• 검색 결과가 없습니다.

The effect of parental imprinting on the INS-IGF2 locus of korean type 1 diabetic patients

N/A
N/A
Protected

Academic year: 2021

Share "The effect of parental imprinting on the INS-IGF2 locus of korean type 1 diabetic patients"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

INT RO DUCT IO N

Pare ntal ge nomic imprinting is the phe nome non in

which the differe ntial behavior of a gene depe nds on the sex of the transmitting pare nts . Eithe r a n imba la nce of pare ntal chromosomes in the embryo or an abe rrant imprinting of these ge nes is implicated in an increas ing number of genetic disorders

1- 7 )

.

Type 1 diabetes me llitus is ca used by the autoimmune destruction of pa ncreatic - ce lls

8 )

. It is a polyge nic disorder, linked to severa l ge netic loci

9 , 1 0 )

and the refore , phe notype express ion is influe nced by a numbe r of s usceptibility genes as we ll as environme nta l factors .

T h e Eff e ct o f P a r e n t a l Im p r in t in g o n t h e IN S - IGF2 Lo c u s o f Ko r e a n Ty p e I Dia b e t ic P a t ie n t s

He u n g S ik Kim , M . D.*, Do n g W o o k Le e , M . D.

, S a n g J u n Le e , M . D.

, Bo Hw a Ch o i, M . D.

, S u n g Ik Ch a n g , M . D.

, Hy u n Da e Yo o n , M . D.

§

a n d In Ky u Le e , M . D.

De p a rt m e nt s o f Pe d iat ric s *, Int e rn a l M e d ic in e

, A n at o m y

, Ke im y u ng U n iv e rs ity Do ng s a n M e d ic a l Ce nt e r, Da e g u , Ko re a ;

De p a rt m e n t o f Int e rn a l M e d ic in e

§

, S c h o o l o f M e d ic in e , Cat h o lic U n iv e rs ity o f Da e g u , Da e g u , Ko re a

B a c kg ro u n d : In s u lin - d e p e n d e n t d ia b e t e s m e llit u s ( IDDM ) is c a u s e d b y t h e a u t o im m u n e d e s t ru c t io n o f p a n c re a t ic - c e lls . S u s c e p t ib ility t o IDD M a p p e a rs t o d e p e n d o n m o re t h a n o n e g e n e t ic lo c u s . Ev id e n c e o f a g e n e t ic lin k a g e f o r IDDM 2 w a s f o u n d in m a le m e io s e s f ro m F re n c h a n d N o rt h A m e ric a n p o p u la t io n s . It is lin k e d t o m a t e rn a l im p r in t in g ( i.e . m o n o a lle le ic e x p re s s io n o f t h e in s u lin g e n e ) t h a t is c o n s id e re d t h e m o s t lik e ly c a u s e o f t h e s e g e n d e r- re la t e d d if f e re n c e s . IG F2 is e x p re s s e d o n ly in t h e p a t e r n a l a lle le a n d , t h e re f o re , is c o n s id e re d a c a n d id a t e g e n e f o r IDDM 2 t ra n s m is s io n b e c a u s e o f it s im p o rt a n t a u t o c rin e / p a ra c rin e e f f e c t s o n t h e t hy m u s , ly m p h o cy t e s a n d p a n c re a s . N e v e rt h e le s s , it re m a in s c o n t ro v e rs ia l w h e t h e r t h e p a re n t a l o rig in o f IDDM 2 in f lu e n c e s ID DM s u s c e p t ib ility .

M e t h o d s : U s in g PC R a n d s e m i-q u a n t it a t iv e R T - PC R , w e a n a ly z e d t h e IN S / Ps t I + 1 1 2 7 a n d IG F2/ A p a I p o ly m o rp h is m s a n d R N A e x p re s s io n le v e l b e t w e e n Ps t I ( +/ - ) a n d Ps t I ( +/ + ) t o d e t e r m in e g e n o ty p e a n d a lle le - s p e c if ic e x p re s s io n o f t h e IN S a n d IG F2 g e n e s .

R e s u lt s : IN S / Ps t I ( + / + ) a n d IG F2/ A p a I ( +/ - ) w e re o b s e rv e d in 3 6 ( 9 7 .3 % ) o f 3 7 IDDM p a t ie n t s a n d in 2 9 ( 7 2 . 5 % ) o f 4 0 IDDM p a t ie n t s , re s p e c t iv e ly . T h e p re s e n c e o f b o t h IG F2 a lle le s in R N A w a s o b s e rv e d in 2 1 ( 9 1 . 6 % ) o f 2 4 IDD M p a t ie n t s . O u r re s u lt s s h o w a 3 - f o ld in c re a s e in R N A e x p re s s io n f ro m Ps t I ( +/ - ) a lle le o v e r Ps t I ( +/ + ) a lle le .

