3±1.2 5.6±0.1

P-value 0.116 0.690 0.337 0.579 0.210 0.598

* WHC: Water holding capacity

차이가 있다는 것이 여러 연구에서 확인되어 지고 있다 (Drogemuller 등, 2001; Thaller 등, 2003; Cho 등, 2007).

PGK 유전자는 이황화 환원 효소로서 혈관형성 과정에서 종양의 확장과 전이에 중대한 영향을 미치는 것으로 알려 져 있으며(Lay 등, 2000), 또한 효모를 포함한 진핵 생물 효 소의 기능적인 측면에서 높은 보존력에 관여하는 것으로 알려져 있다(Mas 등, 1986). 또한 Jang 등(2011)의 연구에서 재래돼지와 Landrace 교잡종 F2와 PGK2 유전자의 SNP과 의 연관성 분석결과 생시체중 및 3주차 체중에서 유의적인 차이가 관찰되었으나 본 연구의 결과에서는 생시체중과 3 주차 체중에서 재래돼지와 연관성을 확인 할 수 없었다. 하 지만 육질에 영향을 주는 것으로 알려진(Park 등, 2002) pH 에서 연관성을 확인 할 수 있었다.

본 실험의 결과 재래돼지의 MC4R의 c.1426A>G SNP과 생시체중 (p=0.032)에서, PGK2의 g.122T> SNP과 육질의 산도 (p=0.026)에서 유의적인 영향을 미치는 것이라 사료되 어지며, 이러한 실험의 결과를 이용하여 재래돼지의 경제형 질을 개선하는데 자료로 활용될 수 있을 것이라 기대되어 지며 추후 재래돼지의 보존 및 개량을 위한 더 많은 연구가

필요할 것이라 사료된다.

Ⅳ. 요약

본 연구의 목적은 재래돼지에서 경제형질(생시체중, 이유 체중, 2주차 일당 증체량, 4주차 일당 증체량, 10주차 일당 증체량, 18주차 일당 증체량, 출하체중, 도체중, 등지방 두 , 수분함량, 회분, 지방함량, 단백질함량, 보습력, 산도)과 경제형질에 영향을 주는 것으로 알려진 6개의 후보유전자 (MC4R, PGK2, TNNI1, TNNI2, PIK3C3, CTSK)의 SNP들 간의 유전적인 연관성을 확인하고자 본 연구를 실시하였다. PCR-RFLP 방법을 이용하여 각각의 유전자들의 SNP의 유 전자형을 확인 하였다. 확인 된 각각의 SNP들의 유전자형 과 경제형질간의 연관성 분석 결과 MC4R의 c.1426A>G와 생시 체중에서 연관성을 확인 하였고(p=0.032), 또한 PGK2 유전자의 g.122T>G와 재래돼지 고기의 산도에서 유의적 차 이를 확인하였다(p=0.026). 다른 유전자들의 SNP에서는 연 관성을 확인할 수 없었다. 본 실험의 결과 MC4R과 PGK2

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(7)

www.earticle.net

SNP가 각각 재래돼지의 생시 체중과 육질의 산도에서 영향을 미치는 것이라 사료되며 추후 재래돼지의 보존 및 개량을 위해 더 많은 연구가 필요할 것이라 사료된다.

사사

본 연구는 농촌 진흥청 차세대 바이오그린21 사업(과제 번호 PJ008196, PJ008028)과 강원 산우리 재래돼지 클러스 터사업단의 지원으로 이루어 졌으며 이에 감사드립니다.

Ⅴ. References

1. Benoit, S., Schwartz, M., Baskin, D., Wood, S. C. and Seeley, R. J. 2000. CNS melancortin system involvement in the regulation of food intake. Horm. &

Behav. 37(4):299-305.

2. Cho, K. H., Kim, M. J., Choi, B. H., Jeon, G. J., Ryu, J.

W., Jung, H. J., Kim, I. C., Lee, H. K. and Jeon, G. J.

2007a. Associations of the porcine Melanocortin-4 Receptor (MC4R) Gene with growth traits in Duroc pigs. J. Anim. Sci. Tech. 49(4):437-442.

