두릅순 열수 추출물의 지방세포 분화 및 중성지방 합성 억제 효과
⁃ 연구노트 ⁃
최라영1*․이해인2*․윤경원3․함주리1․이미경1
1순천대학교 식품과학부 식품영양학전공
2목포수산식품지원센터
3순천대학교 한약자원개발학과
Inhibitory Effects of Aralia elata Sprout Hot-Water Extract on Adipocyte Differentiation and Triglyceride Synthesis in 3T3-L1 Cells
Ra-Yeong Choi1*, Hae-In Lee2*, Kyeong Won Yun3, Ju Ri Ham1, and Mi-Kyung Lee1
1Department of Food & Nutrition and 3Department of Oriental Medicine Resources, Sunchon National University
2Mokpo Marine Food-Industry Promotion Center
ABSTRACT Aralia elata Seem. is distributed widely in Korea, China, and Japan, and its sprouts (dureupsoon) are a popular edible vegetable in spring. This study evaluated the anti-obesity activity of the hot-water extract (ASE) of Aralia elata sprout in 3T3-L1 cells and its underlying mechanism. ASE did not affect the 3T3-L1 cell viability at 100, 200, and 400 μg/mL. The ASE treatment inhibited adipocytes differentiation significantly in a dose-dependent manner, and it dose-independently reduced the intracellular triglyceride levels. ASE down-regulated adipogenic gene (peroxisome proliferator-activated receptor γ) and lipogenic gene (sterol regulatory element-binding protein 1c, stearo- yl-CoA desaturase 1, diacylglycerol O-acyltransferase 2) significantly compared to the vehicle control. These results suggest that ASE could be a promising functional material for anti-obesity.
Key words: 3T3-L1, Aralia elata sprout, adipogenesis, dureupsoon, lipogenesis
Received 31 March 2020; Accepted 11 May 2020
Corresponding author: Mi-Kyung Lee, Department of Food and Nutrition, Sunchon National University, Suncheon, Jeonnam 57922, Korea
E-mail: [email protected], Phone: +82-61-750-3656
*The authors equally contributed to this study.
Author information: Ra-Yeong Choi (Graduate student), Kyeong Won Yun (Professor), Ju Ri Ham (Researcher), Mi-Kyung Lee (Professor)
서 론
비만은 지방세포의 수가 증가하거나 지방세포의 크기가 커져 체내에 지방이 과도하게 축적된 상태를 말한다(Kwon 등, 2015). 비만은 고혈압, 고지혈증, 제2형 당뇨병, 심혈관 계 질환 등 많은 만성질환의 원인이므로 심각한 공중보건문 제로 인지되고 있다. 국민건강영양조사에 따르면 2018년도 만 19세 이상 비만 유병률은 34.6%로 10년 전에 비해 4%
높아졌다(KCDC, 2018). 또한 전 세계적으로 비만은 빠르게 지속해서 증가하고 있어 비만 예방 및 비만 관련 질환 연구 역시 꾸준히 이루어지고 있다.
지방세포는 지질대사 및 체내 에너지 항상성 유지에 중요 한 역할을 하며, 지방전구세포(pre-adipocyte)인 3T3-L1 은 여러 전사인자들에 의해 지방세포(adipocyte)로 분화되
면서 세포 내 지방을 축적한다(Lee 등, 2016). 지방세포의 생성 및 분화는 CCATT/enhancer-binding protein α(C/
EBPα), peroxisome proliferator-activated receptor γ (PPARγ) 등의 전사인자에 의해 조절되는데(Jeong, 2016), 이들은 분화 후기에 발현되어 sterol regulatory element- binding protein(SREBP), fatty acid synthase(FAS) 등과 같은 adipose-specific 유전자 발현을 활성화하여 분화를 촉진하며 분화된 세포는 중성지방 축적과 같은 형태적 특징 을 가진다(Ho 등, 2013; Choi 등, 2013). 따라서 지방세포 분화 및 지방생성 억제에 효과적인 치료제가 계속 출시되고 있으나, 시중에 유통되고 있는 비만 관련 약물은 혈압상승, 심장질환 등의 부작용이 보고된 바 있어 천연물 또는 파이토 케미컬(phytochemicals)을 활용한 비만 치료제 연구가 계 속 이어지고 있다(Kazemipoor 등, 2013).
