• 검색 결과가 없습니다.

Molecular Cloning and Characterization of myo-Inositol Dehydrogenase from Enterobacter sp. YB-46

N/A
N/A
Protected

Academic year: 2021

Share "Molecular Cloning and Characterization of myo-Inositol Dehydrogenase from Enterobacter sp. YB-46"

Copied!
9
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

Enterobacter sp. YB-46의 myo-Inositol dehydrogenase 유전자 클로닝과 특성분석

박찬영1, 김광규2, 윤기홍1*

1우송대학교바이오식품과학전공, 2㈜디와이내츄럴

Received: May 16, 2018 / Revised: May 23, 2018 / Accepted: May 25, 2018

서 론

Inositol (1,2,3,4,5,6-cyclohexanehexol) 6개의수산화기 에피머화에의해 9 종류의입체이성질체로존재하며 myo-inositol (cis-1,2,3,5-trans-4,6-cyclohexanehexol;

MI)자연에가장풍부하게존재한다. 주로콩과식물과

류에서 인산의 저장물질인 phytic acid (myo-inositol hexakisphosphate) MI함유하고있으며이들식물로부 MI산업적으로생산된다. MI제외한다른이성질체 자연계에서희소량존재하는데이들 D-chiro-inositol

(DCI)고혈당증이나다낭성난소증후군증상을개선하며

[1], scyllo-inositol (SI)알츠하이머증상을완화시키는 과가있는것으로알려졌다[2].

MI 유일 탄소원으로 하여 성장할 있는 세균으로 Aerobacter aerogenes (Enterobacter aerogenes 재분류) [3], Bacillus subtilis [4], Geobacillus kaustophilus [5], Lactobacillus casei BL23 [6], Rhizobium leguminosarum [7], Salmonella typhimurium [8], Sinorhizobium fredii [9] S. meliloti [10]알려졌으며이들의 MI 대사에관여 하는효소계와유전자발현조절기작이연구되었다. MI 비롯하여 이성질체인 DCI SI 산화하는 dehydrogenase해당 inositol의해생산이유도되는 으로알려졌다[5, 8, 11]. B. subtilis MI, DCI SI유일 탄소원으로이용할있으며이노시톨의대사과정이자세 Molecular Cloning and Characterization of myo-Inositol Dehydrogenase from Enterobacter sp. YB-46

Chan Young Park1, Kwang-Kyu Kim2, and Ki-Hong Yoon1*

1Food Science & Biotechnology Major, Woosong University, Daejeon 34606, Republic of Korea

2DYNatural Co. Ltd., Daejeon 34145, Republic of Korea

A bacterial strain capable of metabolizing myo-inositol (MI) and converting to other substances was iso- lated from soil of orchard. The isolate, named YB-46, was grown on minimal medium supplemented with MI as the sole carbon source and was presumed to belonging to genus Enterobacter according to the 16S rDNA sequence. Escherichia coli transformant converting MI into unknown metabolites was selected from a metagenomic library prepared with fosmid pCC1FOS vector. Plasmid was isolated from the transformant, and the inserted gene was partially sequenced. From the nucleotide sequence, an iolG gene was identified to encode myo-inositol dehydrogenase (IolG) consisting of 336 amino residues. The IolG showed amino acid sequence similarity of about 50% with IolG of Enterobacter aerogenes and Bacillus subtilis. The His-tagged IolG (HtIolG) fused with hexahistidine at C-terminus was produced and purified from cell extract of recom- binant E. coli. The purified HtIolG showed maximal activity at 45℃ and pH 10.5 with the highest activity for MI and D-glucose, and more than 90% of maximal activity for D-chiro-inositol, D-mannitol and D-xylose. Km and Vmax values of the HtIolG for MI were 1.83 mM and 0.724 µmol/min/mg under the optimal reaction con- dition, respectively. The activity of HtIolG was increased 1.7 folds by Zn2+, but was significantly inhibited by Co2+ and SDS.