3. Cho, S. H., Park, B. Y., Kim, J. H., Kim, M. J., Seong, P. N., Kim, Y. J., Kim, D. H. and Ahn, C. N.. 2007b.

Animal products and processing : Carcass yields and meat quality by live weight of Korean native black pigs. J. Anim. Sci. Tech. 49(4):523-530.

4. Choi, Y. S. 2004. Studies on the pork quality of Korean native black pigs and its improvement through dietary manipulation. Ph. D. thesis. Kangwon National Univ., Chuncheon, Korea. pp. 1-169.

5. Cone, R. D. 1999. The centeal melancortin system and energy homeostasis. Tren. Endo. Metab. 10:211-216.

6. Drogemuller, C., Hamann, H. and Distl, O. 2001.

Candidate gene markers for litter size in different German pig lines. J Anim. Sci. 79(10):2565-2570.

7. Fontanesi, L., Speroni, C., Buttazzoni, L., Scotti, E., Dall'Olio, S., Nanni Costa, L., Davili, R. and Russo, V.

2010. The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only sus scrofa chromosome 2p mutation affecting meat

production and carcass traits in pigs: Evidence frome the effects of a cathepsin D (CTSD) gene polymorphism. American Soci. of Anim. Sci.

88:2235-2245.

8. Hernandez-Sanchez, J., Visscher, P., Plastoe, G. and Haley, C. 2003. Candidate gene analysis for quantitative traits using the transmission disequilibrium test; The example of the melanocortin 4-receptor in pigs. Genet.

164:637-644.

9. Hirose, K., Takizawa, T., Fukawa, K., Ito, T., Ueda, M., Hayashi, Y. and Tanaka, K. 2011. Association of an SNP marker in exon 24 of a class 3 phosphoinositide- 3-kinase (PIK3C3) gene with production traits in Duroc pigs. J. Anim. Sci. 82:46-51.

10. Hofmann, K., Hamm, R. and Bluchel, E. 1982..

NeunesUber die bestimmung der wasserbindung des fleisches mit hilfe der filterpapierpressmethode.

Fleischwiry. 62:87-92.

11. Houston, R. D., Cameron, N. D. and Rance, K. A.

2004. A melanocortin-4 receptor (MC4R) polymorphism is associated with performance traits in divergently selected large white pig populations. Anim. Genet.

35:386-390.

12. Jang, H. C., Kim, S. W., Lim, D. J., Kim, J. Y., Cho, K.

H., Kim, M. J., Lee, J. W., Choi, B. H. and Kim, T. H.

2011. Breeding and genetics : Association of single nucleotide polymorphism (SNP) in the PGK 2 Gene with growth traits in pigs. J. Anim. Sci. Tech.

53(1):15-22.

13. Jin, S. K., Kim, C. W., Song, Y. M., Jang, W. H., Kim, Y. B., Yeo, J. S., Kim, J. W. and Kang, K. H. 2001.

Physicochemical characteristics of longissimus muscle between the Korean native pig and Landrace. Korean J. Food Sci. Anim. Resour. 21(2):142-148.

14. Kim, K. S., Larsen, N. J. and Rothschild, M. F. 1999.

Rapid communication : linkage and. physical mapping of the porcine melanocortin 4 receptor (MC4R) gene. J. Anim. Sci. 78(3):791-792.

15. Kim, K. S., Larsen, N. J. and Rothschild, M. F. 2000.

A missense variant of the porcine melanocortin-4 reccptor (MC4R) gene is associated with fatness, growth, and feed intake traits. Mamm. Gemo.

11:131-135.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(8)

www.earticle.net

16. Kim, K. S., Reecy, J. M., Hsu, W. H., Anderson, L. L., Rothschild, M. F., 2004. Functional and phylogenetic analyses of a melanocortin-4 receptor mutation in domestic pig. Dome. Anim. Endo. 26:75-86.

17. Kim, M. J., Oh, J. D., Cho, G. H., Lee, J. H., Lee, S. S., Hong, Y. S., Jeon, K. J., Jeon, G. J. and Lee, H. K.

2006. Association between economic traits and candidate gene polymorphism in Korean native pig and duroc. Korean J. Emb. Trans. 21(4):273-280.