두릅나무(Aralia elata Seem.)는 두릅나무과(Araliaceae) 에 속하는 식물로 한국, 일본, 중국 등지에 널리 분포되어 있으며, 예부터 두통, 신장질환, 당뇨, 위장질환, 급・만성 간 염 개선에 효과적인 약용식물로 많이 이용되어 왔다(Yang 과 Kwak, 2016). 선행 연구들은 두릅의 함유성분으로 tri- terpenoid saponin과 sitosterol, hederagenin, choline, alkaloid, oleanolic acid, palmitic acid, linoleic acid, methyl eicosanoate, 3,4-dihydroxybenzoic acid 및 hex-
acosol 등을 보고하였다(Lee와 Jeong, 2009; Kwak과 Yang, 2016). 한편 두릅순은 특유의 향과 맛으로 봄철에 데쳐서 나물로 많이 섭취하는 인기 있는 채소로 ascorbic acid, β- carotene, retinol 등의 비타민과 K, Ca, P, Mg 등의 무기질 및 폴리페놀이 풍부하여 항산화 효능이 높다고 알려져 있다 (Lee 등, 2014; Cha 등, 2009). 두릅에 대한 생리활성 연구 는 항산화 활성(Lee 등, 2014; Cha 등, 2009), 광노화 억제 (Yang과 Kwak, 2016), 혈중 지질 저하(Chung과 Jung, 2003) 등이 있다. 또한 두릅순으로부터 분리한 사포닌이 혈 당과 콜레스테롤 함량을 저하하였다는 보고(Kim과 Im, 1999)는 있으나, 현재까지 두릅순을 활용한 다양한 생리활 성 연구는 부족한 실정이다.
따라서 본 연구에서는 두릅순 열수 추출물을 지방전구세 포인 3T3-L1에 처리하여 지방세포 분화 및 중성지방 합성 의 억제 효능을 확인하고 관련 유전자 발현 분석을 통한 기 전을 구명함으로써 항비만 소재로써의 가능성을 확인하고 자 하였다.
재료 및 방법
두릅순 열수 추출물 제조
두릅순(Aralia elata sprout)은 2018년 4월 순천지역에 서 채취하여 2주간 음건하여 분쇄기(Laboratory Blender, Waring Commercial, Fairfax, CA, USA)로 분쇄한 후 100 mesh를 통과한 분말을 사용하였다. 두릅순 분말 50 g에 증 류수 1 L를 가하여 80°C에서 3시간씩 3회 반복 추출하였다.
추출액은 0.2 μm syringe filter(Sartorius, Göttingen, Ger- many)로 여과한 후 회전농축기(EYELA Rotary Evapor- ator N-1000, Tokyo Rikakikai Co., Ltd., Tokyo, Japan) 로 농축하였다. 농축액은 동결건조기(Freeze Dryer PVTFD 10R, ilShinBioBase Co., Ltd., Yangju, Korea)로 건조한 후 시료로 사용하였다. 두릅순 열수 추출물의 수율은 27.8±
0.9%였다.
총 폴리페놀 및 총 플라보노이드 함량 측정
총 폴리페놀 함량은 이전 실험에 활용한 방법을 응용하여 측정하였다(Lee 등, 2010). 시료용액 160 μL에 Folin-Cio- calteu’s phenol 시약(Sigma-Aldrich Co., St. Louis, MO, USA) 160 μL를 첨가하여 3분간 반응시킨 후 10% sodium carbonate(Duksan Pure Chemicals Co., Ltd., Seoul, Korea) 160 μL를 가하여 암실에서 1시간 동안 방치하였다.
반응물은 microplate reader(Versamax, Molecular Devi- ces, San Jose, CA, USA)를 이용하여 700 nm에서 흡광도 를 측정하였다. 총 폴리페놀 함량은 tannic acid(Sigma- Aldrich Co.)를 이용한 표준곡선으로 g당 mg tannic acid equivalent(TAE)로 나타내었다. 총 플라보노이드 함량은 Moreno 등(2000)의 방법을 수정하여 시료용액 40 μL에 10% aluminium nitrate(Sigma-Aldrich Co.) 16 μL, 1 M
potassium acetate(Sigma-Aldrich Co.) 16 μL를 가하고 methyl alcohol(Daejung Chemicals & Metals Co., Ltd., Siheung, Korea) 328 μL를 혼합하여 암실에서 40분간 반 응시킨 후 415 nm에서 흡광도를 측정하였다. 표준물질로는 rutin(Sigma-Aldrich Co.)을 이용하여 g당 mg rutin equiv- alent(RE)로 나타내었다.