C o n c l u s io n : O u r c o n c lu s io n d o e s n o t e n t ire ly e x c lu d e IG F2 a s t h e g e n e in v o lv e d in IDDM 2 , e v e n t h o u g h t h e p a re n t a l e f f e c t o f IDD M 2 t ra n s m is s io n is n o t re la t e d t o IG F2 m a t e rn a l im p rin t in g . T h e IN S g e n o ty p e a p p e a re d m o s t ly in t h e Ps t I ( + / + ) h o m o zy g o t e a n d , t h e re f o re , w e c o u ld n o t e x p la in t h e IN S im p rin t in g p a tt e rn in Ko re a n ty p e 1 d ia b e t ic p a t ie nt s . G e n e t ic d if f e re n c e s b e tw e e n p o p u la t io n s m a y a c c o u n t f o r t h e d is c re p a n cy b e tw e e n Ko re a n ty p e I d ia b e t ic p a t ie n t s a n d A m e ric a n o r F re n c h ty p e I d ia b e t ic p a t ie n t s .

Ke y Wo rds : Genomic imprinting; Diabetes Mellitus; INS; IGF2; Korea

Address reprint requests to:In- Ky u Lee M.D., Departm ent of Internal Medicine, Keimy ung University Dongsan Me dical Center, # 194 Dongs an - dong, Joong- Gu, Daegu 700- 712, Korea

* S upp orted by a Sp ecial Res earch Fund of the

Ins titute of Medical Genetics, Keimy ung Univers ity

School of Medicine.

(2)

Rece nt genome wide linkage studies indicate that ge nes in the HLA class II region provide the major ge netic s usceptibility to IDDM

1 1 , 1 2 )

. The insulin ge ne (INS) region on chromosome 11p15.5 (IDDM2) has also been shown to contribute to IDDM susceptibility in many populations

13 - 18 )

. The remaining genetic component is la rge ly unknown, a lthough rece nt studies have revea led the presence of several loci showing a significant genetic linkage

12 , 19 )

. That one or more of these loci may be s ubject to pare ntal imprinting was first suggested in the observation that IDDM is tra ns mitted by diabetic fathe rs more than twice as often as by diabetic mothers

2 0 )

. Further, more direct evidence that IDDM trans mission is modified by pa renta l imprinting was ge ne rated by a la rge study of the IDDM2 locus in a Fre nch and mixed North Ame rican population

1 4 , 2 1 - 2 3 )

. But it is controversial whether IDDM2 transmission is pos itively associated with type I diabetes in Asians.

The IDDM2 locus was previous ly mapped to a 4.1- kb region spa nning the insulin ge ne a nd a va riable number of ta ndem repeats (VNTR) locus on the human chrom- osome 11p 15.5

1 6 )

. Ge netic s usceptibility to IDDM is e ncoded by seve ral loci, one of which (IDDM2) maps to a variable number of tandem repeats (VNTR) minisatellite, upstream of the ins ulin gene (INS). The short class I VNTR alleles (26- 63 repeats) predispose to IDDM, while class III a lle les (140- 2 10 repeats) have a domina nt protective effect

2 4 )

. Class III a lle les are associated with margina lly lower INS mRNA leve ls than class I in the huma n adult a nd fetal pa ncreas in vivo. Class I alleles a re found with higher frequencies in type I diabetic patients tha n the class III alleles

14 , 2 4 )

. The shorter a lle les of class I predispose to IDDM, while the longe r class III a lle les are protective. These may be related to type 1 diabetes pathogenes is , as insulin is the only known cell- specific IDDM autoantigen. INS is a ta rget of tiss ue- specific VNTR transcriptional effects a nd is the only known cell specific autoantige n in type 1 diabetes

2 5 - 2 7 )

. Additionally, INS was rece ntly s hown to be imprinted in the yolk sac but not in the pa ncreas of mice

2 8 )

.

The IGF2 ge ne located immediate ly 3' to INS is maternally imprinted in mice and in huma ns

2 9 , 3 0 )

. This favors IGF2 as the ge ne involved in IDDM tra ns miss ion.

Howeve r, in human periphera l lymphocytes , in which lectin stimulation induces IGF2 transcription, imprinting is re laxed a nd the maternal copy is seen in most but not a ll individuals

3 1 , 3 2 )

. This variable re laxation of imprinting may be the ge notype- dependent trait postulated by Ba in et al.