18. Kwon, O. S., Park, J. C. and Huh, T. Y. 2001. Korean native black pigs. Standard guideline for farmer, Rural Development Administration.

19. Lay, A. J., Jiang, X. M., Kisker, O., Flynn, E., Underwood, A., Rosemary, C. and Philip, J. H. 2000.

Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase. Nature. 208:869-873.

20. Marshall, T. C., Slate, J., Kruuk, L. E. B. and Pemberton, J. M. 1998. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol. 7:639-655.

21. Mas, M. T., Chen, C. Y., Hitzeman, R. A. and Riggs, A. D. 1986. Active human-yeast chimeric phosphoglycerate kinases engineered by domain interchange. Science. 233:788-790.

22. Meidtner, K., Wermter, A-K., Hinney, A.,

Remschmidt, H., Hebebrand, J. and Fries, R. 2006.

Association of the melanocortin 4 reccptor with feed intake and daily gain in F2 Mangalitsa X Pietrain pigs. Amim. Genet. 37:245-247.

23. Seyfert, M., Mancini, R. A., Hunt, M. C., Tang, J. and Faustman, C. 2007. Influence of carbon monoxide in package atmospheres containing oxygen on colour, reducing activity, and oxygen consumption of five bovine muscles. Meat Sci. 75:432-442.

24. Thaller, G., Kramer, W., Winter, A., Kaupe, B., Erhardt, G. and Fries, R. 2003. Effects of DGAT1 variants on milk production traits in German cattle breeds. J. Anim. Sci. 81(8):1911-1918.

25. Xu, Z. Y., Yang, H., Xiong, Y. Z., Deng, C. Y., Li, F.

E., Lei, M. G. and Zuo, B., 2010. Identification of three novel SNPs and association with carcass traits in porcine TNNI1 and TNNI2. Mol. Biol. Rep.

37:3609-3613.

26. Yoo, C. K., Lim, H. T., Han, S. H., Lee, S. S., Ko, M.

S., Kang, T. Y., Lee, J. H., Park, H. B. and Cho, I. C..

2012. QTL analysis of back fat thickness and carcass pH in an F2 intercross between Landrace and Korean native pigs. Mol. Biol. Rep. 39:8327-833.

(투고일: 2013.04.05. 수정일: 2013.05.11. 판정일: 2013.05.13.)

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

수치

Table 1. Primer of each individual SNP of the 6 candidate genes in Korean native pigs
Table 3. Genetic characterization based on, genotype and allele frequencies of each individual SNP in the 6 candidate genes of Korean native pigs
Table 4. Associations of 6 genes with economic traits in Korean native pigs (n=69) Gene
Table 5. Means±SD of meat quality trait for Korean native pigs fatteners of different 6 genes genotype (n=7) Gene

참조

관련 문서

Effects of age and/or weight at slaughter on longissimus dorsi muscle: Biochemical Traits and Sensory Quality in pigs.. Carcass yields and meat quality by live weight of Korean

X region X year-season interaction effects in the model for genetic analysis of birth, weaning, and six month weight may be important because interaction effects seem

ABSTRACT : Genetic parameters were estimated for birth weight and weaning weight from three year (1991-1993) data totalling 1100 records of 25 rams to 205 ewes of

It has been reported that dietary habits, lifestyle, genetic factor, gestational weight gain, birth weight and prepregnancy obesity of mothers are recognizable

The following phenotypic traits were included in this study; backfat thickness (BF), carcass weight (CW), fat color (FC), longissimus muscle area (LMA), meat color

Genetic trends of Hanwoo carcass traits (CWT, BFT, EMA and MAR are the means of estimated breeding values of carcass weight (kg), backfat thickness (mm), eye-muscle area (㎠)

Association of a genetic marker with blood serum insulin-like growth factor-1 concentration and growth traits in Angus

Genetic polymorphisms of the bovine Fatty acid binding protein 4 gene are significantly associated with marbling and carcass weight in Hanwoo (Korean Cattle)... Mutations of MC4R