세포 배양 및 지방세포 분화 유도
3T3-L1 지방전구세포는 American Type Culture Col- lection(Manassas, VA, USA)에서 구입하여 10% newborn calf serum(Gibco, Grand Island, NY, USA)과 1% anti- biotic-antimycotic(Gibco)이 첨가된 Dulbecco’s modifi- ed Eagle’s medium(DMEM; Gibco)을 이용하여 confluent 상태가 될 때까지 37°C CO2배양기(PHC Holdings Corpo- ration, Tokyo, Japan)에서 배양하였다. 세포가 confluent 한 상태가 되면 10% fetal bovine serum(FBS; Gibco), 10 μg/mL insulin(Sigma-Aldrich Co.), 0.25 μM dexameth- asone(Sigma-Aldrich Co.), 0.5 mM 3-isobutyl-1-meth- yl-xanthine(Sigma-Aldrich Co.)이 포함된 DMEM으로 교 환하여 2일 동안 배양하였다. 2일 후에 10% FBS와 10 μg/
mL insulin이 포함된 배지로 교체한 후, 4~8일까지는 10%
FBS를 포함한 배지를 처리하여 지방세포로 분화시켰다. 두 릅순 열수 추출물은 0~8일 동안 농도별로 처리하였다.
세포생존율 측정
3T3-L1 지방전구세포는 96-well plate에 3×103 cells/
well로 분주하고 2일간 배양하여 부착시킨 후, 두릅순 열수 추출물을 농도별로 처리하고 48시간 동안 배양하였다. 배양 종료 후에 배양액을 제거하고 12% trichloroacetic acid를 분주하여 4°C에서 1시간 동안 방치하였다. 이를 증류수로 세척하고 건조한 후 0.4% sulforhodamine B(SRB; Sigma- Aldrich Co.)를 가하고 실온에서 30분간 염색하였다. 그 후 1% acetic acid(Daejung Chemicals & Metals Co., Ltd.) 로 세척하고 건조한 다음 10 mM Tris로 SRB를 용출시켰으 며 microplate reader(Versamax, Molecular Devices)를 이용하여 540 nm에서 흡광도를 측정하였다. 세포생존율은 대조군의 흡광도 값에 대한 상대적인 값을 나타내었다.
Oil Red O 염색
분화된 지방세포는 배양액을 제거하고 Dulbecco’s pho- sphate-buffered saline(D-PBS, WELGENE Inc., Gyeong- san, Korea)으로 세척한 후 10% formalin(Daejung Chem- icals & Metals Co., Ltd.)을 첨가하여 1시간 동안 세포를 고정하였다. 용액 제거 후 증류수로 세척하고 Oil Red O 실험용액으로 15분 동안 염색하였다. 이후 증류수로 세척하 고 현미경으로 분화된 세포의 사진을 촬영하였다. 마지막으 로 증류수를 제거한 후 완전히 건조시키고 isopropyl alco- hol(Daejung Chemicals & Metals Co., Ltd.)로 Oil Red
Table 1. Primer sequences for real-time PCR
Gene Full name Forward/Reverse (5′-3′)
C/EBPα DGAT2 FAS GAPDH PPARγ SCD1 SREBP1c
CCAAT/enhancer-binding protein α Diacylglycerol O-acyltransferase 2 Fatty acid synthase
Glyceraldehyde-3-phosphate dehydrogenase Peroxisome proliferator-activated receptor γ Stearoyl-CoA desaturase 1
Sterol regulatory element-binding protein 1c
CCTTGACCAAGGAGCTCTCA/GCCGAGATAAAGCCAAACA CTGGCTGATAGCTGTGCTCTACTTC/TGCGATCTCCTGCCACCTTTC TTGGAGCTAAGGCATGGTGG/GCAGTTGTCCTCTGGATGCT AAGGTCATCCCAGAGCTGAA/CTGCTTCACCACCTTCTTGA TCGCTGATGCACTGCCTATG/GAGAGGTCCACAGAGCTGAT TTCTTCATCGACTGCATGGC/ACTCAGAAGCCCAAAGCTCAG AACCTCATCCGCCACCTG/TGGTAGACAACAGCCGCATC
Table 2. Total polyphenol and total flavonoid contents of Aralia elata sprout hot-water extract
Total polyphenol
(mg TAE2)/g) Total flavonoid (mg RE3)/g) ASE1) 99.68±3.33 26.66±1.36 Values are expressed as mean±SE (n=3).