1 5 )

which expla ins e ither the prese nce or abse nce of imprinting phenomena in different populations. Functiona lly, IGF2 is a lso conside red a ca ndidate for the IDDM2 effect

due to its we ll- cha racterized role as a mitogenic peptide with important a utocrine/pa racrine effects on the thymus , lymphocytes and pancreas

3 3 , 3 4 )

.

In this report, we studied patte rns of IDDM2 pare nta l transmission and the imprinting effects of the INS a nd IGF2 genes in Korea n type I diabetic patients .

MATER IA LS A ND METHO DS

S a mple s Whole blood sa mples were obta ined from patients diagnosed with type 1 diabetes me llitus by the criteria of the National Diabetes Data Group. The samples used in the ge notype a nd a lle le- specific express ion a na lyses we re obta ined from 26 patients with no family history of diabetes a nd 16 patie nts with a fa mily history of diabetes. The patie nts (aged 6- 16) and the ir pare nts we re recruited through the pediatric departme nt of Dongsan hospital a nd the Diabetic Ca mp of the Daegu a nd Kyungbook.

Nucle ic Acid Preparation

Ge no mic DNA e xtractio n. Mononuclear ce lls we re isolated from 10 mL of whole blood samples us ing a mmonium chloride e rythrocyte lysis buffe r. Genomic DNA was purified us ing 100 g/ L proteinase K and 0.5% sodium dodecyl s ulfate a nd then extracted in phe nol/chloroform/isoa mylalcohol (25:24:1).

Tota l RNA e xtra ctio n a nd c DNA s ynthe s is . Mononuclear ce lls we re isolated from 10 mL of whole blood sa mples us ing Ficoll- Paque solution (Pha rmacia Biotech., USA). Total cellular RNA was prepared as RNA Zol B (TEL- Test. INC., USA). To generate cDNA, 2 g total RNA was reve rse- transcribed in 20 g of reaction mixture conta ining 5 mmol MgCl

2

, 1 mmol dNTP, 1 U/ L RNase inhibitor, 2.5 U/ L MuLV reverse transcriptase and 2.5 M oligo d (T)

16

for 1h at 42℃.

Po lyme ras e c ha in re actio n (PCR). A set of primers was ge ne rated to PCR- a mplify a nucleotide segment, including the PstI+1127 restriction fragme nt le ngth polymorphis m (RFLP), in the 3' untrans lated region of

INS

2 4 )

. Sequences of the prime r pair we re as follows

(5'- 3'): INPsA, TGGTGCAGGCAGCCTGC ; INPs B,

GGTGGTTCAAGGGCTTTATT. Likewise , a prime r set

used to amplify IGF2- exon 9, including an Apa I RFLP,

was made as follows (5'- 3'): IGApA, CCTGGACTTTGAG

TCAAATTGG ; IGApB, CCTCCTTTGGTCTTACTGGG

3 0 )

.

500 ng genomic DNA and 4 g RT- product were s ubjected

to PCR for 35 cycles in a mixture containing each prime r

pair exposed to the following conditions : for INS PCR,

(3)

initial denaturation at 95℃ for 10 min by 35 cycle of 92℃

for 1 min, 55℃ for 1 min and 72℃ for 2 min.

RFLP Ana lys is . Afte r PCR products we re purified using the wiza rd PCR preps DNA purification system (Promega, USA), they we re digested with 30 U of PstI or ApaI at 37℃ ove rnight and electrophoresed on 2%

aga rose gel or 6% polyacrylamide gel. The ge l was the n sta ined with ethidium bromide for visualization.

Expre s s io n s tudie s . Express ion of the INS a nd IGF2 ge nes was assessed us ing the sa me PCR prime rs . GAPDH se rved a s a n inte rna l control for the reaction. A prime r set to a mplify GAPDH was made as follows (5'- 3') : S, CGTCTTCACCACCATGGAGA; AS, CGGCCATCACGCCACAGTT

3 5 )

. PCR amplification was ca rried out under the following conditions : initial denaturation at 95℃ for 10 min by 30 cycles of 94℃ for 30 sec, 60℃ for 30 sec and 72℃ for 30 sec. PCR products we re e lectrophoresed on 2% agarose gel followed by ethidium bromide sta ining. Sa mples were quantified by densitometry using a Molecular Analyst version 1.4 image a na lyzer (Ge l Doc 1000, Bio- RAD, USA).