Keywords: Enterobacter sp. YB-46, myo-inositol dehydrogenase, cloning, purification, characterization

*Corresponding author

Tel: +82-42-630-9742, Fax: +82-42-630-9389 E-mail: [email protected]

© 2018, The Korean Society for Microbiology and Biotechnology

(2)

밝혀졌다[12]. B. subtilis유전체에는 MI 대사에관여 하는여러단계의효소를암호화하는 iolABCDEFGHIJ 페론이존재한다[4, 13]. Fig. 1나타낸바와같이 MI 대사 단계는 iolG 유전자산물인 myo-inositol dehydrogenase (IolG)의해 MI scyllo-inosose (SIS)전환되는과정이 이때 NAD+조효소로작용된다[14]. 또한 IolG DCI 에도작용하여 1-keto-D-chiro-inositol생성하고이는 iolI 유전자산물인 inosose isomerase의해 SIS전환된다. 둘째 단계에서는 iolE 유전자 산물인 2-keto-myo-inositol dehydratase 탈수반응을 통해 SIS D-2,3-diketo-4- deoxy-epi-inositol (DKEI) 전환한다. 세번째 단계에서 DKEI 5-deoxy-D-glucuronic acid (5DG) 가수분해되며, 이때는 iolD 유전자산물인 DKEI hydrolase관여한다. 번째단계에서 iolB 유전자산물인 5DG isomerase의해 5DG 2-deoxy-5-keto-D-gluconic acid (DKG) 전환된 , 다섯번째단계에서 iolC 유전자산물인 DKG kinase 의해 2-deoxy-5-keto-D-gluconic acid 6-phosphate (DKGP) 인산화된다. 마지막으로, iolJ 유전자산물인 aldolase 작용하여 DKGP dihydroxyacetone phosphate malonic semialdehyde 분해하며, malonic semialdehyde iolA 유전자산물인 malonic semialdehyde dehydrogenase acetyl-CoA CO2분해된다. B. subtilis IolG외에도 inositol dehydrogenase 활성을갖는 IolX IolW생산한 . IolG MI DCI 아니라 pinitol (3-O-methyl-DCI) 에도작용하지만 SI에는작용하지못하는데[15, 16], IolX

IolW SI특이적으로작용하여 SIS전환시키고 중에 NAD+ NADP+각각조효소로이용한다. 특히 IolX SI이화대사에주요역할을하는것으로나타났고 반면에 IolW NADPH산화하면서 SIS SI환원시키

역할을하는것으로추정되고있다[12].

식물과공생하는 S. fredii, S. meliloti R. leguminosarum 에서 MI대사기능이알파를비롯한콩과식물의질소고 정이나뿌리혹의형성에영향을미치는것으로알려졌다[9, 15, 17]. S. fredii S. meliloti [9, 10] iolG iolE 전자와 효소의 기능이 밝혀졌고, R. leguminosarum에서 iolA iolDEB 유전자기능이연구되었다[17]. S. meliloti 이노시톨대사관련유전자(iolA iolCDEB) MI 아니라 DCI SI유일탄소원으로성장에도필요 하다고알려졌다. 또한플라스미드에존재하는 idhA (iolG) 유전자산물이 MI DCI산화과정에관여하며 SI SIS 전환시키는반응은 smc01163 (iolY) 유전자에의해암호 화된별개의 dehydrogenase (IolY)관여하는것으로알려 졌다[11, 15]. 한편대부분의유산균과는달리 MI탄소원 으로 이용하는 L. casei BL23 B. subtills 유사하게 iolTABCDG1G2EJK operon 가지고 있으며 2종류의 iolG 유전자(iolG1, iolG2)연이어배열된것이특징적이 [6]. 내열성균인 G. kaustophilus HTA426 MI, SI DCI유일한탄소원으로하여성장하며이들의대사에 여하는 유전자는 iolIDEBCAJ 오페론과 3종류의 inositol dehydrogenases 유전자에해당하는 gk1897-1898-1899 오페

론으로존재한다[5]. 연구에서는과수원토양에서 MI

다른대사산물로전환하는미생물을분리하고 inositol 대사 관여하는유전자를클로닝하였으며이들 iolG 유전자 효소의특성을조사하였다.

재료 및 방법

myo-Inositol 분해균의 분리

MI대사하여다른대사산물로전환하는미생물을선발 하기위해충청북도와경상북도의과수원에서채취한토양 생리식염수로희석한 LB 평판배지(yeast extract, 5 g;

tryptone, 10 g; NaCl, 5 g; agar, 15 g; water, 1 L)도말 하여 30℃에서배양하였다. 콜로니의모양이서로다른 주를선별하여 MI (0.5%)첨가된 LB 액체배지에접종하 3일간진탕배양한배양상등액에존재하는물질을 층크로마토그래피(Thin-layer chromatography, TLC) 석함으로써 MI다른물질로전환된균주를탐색하였다. TLC배양상등액을적정량취해 silica gel-precoated thin layer glass plate (Merck Kiesegel, 60F254, Merck Millipore Co., Germany)점적하고 methanol, chloroform증류수 Fig. 1. Inositol catabolic pathway in B. subtilis.