1)Aralia elata sprout hot-water extract.
2)Tannic acid equivalent.
3)Rutin equivalent.
O를 용출시켰으며 microplate reader(Versamax, Molec- ular Devices)를 이용하여 540 nm에서 흡광도를 측정하였 다.
중성지방 함량 측정
분화된 지방세포는 배양액을 제거하고 D-PBS(WELGENE Inc.)로 세척한 후 trypsin-ethylenediaminetetraacetic acid(trypsin-EDTA, Gibco)를 이용하여 세포를 모아 1,200 rpm에서 5분 동안 2회 원심분리(Fleta 5, Hanil Scientific Inc., Gimpo, Korea) 하였다. 수득한 pellet은 lysis buffer 로 용해시키고 10,000 rpm에서 5분 동안 원심분리(Mega 17R, Hanil Scientific Incc.) 하여 상층액을 회수 후 측정 kit(Asan Pharmaceutical Co., Ltd., Seoul, Korea)을 이용 하여 중성지방 함량을 측정하였다.
실시간 유전자 중합효소 연쇄반응(RT-qPCR) 분석 Total RNA는 TRIzol 시약(Invitrogen, Carlsbad, CA, USA)으로 추출하여 정제했으며, 추출된 RNA는 NanoDrop 2000(Thermo Fisher Scientific, Waltham, MA, USA)을 이용하여 정량하였다. 이후 ReverTra Ace qPCR RT mas- ter mix(Toyobo Co., Ltd., Osaka, Japan)를 사용하여 제조 사의 방법에 따라 cDNA를 합성하였고 mRNA 발현은 SYBR green PCR kit(Qiagen, Hilden, Germany)와 CFX96 TouchTM real-time PCR detection system(Bio-Rad Laboratories, Inc., Hercules, CA, USA)을 이용하여 PCR 분석을 실시하였다. 각각의 유전자 발현은 동일한 시료의 glyceraldehyde-3-phosphate dehydrogenase(GAPDH) 발현을 측정하여 보정하였으며, Ct값을 이용하여 2-∆∆CT방 법으로 계산하였다. Primer sequence는 Table 1과 같다.
통계처리
실험 결과 값은 평균±표준오차로 나타내었으며, SPSS (version 25.0, SPSS Inc., Chicago, IL, USA)를 이용하여 실험군 간의 차이는 one-way ANOVA로 분석한 후 Dun- can’s multiple range test로 사후 검증하였다. 유의성은 P<0.05 수준에서 검증하였다.
결과 및 고찰
두릅순 열수 추출물의 총 폴리페놀 및 총 플라보노이드 함량 두릅순 열수 추출물의 총 폴리페놀과 총 플라보노이드 함 량을 측정한 결과 각각 99.68±3.33 mg TAE/g과 26.66±
1.36 mg RE/g으로 나타났다(Table 2). 다양한 식물에 함유 되어 있는 2차 대사산물인 페놀성 화합물은 항산화, 항암, 항균작용 등의 생리활성 기능을 가진다고 알려져 있다 (Ferreres 등, 2009). 또한 플라보노이드는 활성산소종 (reactive oxygen species)과 활성질소종(reactive nitro- gen species)을 제거하는 항산화 효과를 가질 뿐만 아니라 단백질 및 지질 인산화 효소들의 신호전달계를 조절한다 (Lee 등, 2007). 본 실험 결과는 두릅순 건조시료의 총 폴리 페놀과 총 플라보노이드 함량이 각각 20.15±0.13 mg TAE/
g과 18.75±0.42 mg RE/g이었다는 Kwak과 Yang(2016) 의 보고와 두릅순 물 추출물의 4.68%가 총 폴리페놀 화합물 이라는 Cha 등(2009)의 결과보다 높은 함량이었다. 한편 Lee 등(2014)은 두릅순 에탄올 추출물의 총 폴리페놀 함량 이 1.7±0.00 mg gallic acid equivalent/g이라고 보고한 바 있다. 이처럼 연구 결과들의 차이는 시료 채취, 추출에 적용된 온도, 시간, 용매 및 표준물질의 차이에서 기인된 것 으로 사료된다.