RES ULTS

Ge notype De te rminatio n. The fa milie s of type I dia be tic patie nts we re s tudie d. Sixtee n of 42 families we re found to include type I diabetic membe rs , and 3 of these diabetic patients had a diabetic mother. None of the patients had a diabetic father. A total of 42 type 1 diabetic patie nts were ge notyped for the PstI+1127 a nd ApaI polymorphis m in INS a nd IGF2, respective ly (Table 1). The absence of a restriction site in INS is indicated as the '+' a lle le , while the a lle le containing the cutting s ite is te rmed '- ' a lle le . The abse nce and prese nce of the restriction s ite in IGF2 is indicated as the '- ' and '+' a lle le , respective ly. The INS PCR product was 19 1bp long, although there was more tha n one PstI restriction s ite present (Figure 1). Digestion of the PCR products with PstI produced, in the presence of two restriction s ites , fragments of s ize 86 bp a nd 6 1 bp. In the absence of restriction s ites , a fragme nt of 147 bp was ge nerated.

The IGF2 PCR product was 236bp long. Digestion of the PCR products with ApaI, in the prese nce of a restriction s ite , produced a 173 bp fragment a nd, in the absence of restriction s ites , a fragme nt of 236 bp was ge ne rate d.

Ps tI digestion of PCR products from ge nomic DNA demonstrated that 36 (97.3%) of the 37 IDDM patie nts tested were homozygous for the PstI (+/+) allele (Table 1, Figure 2A). PCR of genomic DNA revealed that 29 (72.5%)

of the 40 type 1 diabetic patie nts we re hete rozygous (ApaI (+/- )), while the others were homozygous (ApaI (- /- )) for the ApaI RFLP in IGF2 (Table 1). The frequencies of the INS/Ps tI (+/+) homozygous ge notype we re found to be much higher tha n the INS/Ps tI (+/- ) heterozygous genotype . These res ults confirm that the INS/PstI (+/+) homozygote is the domina nt ge notype in Kore a n type I diabetic patients .

Ta ble 1. Ge notype a na lys is fo r INS a nd IGF2 po lymo rphis ms in IDDM2

Alleles INS/Ps tI+1127

+/+ 36 (97.3%)

+/- 1 ( 2.7%)

tota l 37

'+' a lle le is abse nce of the restriction s ite '- ' a lle le is prese nce of the restriction s ite

Alleles IGF2/ApaI

- /- 11 (27.5%)

+/- 29 (72.5%)

tota l 40

'- ' a lle le is abse nce of the restriction s ite '+' a lle le is prese nce of the restriction s ite

Fig ure 1. Organization of the INS/IGF2 gene cluster. Arrows indicate some of the polymorphic loci in this region, including those cons ide red in the pres ent report (bold face).

VNTR, va riable numbe r of ta nde m repeats

Alle le - s pe c ific e xpre s s io n of INS a nd IGF2 . We

exa mined the presence of each a llele in the RNA

transcript from lymphocytes ide ntified as heterozygous ,

Ps tI (+/- ) a nd ApaI (+/- ). In Figure 2B a nd 2C, the

a mplification- digestion products of INS ge nomic and

complimenta ry DNA of two families are s hown. One of

the families expressed hete rozygous and all were found

to be both a lle les for the PstI polymorphis m in the ir

genomic DNA (Figure 2C). In the other family, the mothe r

was PstI (+/- ) heterozygous and the patient was PstI (+/+)

homozygous (Figure 2B). We could not de monstrate that

the INS ge notype was associated with parental imprinting

in IDDM tra ns miss ion beca use most of the patie nts had

(4)

PstI (+/+) INS genotypes . As illustrated in Table 2, both IGF2 alle les res ulted in ApaI digestion in 21 of the 24 ApaI (+/- ) hete rozygotes . In Figure 3B, a se ries of individua ls are shown who are cha racte rized by bialle lic IGF2 express ion. In Figure 3A, 2 individua ls who exhibit monoa llelic IGF2 expression a re listed. The refore, the prese nce of both of these alleles in RNA indicates that IGF2 imprinting is at least partia lly relaxed in these cells.

The relative intens ities of the PstI (+/- ) and PstI (+/+) RNA transcripts were measured using semi- quantitative RT- PCR.

We found a 3- fold higher leve l of RNA expression from the Pst I (+/- ) transcript compared to that of the Pst I (+/+) transcript in periphera l leukocytes (Figure 4). We a lso measured the re lative inte ns ities of IGF2 RNA transcripts in the sa me type 1 diabetic patie nts . In this case , the express ion of the Pst I (+/- ) tra nscript was greater than that of the Ps t I (+/+) tra nscript, although these patie nts s howed biallelic IGF2 express ion (Figure 4).