(3)

(5:5:1-v/v/v)혼합용액으로전개한이를 2% KMnO4 액으로 5초간염색하고 열풍으로말려 관찰하였다. MI pinitol Sigma-Aldrich. (USA)구입하였다.

분리균의 동정

그람염색을실시하여분리균의형태적특성을관찰하였 으며, LB 액체배지에서배양한균체를 0.85% NaCl 용액에 현탁한제조사의지침에따라 API 20E API 50 CHE (Biomerieux, France) kits접종하고 30℃에서배양하면서

1일과 2일째각각탄수화물이용능과생화학적특성을관찰

하였다. 분리균의 16S rRNA 유전자의염기서열을분석하기 위해서유전체 DNA주형으로하고, 5'-AGAGTTTGA TCCTGGCTCAG-3' (Escherichia coli 16S rRNA 유전자 염기서열 827) 5'-GGTTACCTTGTTACGACTT-3' (E.

coli 16S rRNA 유전자염기서열 1,4921,510) primers

이용하여중합효소연쇄반응(PCR)실시함으로써증폭된

DNA 단편을정제한염기서열분석에사용하였다.

MI 대사 효소 유전자의 클로닝

분리균의배양균체로부터유전체 DNA Biofact Co.

(Korea) Bacterial Genomic DNA Preparation kit 용하여지침서에따라분리하였다. 유전자은행을제조하기 위해서는 Epicentre Biotechnologies (USA) CopyControlTM Fosmid pCC1FOSTM Library Production kit다음과 사용하였다. 분리된유전체 DNA pipetting하여물리 충격을가함으로써적절한크기의단편으로(3050 kb) 단한 End-Repair Enzyme Mix (Epicentre Biotechnologies,

USA)사용하여절단단편의평활화와 5’ 인산화를실시하

였다. 전기영동을수행하여 40 kb 크기의 DNA 단편을 GELase 추출한 Fast-Link DNA ligase 사용하여 pCC1FOS vector ligation하였다. Ligated DNA 70℃에 10분간 열처리하고 MaxPlax Lambda Packaging Eextracts혼합하여최종적으로 E. coli EPI300으로형질 도입한 chloramphenicol (12.5 μg/ml)첨가된 LB 평판 배지에도말하였다.

iolG 유전자의 과잉발현 및 효소 정제

iolG 유전자를과잉발현시키기위해 pET23a T7 promoter 하단에도입하여재조합플라스미드를제조하였다. IolG

카르복시말단에 His-tag융합된형태로발현시키기위해

2종류의 primers P8iolG-F1 (TCAACATATGACTTTAAA AGCAGGTATTGTGG; 밑줄은 NdeI 위치) P8iolG-nR (TGAACTCGAGCTTGTAGAACGCAGGTTTCGCT; 밑줄 XhoI 위치)제조하였다. 이들 primers증폭된유전 단편을 NdeI XhoI으로절단하여동일한효소로처리

pET23a(+)도입하여재조합플라스미드 pE8LiG1 조하였다. His-tagged IolG (HtIolG)유전자를과잉발현 시키기위해 pE8LiG1 E. coli BL21 (DE3)도입하여 형질전환주를 LB 액체배지에접종하고 37℃에서하룻 진탕배양한, 동일배지 300 ml함유한 baffled flask 1%되도록접종하였다. 37℃에서진탕배양하면서 광도(OD600) 0.6도달했을 IPTG 1.0 mM되도록 첨가하고 25℃에서 10시간추가로진탕배양하였다. 원심분 하여균체를회수하고 8 ml cell lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) 현탁하여초음파파쇄한윈심분리하여균체파쇄상등액 회수하였다. 이를동일한완충액으로평형화시킨 Ni-NTA 컬럼에 주입한 washing buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) 세척하였다. HtIolG 300 mM imidazole함유한완충액으로추출하 분획의 IolG 활성분석과 SDS-PAGE 분석을통해 성이높고단일단백질이포함된분획을골라 10 mM sodium phosphate 완충액(pH 8.0)에서투석하여정제효소로사용 하였다.