두릅순 열수 추출물이 3T3-L1 지방전구세포의 생존율에 미치는 영향
두릅순 열수 추출물에 대한 3T3-L1 지방전구세포의 생 존율을 측정하기 위해 100, 200, 400 μg/mL의 농도로 처리 한 후 SRB assay를 실시한 결과, 두릅순 열수 추출물의 모든 농도에서 94.59% 이상의 세포생존율을 보였다(Fig. 1). 이 는 두릅순 열수 추출물 400 μg/mL 이하의 농도에서 세포독 성이 없다는 것을 의미하므로 향후 실험 농도로 설정하였다.
Fig. 1. Effects of Aralia elata sprout hot-water extract on cell viability in 3T3-L1 pre-adipocytes. Values are expressed as mean±SE (n=3).
Fig. 2. Effects of Aralia elata sprout hot-water extract on adipo- cyte differentiation and lipid accumulation in 3T3-L1 adipocytes.
Quantitative analysis of Oil Red O staining and microscopic observation of lipid droplets stained with Oil Red O. Values are expressed as mean±SE (n=3). Values not sharing a common let- ter (a-e) are significantly different among the groups by Duncan’s multiple range test (P<0.05).
Fig. 3. Effects of Aralia elata sprout hot-water extract on adipo- genesis-related gene levels in 3T3-L1 adipocytes. The mRNA expressions of PPARγ and C/EBPα were determined by re- al-time PCR analysis. Values are expressed as mean±SE (n=3).
Values not sharing a common letter (a,b) are significantly differ- ent among the groups by Duncan’s multiple range test (P<0.05).
두릅순 열수 추출물이 3T3-L1 지방세포 분화 및 관련 유전 자 발현에 미치는 영향
3T3-L1 지방전구세포가 지방세포로 분화되는 과정에서 지방구(lipid droplet)가 나타나기 때문에 두릅순 열수 추출 물을 분화 유도 시 동시 처리한 다음 Oil Red O 시약을 이용 하여 세포 내 lipid droplet의 생성 정도를 정량화하였다.
그 결과 지방구 형성은 지방전구세포에 비해 분화된 지방세 포에서 약 3.7배 높았으며, 두릅순 열수 추출물을 100, 200, 400 μg/mL의 농도로 처리하였을 때 대조군에 비해 각각
11.22, 23.48, 36.03% 감소하였다(Fig. 2). 이와 같이 두릅 순 열수 추출물은 농도 의존적으로 지방세포 분화를 억제하 는 것으로 나타났다.
Adipogenesis는 지방전구세포가 증식 및 분화되는 과정 을 거쳐 성숙한 지방세포로 되는 과정으로 지방조직의 팽창, 지방 축적 등의 형태학적 변화와 지방세포의 특이적 단백질 마커, 전사인자 등의 발현, 아디포카인 분비량 변화 등이 나 타난다(Choi 등, 2013; Jeon 등, 2004). Adipogenesis의 대표적 핵심 조절인자는 PPARγ와 C/EBPα이다(Rosen과 MacDougald, 2006). C/EBP계에 의해 유도된 PPARγ는 지 방세포 분화와 지방산 대사조절에 중요한 역할을 담당하는 전사인자이다. PPARγ의 활성화는 지방전구세포에서 뿐만 아니라 NIH-3T3 세포를 포함한 여러 상피세포에서 지방세 포의 분화를 촉진한다고 알려져 있다(Kim과 Park, 2002).
PPARγ는 retinoid X receptor(RXR)와 heterodimer를 형 성하는 전사인자로 분화 초기에 발현되어 C/EBPα의 지방 세포 분화 후기 발현을 유도할 뿐만 아니라 fatty acid bind- ing protein(aP2), leptin 등의 지질 관련 유전자 발현을 유 도한다고 보고되어 있다(Jo 등, 2015). 따라서 두릅순 열수 추출물이 adipogenesis 경로에 미치는 영향을 살펴보기 위 하여 PPARγ와 C/EBPα의 유전자 발현을 측정하였다. 본
Fig. 4. Effects of Aralia elata sprout hot-water extract on trigly- ceride content in 3T3-L1 adipocytes. Values are expressed as mean±SE (n=3). Values not sharing a common letter (a-c) are significantly different among the groups by Duncan’s multiple range test (P<0.05).