F ig ure 2 . Alle le- specific INS expres s ion in IDDM patie nts . Ge nomic DNA (g) a nd cDNA (c) we re a mplified to detect a n Ps tI+1127 polymorphis m. A, INS monoallelic expression. B a nd C, PCR a nd RT- PCR analyses of allele usage in two fa milies . m, ma rke r; g, ge nomic DNA; c, comple me nta ry DNA F, father; M, mothe r

F ig ure 3 . Represe ntative exa mples of IGF2 express ion from mononuclea r ce lls us ing the Apa I polymorphis m in exon 9 of the ge ne . A, IGF2 monoa llelic express ion. B, IGF2 bia lle lic express ion.

m, ma rke r; g, ge nomic DNA; c, comple me nta ry DNA

Ta ble 2 . Alle le - s pe c ific e xpre s s io n of IGF2 a nd INS ge ne s in IDDM2 .

IDDM CASE

IGF2 INS

gDNA cDNA F M gDNA cDNA F M

ID1 ID2 ID3 ID4 ID5 ID6 ID7 ID8 ID9 ID10 ID11 ID12 ID13 ID14 ID15 ID16 ID17 ID18 ID19 ID20 ID2 1 ID22 ID23 ID24 ID25 ID26 ID27 ID28 ID29 ID30 ID3 1 ID32 ID33 ID34 ID35 ID36 ID37 ID38 ID39 ID40 ID4 1 ID42

+/- - /- +/- +/- - /- - /- +/- +/- +/- +/- +/- +/- +/- +/- +/- +/- +/- +/- +/- +/- +/- - /- - /- +/- - /- +/- - /- - /- +/- +/- +/- +/-

+/- - /- - /- +/- - /- +/- +/-

+/- +/- - /- +/- +/- - /- - /- +/- - /- +/- +/-

+/- +/- +/- +/- +/- +/-

+/-

+/-

- /- +/- - /- +/- - /-

- /-

+/- +/- +/- - /- - /- - /- - /- +/- +/- +/- +/-

+/- - /-

+/-

+/-

+/-

+/- +/-

- /- - /- +/- +/-

+/- - /- - /-

- /-

+/-

+/-

+/- +/- - /- - /- +/- +/- +/- +/-

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/-

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/- +/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/- +/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/-

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/+

+/- , hete rozygote ; +/+, - /- , homozygote ; bla nk, unchecked

g, genomic; c, compleme nta ry; F, fathe r; M, mothe r

(5)

F ig ure 4 . INS a nd IGF2 mRNA express ion in mononuclea r cells by RT- PCR.

A, Expres s ion of the INS mRNA betwee n ID32 a nd ID39.

B, Diffe re nces of the INS (191bp) a nd IGF2 (236bp) mRNA express ion betwee n ID32 a nd ID39.

DIS C US S IO N

Warram et al

2 0 )

. proposed that IDDM is transmitted to offspring by diabetic fathers more tha n twice as often as by diabetic mothers . This is the first indication that IDDM is related to parental imprinting. Following studies we nt on to exa mine the evidence of a linkage between IDDM transmission a nd pa re nta l imprinting

1 4 , 2 1 - 2 4 , 3 0 , 3 2 )

. Of the families included in this study, 16 out of 42 were found to include type I diabetic members. Of these, 3 had a diabetic mothe r, although none had a diabetic fathe r.

These findings contrast with those from a previous report

2 0 )

. We ca nnot expla in the re lations hip betwee n IDDM tra ns miss ion and pa rental imprinting. INS and IGF2 a re cons idered prime ca ndidate ge nes for the IDDM2 locus and for IDDM2- encoded susceptibility

14 , 2 1 , 2 2 , 2 4 )

. This is especially true since IGF2 is exclusively expressed by the pate rna l copy in most tissues

3 3 )

, which leads to our hypothes is that IDDM- encoded s usceptibility is mediated by IGF2

3 2 )

. To test this, we examined genotype determi- nation and allele- specific expression using mononuclear ce lls from IDDM patie nts and the ir pa rents . Twe nty- nine of 40 type 1 diabetic patie nts express hete rozygous a nd the data of pa renta l ge notype we re available in only 9 of 29 type 1 diabetes patients. Only 3 cases of IGF2 mRNA revea led mate rna l origin. There see ms to be polymorphic re laxation of IGF2 imprinting in leukocytes. But we need

to require a much larger numbe r of sa mples for statistica l va lidity. Howeve r, these res ults a re s imila r to the findings of previous reports that showed that IGF2 imprinting is relaxed in human peripheral lymphocytes

3 6 , 3 7 )