IolG 활성 측정

IolG활성은 0.5 mM NAD+조효소로하고 50 mM

질과 100 mM 완충액을포함한반응액에적정량의효소를

첨가하여 45℃에서 30분간반응한 340 nm에서흡광도

증가에따른 NADH생성량을측정함으로써결정하였

. 효소활성에미치는반응온도의영향을조사하기위하 2550℃와 pH 6.011.5범위에서 IolG 활성을각각 정하였다. 열안정성은 2550범위의온도에서 IolG 효소 액을 30동안방치한잔존활성을측정하여결정하였 . 금속이온과화합물이효소활성에미치는영향을조사하

위해서는최종농도가 5 mM되도록반응액에첨가하

효소활성을측정하였다.

결과 및 고찰

MI 이용균의 분리와 동정

자연계에풍부하게존재하는 MI유일탄소원으로이용 하는토양균이다수보고된있다. MI대사능이있는 생물을탐색하기위해과수원토양으로부터분리된미생물 MI첨가된 LB 배지에배양하여배양산물을 TLC 석하였다. 다수의토양세균이 MI이용하지못하였으며,

분리균 YB-46배지의 MI이용하여미지의대사물질을

생산하는것으로나타났다(Fig. 2A). MI첨가량을달리하 배양한 MI이용정도를조사한결과 MI 0.5% 가된배지에서는 MI완전히이용되어미지의물질이생산

(4)

되었으나, MI첨가량을증가시켰을경우 MI일정량만 소모되고배지에잔존하였으며생성된대사물질의양도 증가하지않았다(Fig. 2B).

분리균 YB-46형태적특성을관찰한결과그람음성

균으로확인되어 API 20E API 50CHE kit사용하여 화학적특성과이용능을조사하였다. 결과 YB-46β- galactosidase활성과 citrate이용능을보였고 indole 유기산을 생성하였으며, arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase, urease tryptophan deaminase 활성 acetoin황화수소의생성능은모두 었다. 이용능은 Table 1보인바와같으며, Biomeriux API web (https://apiweb.biomerieux.com/jsp/login.jsp)

에서 다른균주와 생화학적특성을비교한 결과 YB-46

Pantoea sp. 2유사도가 87.3%가장높았다. 한편 PCR 16S rDNA 단편을증폭하고 1,510 bp 크기의염기서열을 결정한미국 NCBI BLAST 검색방법으로기존에등록 세균들의상응하는염기서열과비교한결과 Enterobacter bugandensis 1510 bp 1495 bp동일하여상동성이 가장 높았으며, Enterobacter cancerogenus Klebsiella oxytoca 1494 bp동일하였다. 한편생화학적특성에서 가장유사도가높았던 Pantoea 균주중에서는가장높은

상동성을보이는균주는 Pantoea agglomerans JCM 1236 이며 1451 bp 1427 bp동일하여 Enterobacter 균주 보다상동성이낮았다. 이와같이조사된결과로분리

YB-46 확실하게 동정된 상태라 없으나 16S

rDNA 서열에근거하여분리균을 Enterobacter sp. YB-46 명명하였다.

탄소원으로 glucose, fructose MI각각 1% 첨가된 M9 최소배지에분리균 YB-46접종하여 30℃에서 1일간진탕 배양한결과 glucose fructose첨가된배지에서는순조 롭게성장하였고 MI첨가된배지에서는거의성장이일어 나지않았으나배양 2일째는성장도가 glucose fructose 첨가된배지와유사한수준을보였다. 이로보아 YB-46 MI 유일탄소원으로이용하여성장하지만유도기가 24시간 이상으로길었으며, Salmonella enterica최소배지에서 MI유일탄소원으로사용하였을 4060시간의유도기 갖는것으로알려졌다[8, 18].

MI 대사 효소의 유전자 클로닝

MI대사과정에는여러효소가관여하며유전자는 생물에따라차이는있지만대부분이오페론으로존재한다 [6, 8, 11, 13]. 그러므로 Enterobacter sp. YB-46으로부터 Fig. 2. Thin-layer chromatogram of culture filtrates by the isolate YB-46 and E. coli carrying pMU118. In panel A, the isolate YB- 46 was grown in LB broth supplemented with 2% myo-inositol (MI) for 3 days. Lanes M, MI; D, D-chiro-inositol; P, pinitol; 2 and 3, culture filtrates on 2nd and 3th day. MI, D-chiro-inositol and pinitol were indicated by arrows. In panel B, the isolate YB-46 was grown in M9 minimal medium and LB medium, respectively, supplemented with MI of various concentrations (%) indicated in the bottom of panel.