Fig. 5. Effects of Aralia elata sprout hot-water extract on lipogenesis-related gene levels in 3T3-L1 adipocytes. The mRNA expressions of SREBP1c, SCD1, FAS, and DGAT2 were determined by real-time PCR analysis. Values are expressed as mean±SE (n=3). Values not sharing a common letter (a,b) are significantly different among the groups by Duncan’s multiple range test (P<0.05).
연구 결과는 지방전구세포에 비해 분화 유도된 지방세포에 서PPARγ의 발현이 3.4배 높게 확인되었으며, 통계적 유의 성은 나타나지 않았으나 C/EBPα역시 분화 시 2.5배 높게 발현되었다. 이러한 PPARγ유전자 발현은 두릅순 열수 추 출물에 의해 유의적으로 억제되었으며, 각 처리 농도에서 53.29, 69.20, 72.92% 감소하였음을 확인하였다(Fig. 3).
이와 같이 두릅순 열수 추출물은 PPARγ유전자 발현 저해
를 통해 지방전구세포에서 지방세포로의 분화를 억제하는 것으로 사료된다.
두릅순 열수 추출물이 3T3-L1 지방세포 내 중성지방 함량 및 관련 유전자 발현에 미치는 영향
비만은 adipogenesis에 의한 지방조직의 팽창과 더불어 lipogenesis를 통한 중성지방 축적이 관련된다(Wang 등, 2017). 따라서 두릅순 열수 추출물 항비만 효과 검증을 위하 여 지방세포 내 중성지방 함량을 측정하였다. 지방전구세포 에서 지방세포로 분화되었을 때 중성지방 함량은 3.1배 이상 증가하였으나 두릅순 열수 추출물을 100, 200, 400 μg/mL 의 농도로 처리하였을 때 모든 농도에서 효과적으로 중성지 방 함량을 낮추었다(Fig. 4). 세포 내 중성지방은 세포 내로 유입되는 포도당과 지단백 분해효소(lipoprotein lipase)에 의해 분해되어 유리된 지방산과 모노글리세롤로부터 합성 되거나 세포 내지방산 생합성 과정에 의해 생성되며, 최종 분화단계까지 지속해서 지방구를 형성한다(Kim과 Park, 2002). 본 실험 결과 두릅순 열수 추출물은 농도 비의존적으 로 지방세포 내 중성지방 축적을 억제하였다. 따라서 두릅순 열수 추출물이 어떤 기전으로 중성지방 함량을 감소하는지 살펴보고자 지질합성 관련 유전자 발현을 분석하였다.
Lipogenesis의 핵심 조절인자인 SREBP1c는 지방전구 세포 분화 초기에 빠르게 유도되고 지방산 및 중성지방의
합성에 관여하며(Horton, 2002), 특히 FAS, stearoyl-CoA desaturase 1(SCD1)과 같은 지방산 합성과 관련된 유전자 를 촉진한다(Park 등, 2018). 본 연구에서 두릅순 열수 추출 물은 SREBP1c, SCD1과 diacylglycerol O-acyltransfer- ase 2(DGAT2) 유전자 발현을 모든 농도에서 유의적으로 낮 추었으나, FAS는 차이를 보이지 않았다(Fig. 5). SREBP1c 에 의해 활성화된 SCD1은 포화지방산인 stearic acid에서 단일 불포화지방산인 oleic acid로 전환하는 역할을 하는 인자이며, oleic acid는 중성지방 합성의 마지막 단계를 촉진 하는 DGAT의 기질로 활용된다(Keum 등, 2015; Miyazaki 와 Ntambi, 2003). SCD1의 증가는 DGAT의 발현을 높여 중성지방 합성을 활성화하는 것으로 알려져 있다(Li 등, 2017). DGAT는 2가지 isoform이 밝혀져 있는데 그중에서 도 DGAT2가 간과 지방조직에서 주로 발현되며 중성지방 합성 경로의 핵심 조절인자이다(Chitraju, 2019). 이와 같이 두릅순 열수 추출물은 지방산 합성효소 유전자 발현에 영향 을 미치기보다 중성지방 합성효소 유전자 발현을 저해함으 로써 중성지방이 축적되는 것을 감소시킨 것으로 사료된다.