. This relaxation was incomplete as mate rna l alle le mRNA was syste matica lly at a lower leve l tha n paternal. The paternal/mate rna l ratio va ried widely among individua l s ubjects. Variable re laxation of IGF2 imprinting seen in huma n leucocytes is not depe ndent on the presence of a class I vers us a class III VNTR

3 6 , 3 7 )

. Conclusive ly, mRNA from both IGF2 a lle les was see n a nd it indicated re laxation of pare ntal imprinting of IGF2 in leukocyte samples . Our results we re not enough to eva luate the IGF2 imprinting effect but we could not exclude IGF2 as the ca ndidate ge ne involved in IDDM2. However, the absence of a n IGF2 imprinting effect suggests that, if there is a pare nta l component in IDDM tra ns miss ion, it is not mediated through IGF2. INS was s hown to be imprinted in the yolk sac but not in the pancreas of

mice

2 8 )

. Mate rna l imprinting of the INS gene has origina lly

bee n cons ide red the most favorable expla nation for the observed ge nde r- re lated difference . However, previous studies demonstrated a biallelic expression of INS in pancreatic tissues with monoallelic and biallelic express ion in the thymus of human fetuses . This s uggests that INS is probably not imprinted in these tiss ues and is expressed tiss ue- specific patte rn

3 6 - 4 0 )

.

We studied the specific pattern of INS genotypes and the association of the ir a lle le- specific expression a nd INS imprinting in periphe ra l mononuclea r cells from Korean type I diabetic patie nts. Thirty- six of the 37 IDDM patients were found to be PstI (+/+) and in 1 case, PstI (+/- ). We could not demonstrate that the INS genotype was associated with pa rental imprinting in IDDM tra ns miss ion beca use the majority of Korea ns had PstI (+/+) INS ge notypes . Also, the re was no information about pare nta l imprinting pattern of INS ge notype in Asia beca use it had bee n difficult to get examples due to the sa me reason. This is the limitation to the study of INS genotype transmission in Korea. However, we can not exclude genetic and e nviron- me ntal differe nces betwee n the patie nts of Korea and western countries, in which the occurrence of type 1 diabetes is found to be e ither rare or more common, respectively.

The RT- PCR assay of Bennett et al

2 4 )

. provides some

evide nce for a quantitative ly diffe rent express ion of the

INS '+' a nd '- ' forms in the two hete rozygotes. Bennett

et al de monstrated 1.5 to 3- fold more expression of

class I than class III haplotypes . We also measured the

re lations hip betwee n the ge notypes a nd INS transcription

(6)

levels us ing semi- quantitative RT- PCR. Our findings we re s imila r to Bennett et al.

2 4 )

in that we found a 3- fold higher leve l of express ion from PstI (+/- ) with class I/III compared to PstI (+/+) with class III/III. Howeve r, Pugliese et al.

4 0 )

observed that class III VNTR/PstI (- ) mRNAs were transcribed at higher leve ls (2.5- fold on average) tha n class I VNTR/PstI (+) mRNA in the thymus a nd inverse corre lation was found in pancreatic islet cell samples . VNTR a lle les corre late with diffe re ntia l INS mRNA expression in the thymus where protective class III VNTRs a re associated with higher steady- state leve ls of INS mRNA expression. This finding could explain the dominant protective effect of class III VNTRs beca use the elevated level of proinsulin in the thymus enhances negative deletion of insulin specific T- lymphocytes which play a critical role in the pathogenesis of type 1 diabetes

14 , 16 , 2 4 )

. Our results are consistent with those of previous reports a nd indicate a diffe re nt RNA tra nscriptiona l leve l for INS ge notype according to VNTR class . Howeve r, our studies of the re lations hip betwee n INS imprinting a nd a lle le- specific expression need to be conducted in a larger population of type I diabetic patie nts. Furthe r study of both the ge netic be havior of specific alleles within VNTR classes and their effect on transcription levels will be needed to conclus ively confirm and define the association between INS transcription levels and IDDM parental transmission. Then, we may be able to bette r confirm pare ntal ge nomic imprinting of IDDM2 trans mission in the Korea n type I diabetic population.

REFERENCES

1. Hall J G. Genomic imprinting: Review and relevance to human diseases. Am J Hum Genet 46:857- 873, 1990 2. Sapie nza C. Genomic imprinting: An Overview. Dev

Genet 17:185- 187, 1995

3. Ba rlows DP. Genomic imprinting in mammals. Science 270:1610- 1613, 1995

4. John RM. Surani MA. Imprinted genes and regulation of gene expression by epigenetic inheritance. Curr Opi Cell Biol 8:348- 353, 1996

5. Hoffma n AR, Vu TH. Genomic imprinting. Sci Am 52- 61, 1996

6. Reik W, Sura ni MA. Genomic imprinting and embry onal tumors. Nature 338:112- 113, 1989

7. Nicholls RD, Knol J HM, Butler MG, Karam S, La lande M.

Genetic imprinting s uggested by maternal heterodis omy in nondeletion Parder- Willi syndrome. Nature 342:28 1-285,

1989.