Lane P is pinitol. In panel C, E. coli carrying pCC1FOS (lane 1) or pMU118 (lane 2) and the isolate YB-46 (lane 3) were grown in LB broth containing 0.5% myo-inositol for 3 days, respectively.

Table 1. Utilization of carbohydates of Enterobacter sp. YB-46 in API 50CHE kit.

Fermented carbohydrates Non-fermented carbohydrates

Glycerol, D-Arabinose, L-Arabinose, Ribose, D-Xylose, Galactose, D-Glucose, D-Fructose, D- Mannose, L-Sorbose, Rhamnose, Dulcitol, Inositol, Mannitol, Sorbitol, Methyl-α-D-mannopy- ranside, Methyl-α-D-glucoside N-Acetyl-glucosamine, Amygdalin, Arbutin, Esculin, Salicin, Cellobiose, Maltose, Lactose, Melibiose, Saccharose Trehalose, D-Raffinose, β-Gentiobiose D-Turanose L-Fucose, D-Arabitol, Gluconate, 2-Keto-gluconate, 5-Keto-gluconate

Erythritol, L-Xylose, Adonitol, Methyl-β-D-xylopyranside, Inulin Melezitose, Amidon, Glycogen, Xylitol, D-Lyxose, D-Tagatose, D-Fucose, L-Arabitol

(5)

MI대사에관련된유전자를클로닝하기위해크기가 DNA 단편의 삽입에적합한 pCC1FOSTM fosmid vector metagenomic library제조함으로써 700개의형질전환 얻었다. 임의로 5개의형질전환주로부터재조합플라스 미드를분리한여러종류의제한효소로절단하여삽입 크기를예측한결과 40 kb 크기의 DNA 단편이삽입 것으로판단되었으며이로보아 YB-46 metagenomic library 28 Mb 수준의유전체를함유한것으로추정 된다.

MI대사유전자를함유한형질전환주를효과적으로 색하기위해 1% MI첨가된 LB 액상배지에 10개의형질 전환주를동시에접종하고혼합배양한배양상등액을 TLC분석하여 1집단의배양액에서 MI소모되고 지의대사산물이생성된것을확인하였다. 그러므로집단 포함된 10개의형질전환주를각각동일한배지에서배양 배양상등액을분석함으로써최종적으로 MI대사하

분리균 YB-46동일하게미지의대사산물을생산하는

단일한형질전환주를선발하였다(Fig. 2C).

iolG 유전자의 염기서열과 유전자 산물

MI대사하는형질전환주로부터플라스미드를분리하여

pMU118명명하고삽입된유전자의염기서열을분석하기

위해 EcoRI, PstI, BamHI HindIII각각절단된단편들 클로닝된유전자로부터유래된단편을추출하고이를

일한효소로절단된 pUC19도입하여염기서열을결정

하였다. 결과 pMU118클로닝된 DNA부분적인 기서열이결정되었으며밝혀진염기서열을기반으로하여

orf조사한결과 336 아미노산잔기로구성된단백질을 드하는 1,011 bp 크기의 iolG 유전자가관찰되었다(Fig. 3).

개시코돈 ATG로부터 5 nucleotides떨어진지역에 purine 염기가집중적으로배열되어있었으나 RBS전형적인

기배열인 AGGAGG와는차이가있었다.

유전자염기서열로부터유추된 YB-46 유래 IolG (YBIolG) 아미노산배열을미국의 NCBI database등록된다른 효소와비교한결과 S. enterica inositol 2-dehydrogenase (WP_000172704)상동성이 93%가장높았으며 E. coli ED1a (CAR06517) Citrobacter werkmanii (WP_085048442) IolG와도 92%높은상동성을보였다. 이들효소는 YBIolG동일하게 336 아미노산잔기로구성되어있는 효소의특성에대해보고된바는없다. 한편효소의특성 조사된 E. aerogenes (YP_007389612; 337 residues;

51.2%) [3], B. subtilis (NP_391849; 344 residues; 49.7%) [14], S. meliloti 1021 (NP_437734; 330 residues; 25.8%) [10], S. fredii USDA191 (AF274867; 329 residues; 25.2%) [9] L. casei BL23 (NC_010999; 350 residues; 19.6%) [19] IolG YBIolG크기에차이가있을아니라 미노산배열의상동성이 19.651.2% 수준으로높지않았다 (Fig. 4). 내열성균인 G. kaustophilus HTA426 IolG (NC_006510) 397 아미노잔기로구성되어다른균의 소에비해크며 YBIolG와도상동성이 17.9%매우낮았다 [5].