Hwang 등(2015)의 선행연구에서 두릅나무 에탄올 추출물 이 HepG2 세포의 SREBP1c, FAS 등의 lipogenesis 관련 유전자 발현을 억제한 것으로 보고하였다. 그러나 두릅순을 이용하여 지방세포 내 중성지방 합성 억제기전을 제시한 연 구는 전무하므로 본 연구 결과는 두릅순 열수 추출물의 항비 만 결과로 의미가 있으며, 향후 비만동물 실험에서의 효능 입증과 주요 활성 성분에 관한 연구가 뒷받침되어야 할 것이 다.
요 약
본 연구에서는 두릅순 열수 추출물의 지방세포 분화 및 중성 지방 합성 억제 효과를 확인하였다. 두릅순 열수 추출물의 총 폴리페놀 함량 및 총 플라보노이드 함량은 각각 99.68 mg TAE/g과 26.66 mg RE/g으로 나타났다. 두릅순 열수 추출물을 농도별(100, 200, 400 μg/mL)로 처리한 결과 adipogenesis 관련 대표 유전자인 PPARγ 발현을 낮추어 지방세포 분화를 억제하였으며, 중성지방 합성 관련 유전자 인 SREBP1c, SCD1, DGAT2를 제어하여 세포 내 중성지방 함량을 유의적으로 낮추었다. 본 연구는 두릅순 열수 추출물 의 지방세포 분화 억제 기전을 제시하였으며, 향후 전임상 효능 평가를 확인한다면 항비만 기능성 식품 소재로서의 활 용 가능성을 제시한다.
감사의 글
이 논문은 2019년 순천대학교 학술연구비(과제번호: 2019- 0210) 공모과제로 연구되었음.
REFERENCES
Cha JY, Ahn HY, Eom KE, Park BK, Jun BS, Cho YS. Antiox- idative activity of Aralia elata shoot and leaf extracts. J Life Sci. 2009. 19:652-658.
Chitraju C, Walther TC, Farese RV. The triglyceride synthesis enzymes DGAT1 and DGAT2 have distinct and overlapping functions in adipocytes. J Lipid Res. 2019. 60:1112-1120.
Choi JH, Park YH, Lee IS, Lee SP, Yu MH. Antioxidant activity and inhibitory effect of Aster scaber Thunb. extract on adipo- cyte differentiation in 3T3-L1 cells. Korean J Food Sci Tech- nol. 2013. 45:356-363.
Chung CK, Jung ME. Ethanol fraction of Aralia elata Seemann enhances antioxidant activity and lowers serum lipids in rats when administered with benzo(α)pyrene. Biol Pharm Bull.
2003. 26:1502-1504.
Ferreres F, Gomes D, Valentao P, Goncalves R, Pio R, Chagas EA, et al. Improved loquat (Eriobotrya japonica Lindl.) culti- vars: variation of phenolics and antioxidative potential. Food Chem. 2009. 114:1019-1027.
Ho JN, Choi JW, Lim WC, Lim MK, Lee IY, Cho HY. Kefir inhibits 3T3-L1 adipocyte differentiation through down-regu- lation of adipogenic transcription factor expression. J Sci Food Agric. 2013. 93:485-490.
Horton JD. Sterol regulatory element-binding proteins: transcrip- tional activators of lipid synthesis. Biochem Soc Trans. 2002.
30:1091-1095.
Hwang KA, Hwang YJ, Kim GR, Choe JS. Extracts from Aralia elata (Miq) Seem alleviate hepatosteatosis via improving hep- atic insulin sensitivity. BMC Complement Altern Med. 2015.
15:347. doi: 10.1186/s12906-015-0871-5.
Jeon T, Hwang SG, Hirai S, Matsui T, Yano H, Kawada T, et al. Red yeast rice extracts suppress adipogenesis by down- regulating adipogenic transcription factors and gene express- ion in 3T3-L1 cells. Life Sci. 2004. 75:3195-3203.
Jeong S. The inhibitory effect of testosterone on PPARγ-induced adipogenesis. Korean J Obes. 2016. 25:68-76.
Jo HK, Han MH, Hong SH, Choi YH, Park C. Ethanol extracts of citrus peel inhibits adipogenesis through AMPK signaling pathway in 3T3-L1 preadipocytes. J Life Sci. 2015. 25:285- 292.
Kazemipoor M, Radzi CW, Hajifaraji M, Haerian BS, Mosad- degh MH, Cordell GA. Antiobesity effect of caraway extract on overweight and obese women: a randomized, triple-blind, placebo-controlled clinical trial. Evid Based Complement Alternat Med. 2013. 2013:928582. doi: 10.1155/2013/928582.