8. Bach J F. Ins ulin- dependent diabetes mellitus as an autoimmune diseas e. Endocr Rev 15:5 16- 542, 1994 9. Todd JA, Farra ll M. Panning for gold: genome- wide

scanning for linkage in type 1 diabetes. Hum Mol Genet 5:1443- 1448, 1996

10. Field LL, Tobias R. Unravelling a complex trait: the genetics of ins ulin- dependent diabetes mellitus. Clin Invest Med 20:40-49, 1997

11. Risch N. Assessing the role of HLA- linked and unlinked determinants of disease. Am J Hum Genet 40:1- 14, 1987 12. Davies J L, Yos hihiko K, Be nnett S, Cope man J B, Corde ll

HJ , Pritchard LE, Reed PW, Gough SCL, J enkins SC. A genome- wide s earch for human type 1 diabetes susceptibility genes. Nature 371:130- 136, 1994

13. Bell GI, Horita S, Karam J H. A polymorphic locus near the human insulin gene is ass ociated with insulin- dependent diabetes mellitus. Diabetes 33:176- 183, 1984

14. J ulie r C, Hye r RN, Davies J , Merlin F, Soula rue P, Briant L, Cathe linea u G, Descha mps I, Rotter J I, Froguel P, Boitard C, Be ll J I, Lathrop GM. Ins ulin- IGF2 region on chromosome 11p encodes a gene implicated in HLA- DR4- dependent diabetes susceptibility. Nature 354:155-

158, 199 1

15. Ba in SC, Prins J B, Hearne CM, Rodrigues NR, Rowe BR, Pritchard LE, Richie RJ , Hall J R, Undlien DE, Ronningsen KS, Dunger DB, Ba rnett AH, Todd JA.

Insulin gene region- encoded s uscep tibility to type 1 diabetes is not restricted to HLA- DR4-positive individuals.

Nat Genet 2:2 12-2 15, 1992

16. Lucassen AM, J ulier C, Be ress i J P, Bottard C, Frogue l P, Lathrop M, Bell J I. Susceptibility to ins ulin dependent diabetes mellitus maps to a 4. 1kb s egment of DNA spanning the insulin gene and associated VNTR. Nat Genet 4:305- 3 10, 1993

17. Owe rbach D, Gabbay KH. Localiz ation of a type 1 diabetes susceptibility locus to the variable tandem repeat region flanking the ins ulin gene. Diabetes 42:1708- 1714,

1993

18. She JX, Bui MM, Tian XH, Muir A, Wa ke land EK, Zorovich B, Zha ng LP, Liu MC, Thomson G, Maclaren NK. Additive susceptibility to insulin- dep endent diabetes conferred by HLA-DQB1 and insulin genes. Autoimmunity

18:19 15- 1203, 1994

19. Cope man J B, Cucca F, Hearne CM, Corna ll RJ , Reed PW, Ronninge n KS, Undlien DE, Niscito L, Buzzetti R, Tos i R, Pociot F, Nerup J , Cornelis F, Ba rnett AH, Bain SC, Todd JA. Linkage dis equilibrium mapping of a type 1 diabetes s usceptibility gene(IDDM7) to chromosome 2q3 1- q33. Nat Genet 9:80- 85, 1994

20. Warra m J H, Krolews ki AS, Gottlieb MS, Ka hn CR.

Differences in risk of ins ulin- dependent diabetes in

offspring of diabetic mothers and diabetic fathers. N Engl

J Med 3 11:149- 152, 1984

(7)

21. Bui MM, Muir A, Macla re n NK, She JX. Linkage of the insulin gene with insulin- dependent diabetes in Caucasians suggest a maternal imprinting effect. Diabetes 42:63A, 1993 22. Pugliese A, Awdeh ZL, Alper CA, Jackson RA, Eise nba rth GS. The paternally inherited insulin gene B allele (1,428 Fok I site) confers protection from insulin- dep endent diabetes in families. J Autoimmunity 7:687- 694, 1994 23. Polychrona kos C, Kukuvitis A, Gia nnouka kis N, Colle E.