YBIolG 915번째아미노잔기는 dehydrogenases N

말단영역에서 NAD(H) ADP 부분에결합에관여한다고

알려진아미노산배열(GXGXXG)동일하였다[20]. 또한 B.

Fig. 3. Nucleotide sequence and deduced amino acid sequence of iolG gene. The amino acid deduced from the open reading frame is shown with the one-letter code below the nucleotide sequence. Putative ribosome binding site (SD) is depicted below the underlines.

The numbers at the end of each line correspond to the nucleotide positions.

(6)

subtilis IolG 233235번째잔기인 YGY기질인 inositol 인식부위주변에서소수성공간을형성하는데 YBIolG 232234번째 잔기에서이와 동일한 배열을 보였고 L.

casei BL23 IolG2 HGY배열되어다른균의효소와 차이가 있었다. B. subtilis IolG에서 K97, D172 H176활성잔기이며 H176-염기촉매제작용을하는 것으로보고되었는데[21], YBIolG K97 H176 잔기가 치하였으나 172 잔기는 Asp 유사한 아미노산인 Glu (E172)치환되어있었다. 한편 S. fredii, S. meliloti L.

casei BL23 IolG 효소에서는이들활성잔기가 B. subtilis IolG동일하게배열되어있었으며 E. aerogenes IolG 172잔기로 Asp와는특성이다른 Asn (N172)함유 하였다.

재조합 대장균이 생산하는 IolG의 정제 및 특성

YBIolG 카르복시 말단에 His tag융합한 His-tagged

YBIolG (HtIolG) 유전자가 과잉 발현되도록 제조된

pE8LiG1 E. coli BL21 (DE3)도입하고형질전환주 IPTG처리하여 HtIolG유전자를과잉발현한결과 IPTG 첨가 37℃에서배양하였을발현된 HtIolG 부분불용성단백질로존재하였으나 25℃로배양하였을 수용성단백질로발현된양이증가하였다. 그러므로 IPTG 첨가 25℃에서배양된균체를파쇄하고 Ni-NTA 컬럼 로마토그래피를 수행하여 HtIolG 정제하였다. 정제된 HtIolG SDS-PAGE분석한결과분자량이 3840 kDa 으로나타났으며(Fig. 5), 이는 iolG 유전자의염기서열로부 예측된 YBIolG카르복시말단에융합된 6개의 His 기를포함한 HtIolG분자량(38 kDa)유사하였다. 한편 SDS-PAGE에서 39 kDa분자량을 보이는 B. subtilis IolG 분자량이 150160 kDa 사량체로 존재하며[16, 21], L. casei BL23 IolG2사량체로보고되었다[19].

정제된 HtIolG사용하여반응온도와 pH따른효소 활성을조사한결과최적반응온도는 45℃이며 pH 10.5 최대활성을보였고 pH 8.0에서 25%, pH 11에서 Fig. 4. Comparison of the Enterobacter sp. YB-46 IolG with others. The amino acid sequences of six IolGs from Enterobacter sp. YB- 46 (YB), S. fredii USDA191 (Sf), L. casei BL23 (Lc), S. meliloti 1021 (Sm), B. subtilis 168 (Bs) and E. aerogenes EA1509E (Ea) are given in the one-letter code and have been aligned by introducing gaps (hypens) to maximize similarities by Clustal W method. Putative amino acid sequence corresponding to NADH-binding motif is underlined. The catalytic triad residues are marked by closed circles and tyrosine- glycine-tyrosine motif for the hydrophobic pocket are marked by asterisks on the amino acids, respectively. Numbers at the beginning of each line correspond to the amino acid position in the protein.