KCDC. Korea Health Statistics 2018: Korea National Health and Nutrition Examination Survey (KNHANES Ⅶ-3). Korea Centers for Disease Control and Prevention, Korea. 2018. p 226-233.
Keum SO, Lee HI, Lee JH, Yoon YI, Kwon YM, Song YS.
Effects of Gami-cheongpyesagan-tang on body fat in high fat diet-fed obese mice. J Korean Med Obes Res. 2015. 15:
75-92.
Kim YH, Im JG. Effect of saponin from the shoot of Aralia elata in normal rats and streptozotocin induced diabetic rats. J Ko- rean Soc Food Sci Nutr. 1999. 28:912-916.
Kim JB, Park JY. Molecular insights into fat cell differentiation and functional roles of adipocytokines. Endocrinol Metab.
2002. 17:1-9.
Kwak CS, Yang J. Suppressive effects of ethanol extract of Ara- lia elata on UVB-induced oxidative stress in human keratino- cytes. J Nutr Health. 2016. 49:135-143.
Kwon TH, Wu YX, Kim JS, Woo JH, Park KT, Kwon OJ, et
al. 6,6′-Bieckol inhibits adipocyte differentiation through down- regulation of adipogenesis and lipogenesis in 3T3-L1 cells. J Sci Food Agric. 2015. 95:1830-1837.
Lee CW, Park YI, Kim SH, Lim H, Chung MJ. Antioxidant and anti-adipogenic activities of bread containing corn silk, Job's tears, Lentinus edodes, and apple peel in 3T3-L1 preadipo- cytes. J Korean Soc Food Sci Nutr. 2016. 45:651-663.
Lee ER, Kang GH, Kang YJ, Kim WY, Choi HY, Kim BW, et al. Regulation of cellular signal transduction by flavonoids.
Cancer Prev Res. 2007. 12:163-173.
Lee J, Jeong JY, Cho YS, Park SK, Kim KJ, Kim MJ, et al.
Effect of young Phragmites communis leaves powder on lipid metabolism and erythrocyte antioxidant enzyme activities in high-fat diet fed mice. J Korean Soc Food Sci Nutr. 2010.
39:677-683.
Lee JH, Jeong CS. Suppressive effects on the biosynthesis of inflammatory mediators by Aralia elata extract fractions in macrophage cells. Environ Toxicol Pharmacol. 2009. 28:333- 341.
Lee YJ, Lee SW, Lee SC, Park EJ. Antioxidant activities and antigenotoxic effect of ethanol extracts of Acorus gramineus, bud of Aralica elata Seem, Capsella bursa-pastoris, and Taraxacum officinale. J Basic Sci. 2014. 31:45-58.
Li JX, Ke DZ, Yao L, Wang S, Ma P, Liu L, et al. Response of genes involved in lipid metabolism in rat epididymal white
adipose tissue to different fasting conditions after long-term fructose consumption. Biochem Biophys Res Commun. 2017.
484:336-341.
Miyazaki M, Ntambi JM. Role of stearoyl-coenzyme A desatur- ase in lipid metabolism. Prostaglandins Leukot Essent Fatty Acids. 2003. 68:113-121.
Moreno MI, Isla MI, Sampietro AR, Vattuone MA. Comparison of the free radical-scavenging activity of propolis from several regions of Argentina. J Ethnopharmacol. 2000. 71:109-114.
Park SY, Oh EK, Lim Y, Shin JY, Jung HA, Park SY, et al.
Metabolites profiling and hypolipidemic/hypocholesterolemic effects of persimmon (Diosyros kaki Thumb.) by different processing procedures: in vitro and in vivo studies. J Nutr Health. 2018. 51:275-286.
Rosen ED, MacDougald OA. Adipocyte differentiation from the inside out. Nat Rev Mol Cell Biol. 2006. 7:885-896.
Wang Z, Kim JH, Jang YS, Kim CH, Lee JY, Lim SS. Anti-obe- sity effect of Solidago virgaurea var. gigantea extract through regulation of adipogenesis and lipogenesis pathways in high- fat diet-induced obese mice (C57BL/6N). Food Nutr Res.
2017. 61:1273479.
Yang JW, Kwak C. Inhibitory effect of Aralia elata ethanol ex- tract against skin damage in UVB-exposed human keratino- cytes and human dermal fibroblasts. J Nutr Health. 2016. 49:
429-436.