Parental imprinting effect at the INS - IGF2 diabetes susceptibility locus. Diabetologia 38:715- 719, 1995 24. Be nnett ST, Lucassen AM, Gough SCL, Powell EE,

Undlie n DE, Pritchard LE, Merrima n ME, Kawaguchi Y, Dronsfie ld MJ , Pociot F, Nerup J , Bouze kri N, Ronningen KS, Barnett AH, Bain SC, Todd JA. Susceptibility to human type 1 diabetes at IDDM is determined by tandem repeat variation at the insulin gene minisatellite locus. Nat Genet 9:284-292, 1995

25. Lucassen AN, Screaton GR, J ulier C, Elliott TJ , Lathrop M, Bell J I. Regulation of ins ulin gene expression by the IDDM associated, insulin local haplotype. Hum Mol Genet 4:501- 506, 1995

26. Owerbach D, Gabbay KH. The search for IDDM s usceptibility genes: the next generation. Diabetes 45:544- 55 1, 1996 27. Ke nnedy GC, Ge rma n MS, Rutte r WJ . The minisatellite

in the diabetes s uscep tibility locus IDDM2 regulates ins ulin transcription. Nat Genet 9:293-298, 1995

28. Giddings SJ , King CD, Harman KW, Flood J F, Carnaghi LR. Allele specific inactivation of insulin 1and 2, in the mouse yolk sac, indicates imprinting. Nat Genet 6:3 10- 3 13, 1994 29. DiChiara TM, Robertson EJ . Parental imprinting of the

mouse insulin- like growth factor II gene. Cell 64:849- 859, 199 1

30. Giannouka kis N, Deal C, Paquette J , Goodye r CG, Polychrona kos C. Parental genomic imprinting of the human IGF2 gene. Nat Genet 4:98- 101, 1993

31. Giannouka kis N, Dea l C, Paquette J , Kukuvitis A, Polychrona kos C. Polymorphic functional imprinting of the human IGF2 gene among individuals, in blood cells, is ass ociated with H19 expression. Biochem Biophys Res Commun 220:1014- 10 19, 1996

32. Polychrona kos C, Gia nnoukakis N, Deal C. Imprinting of IGF2, Insulin dependent diabetes, immune function, and apoptosis : A hypothesis. Dev Genet 17:253-262,

1995

33. Ward A, Bates P, Fis he r R, Richa rdson L, Gra ha m CF.

Disproportionate growth in mice with IGF-2 transgenes.

Proc Natl Acad Sci USA 9 1:10365- 10369, 1994 34. Thompson MA, Cox AJ , White head RH, Jonas HA.

Autocrine regulation of human tumor cell proliferation by insulin-like growth factor II : an in vitro model. Endocrinology

126:3033- 3042, 1990.

35. Lucibello FC, Sewing A, Brusse lbach S, Burge r C, Muller R. Deregulation of cyclins D1 and E and s uppression of cdk2 and cdk4 in s enescent human fibroblas ts. J Cell Sci

105:123- 133, 1993

36. Vafiadis P, Be nnett ST, Colle E, Grabs R, Goodye r CG, Polychronakos C. Imprinted and genotype-specific expression of genes at the IDDM2 locus in pancreas and leucocy tes. J Autoimmun 9:397-403, 1996

37. Vafiadis P, Bennett ST, Todd JA, Grabs R, Polychronakos C. Divergence between genetic determinants of IGF2 transcription levels in leukocy tes and of IDDM2- encoded susceptibility to type 1 diabetes. J Clin Endocrinol Metab 83:2933-2939, 1998

38. Bui MM, Luo F, She JY, Maclaren NK, Murr A, Tomson G, She JX. Paternally transmitted IDDM2 influences diabetes s uscep tibility despite biallelic expression of the ins ulin gene in human pancreas. J Autoimmun 9:97- 103,

1996

39. Vafiadis P, Bennett ST, Todd JA, Nadea u J , Grabs R, Goodyer CG, Wickra mas inghe S, Colle E, Polychrona kos C. Insulin expression in human thymus is modulated by INS VNTR alleles at the IDDM2 locus. Nat Genet

15:289-292, 1997

40. Puglies A, Ze lle r M, Fe rna ndez A, Za lcbe rg LJ , Ba rtlett

RJ , Ricordi C, Pietropaolo M, Eise nba rth GS, Be nnett

ST, Pate l DD. The insulin gene is transcribed in the

human thymus and transcription levels correlate with

allelic variation at the INS VNTR-IDDM2 s uscep tibility

locus for typ e 1 diabetes. Nat Genet 15:293-297, 1997

수치

Fig ure 1. Organization of the INS/IGF2 gene cluster. Arrows indicate some of the polymorphic loci in this region, including those cons ide red in the pres ent report (bold face).

참조

관련 문서