(7)

70% 이상의활성을나타냈다(Fig. 6). Acetomonas oxydans Gluconobacter oxydans ATCC 621H IolG각각 pH 6.2 pH 8.75에서최대활성을보였고 G. oxydans IolG pH 5 이하와 10.5 이상에서는활성이거의없었으며[22, 23], B. subtilis IolG pH 9.0에서최대활성을보이고 pH 10.5에서는최대활성의 30% 수준을보였다[16]. 이로보아

YB-46 HtIolG다른균의효소에비해알칼리조건에서 활성이높은것을있다. 열안정성을조사하기위해 25 50범위에서 30분간방치한후에 HtIolG잔존활성을 사하였다. 30이하에서는대부분의활성을유지하였으며 40이상에서실활되기시작하였고 50℃에서는 10% 낮은잔존활성을보였다(Fig. 6B). 한편고온성균인 G.

kaustophilus GK-1897 GK-1899 NAD+조효소로

사용하여 MI산화하는 IolG확인되었으며최적반응온

도가각각 55℃와 75℃이고 30분간열처리하였을 55

이하에서전혀실활되지않아 HtIolG비해열안정성이

았고특히 GK-1899 75℃에서도 60%높은잔존활성을 보였다[5].

기질특이성을조사하기위해서는 NAD+농도를 0.5 mM

하고여러종류의당을동일한농도(50 mM)사용하여

반응을 실시한 결과 HtIolG MI D-glucose 대해 0.629 μmol/min/mg으로동일하게최대활성으로보였으며 DCI, D-mannitol D-xylose에도 90% 이상의활성을나타 냈다. 그러나 D-glucose에피머인 D-galactose (57.5%) D-mannose (38.7%)대해서는활성이낮았으며 2-deoxy- glucose대한 활성도는 47.2%나타났다. B. subtilis IolG MI대한활성이가장높았으며, D-glucose (25%), D-xylose (12.5%), D-ribose D-fructose (2%)대한활성 MI비해낮았고 D-galactose 2-deoxy-glucose대한

활성을없는것으로보고되어 HtIolG차이가있었다

[16]. 한편 B. subtilis glucose dehydrogenase D- glucose비해 2-deoxyglucose대한활성이 108% 수준으 가장높았으나 MI대한활성은없는것으로알려졌다 [24]. 이로보아 YBIolG MI 아니라 D-glucose에도활성 높은 myo-inositol dehydrogenase판단된다. IolG Fig. 5. SDS-PAGE of the purified HtIolG. Lane P, the purified

enzyme; Lane M, the molecular weight markers shown in kilo- daltons to the left side of the gel.

Fig. 6. pH and temperature profiles for activity and stability of the purified HtIolG. In panel A, the pH profiles were obtained by measuring the IolG activities at various pH’s with a constant temperature of 45℃. Buffers (100 mM) used were as follows: sodium phos- phate (--, pH 6−8), Tris (--, pH 8−9), glycine-NaOH (--, pH 9−11), and NaOH-sodium phosphate (--. pH 11−11.5). In panel B, tem- perature profiles (--) were obtained by measuring the IolG activities at different temperatures with a fixed pH 8.0.

Thermostability (--) was determined by measuring the residual activities after pre-incubation for 30 min at different temperatures.

Each curve represents the average of three independent experiments within standard errors of 2% between of them.

수치

Table 1. Utilization of carbohydates of  Enterobacter sp. YB-46 in API 50CHE kit.
Fig. 6. pH and temperature profiles for activity and stability of the purified HtIolG

참조

관련 문서

웹 표준을 지원하는 플랫폼에서 큰 수정없이 실행 가능함 패키징을 통해 다양한 기기를 위한 앱을 작성할 수 있음 네이티브 앱과

_____ culture appears to be attractive (도시의) to the

이하선의 실질 속에서 하악경의 후내측에서 나와 하악지의 내측면을 따라 앞으로 간다. (귀밑샘 부위에서 갈라져 나와

It considers the energy use of the different components that are involved in the distribution and viewing of video content: data centres and content delivery networks

After first field tests, we expect electric passenger drones or eVTOL aircraft (short for electric vertical take-off and landing) to start providing commercial mobility

1 John Owen, Justification by Faith Alone, in The Works of John Owen, ed. John Bolt, trans. Scott Clark, "Do This and Live: Christ's Active Obedience as the

ƒ 유도 핵반응은 자발적인 핵분열 (Spontaneous Nuclear Reaction)과는 달리 다른 물질과의 작 용으로 원자가 반응하여 여러 가지 생성물을 만들어

ƒ 임계 에너지는 핵분열 하는 핵종에 따라서 다르므로 중성자를 흡수했다 해서 모든 핵종이 핵분열을 일으키는 것은 아님.. 235 U와 같이 정지상태의 중 성자를