The Effects of Interleukin-17 on Production of Matrix Metalloproteinase-3 in Cultured Rheumatoid Arthritis Synoviocytes

(1)

Vol. 11, No. 1, March, 2004

ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ

＜접수일：2003년 8월 20일, 심사통과일：2003년 12월 3일＞

※통신저자：김 성 일

부산시 서구 아미동 1가 10번지 부산대학교 의과대학 내과학교실

Tel：051) 240-7928, Fax：051) 254-3127, E-mail：[email protected] 본 연구는 2002년도 부산대학교병원 지정연구비 지원에 의하여 연구되었음.

Interleukin-17이 배양된 류마티스 관절염 활막세포에서 Matrix Metalloproteinase-3의 생성에 미치는 영향

부산대학교병원 의학연구소*, 부산대학교 의과대학 내과학교실

류 선*․김 성 일

= Abstract =

The Effects of Interleukin-17 on Production of Matrix Metalloproteinase-3 in Cultured Rheumatoid Arthritis Synoviocytes

Sun Ryu*, Sung Il Kim, M.D.

Medical Research Institute, Pusan National University Hospital, Busan, Korea*

Department of Internal Medicine, College of Medicine, Pusan National University, Busan, Korea

Objective: To investigate the effect of interleukin-17 (IL-17) on the production of matrix metalloproteinase-3 (MMP-3) and the expression of MMP-3 mRNA in rheumatoid arthritis synoviocytes.

Methods: Fibroblast-like synovial cells (FLS) were prepared from the synovial tissues of rheumatoid arthritis patients and cultured in the presence of various concentration of IL-17. The production of MMP-3 and expression of MMP-3 mRNA were determined by sandwitch ELISA and real-time quantitative RT-PCR.

Results: In ELISA, stimulation of FLS by IL-17 with 5, 10, 20, 40 ng/mL concentrations increased the production of MMP-3 by 2.7, 2.9, 3.1, 3.6 fold after 24 hours and 9.9, 10, 11, 12 fold after 48 hours over the constitutive levels of unstimulated FLS. In real-time quantitative RT-PCR, stimulation of FLS by IL-17 with 5, 10, 20, 40 ng/mL concentrations increased the MMP-3/β-actin mRNA ratio by 3.2, 5.7, 9.9, 30.5 fold after 24 hours over the constitutive levels of unstimulated FLS.

(2)

서 론

Interleukin-17 (IL-17)은 CD4+ 림프구에서 생성되 어 섬유모세포, 내피세포 및 상피세포에 작용하여 다양한 생물학적 작용을 하며, 주로 염증반응 및 조 혈작용을 한다. 수용체는 다른 사이토카인 수용체와 는 상동성이 없으며 다양한 조직에서 발현된다. 류 마티스 관절염에서는 활막의 Th1 림프구에서 생성 되어 활막의 활막세포, 단핵구, 대식세포 및 연골세 포 등에 작용하여 다양한 사이토카인을 유리시켜 관 절의 염증 및 파괴에 주요한 역할을 한다^1,2).

Matrix metalloproteinases (MMPs)는 골 및 연골의 기질 구성요소를 파괴하는 단백 분해효소로서 정상 조직의 분화, 창상 치유, 기관 형성, 생식, 혈관생성, 조직흡수 및 재형성 등의 과정에 주요한 역할을 하 며, 동맥경화증, 종양 침범 및 관절염 등의 병적인 상태에서도 발현되어 병인에 주요한 역할을 한다^3,4). MMP-1 (interstitial collagenase) 및 MMP-3 (stromelysin)는 관절염에서 특히 중요하며^5-9), 류마티스 관절

염^10-12) 및 류마티스 관절염 동물모델^13,14)의 골 미란

이 발생하는 곳에서 발현된다. 최근 MMP-1 및 MMP-3는 초기 류마티스 관절염 환자에서 관절파괴 를 예측할 수 있는 인자로 알려졌다^15-19). MMP-3는 류마티스 관절염의 활막세포 및 연골세포에서 생성

되며^20,21) MMP-2 및 MMP-9를 활성화해²²⁾ 연골파괴

에 주요한 역할을 한다²³⁾.

MMPs 발현은 성장인자, 호르몬 및 사이토카인에 영향을 받으며, 활성은 MMPs의 전구물질 및 tissue inhibitors of matalloproteinases (TIMPs)에 의하여 조 절된다. 활막세포에서 IL-1, tumor necrosis factor-α (TNF-α) 및 IL-17은 MMP-1의 생성을 촉진시키고, IL-4, IL-13 및 IL-10은 MMP-1의 생성 감소 및 TIMP-1의 생성을 촉진시킨다²⁾. 또한, IL-17은 우형연 골에서 MMP-1 및 MMP-3의 발현을 증가시켜 연골 의 제 2형 콜라겐의 파괴를 증가시키고²⁴⁾, 류마티스

관절염의 활막과 골에서 제 1형 콜라겐의 파괴를 증 가시키고 생성을 억제한다²⁵⁾.

IL-17이 활막세포에서 연골의 파괴에 중요한 MMP- 3 생성에 미치는 영향에 대한 보고는 없다. 본 연구 는 배양된 류마티스 관절염 활막세포에서 IL-17이 MMP-3의 생성에 미치는 영향을 알아보고자 하였다.

대상 및 방법 1. 활막세포 분리와 배양

활막세포는 미국 류마티스학회의 류마티스 관절염 진단기준(1987년)에 부합되는 환자로 관절경을 이용 한 슬관절 활막절제술 또는 관절치환술을 시행한 환 자의 활막을 사용하였다. 채취된 활막의 지방과 섬 유조직을 제거하고 약 2∼3 mm³로 잘라 4 mg/mL의 collagenase (type I; Worthington Biochemical, NJ)로 처리 후 Dulbecco's Modified Eagle Medium (DMEM, Life Technologies, NY) 용액에 넣어 37^oC, 5% CO2

가 공급되는 배양기(incubator)에서 4시간 처리하고 200μm의 나이론 체를 3회 통과시켰다. 이를 500×g 으로 원심분리한 후 75 cm² flask에 10% fetal bovine serum (FBS, Life Technologies, NY), 2 mM glutamine, penicillin (100 U/mL) 및 streptomycin (100 ug/mL)이 포함된 DMEM에 다시 부유시킨 후 배양하였다. 배 양액은 3일마다 교환하였으며 세포가 충분히 자라면 배양액을 완전히 흡입하여 내고 phosphate buffer saline (PBS)로 1회 세척한 후 0.25% trypsin-0.02%

EDTA로 처리하여 계대 배양하였다. 활막 섬유모세 포는 3∼8회 계대 배양한 세포를 사용하였다.

2. IL-17의 MMP-3 생성에 미치는 영향

24-well plate에 각 well당 1 mL의 DMEM과 6×10⁴ 의 활막세포를 넣고 37^oC, 5% CO2 배양기에서 24시 간 배양 후 배양액을 insulin-transferrin-selenium A가 포함된 serum free DMEM으로 교환하고 다시 24시 간 37^oC, 5% CO2 배양기에서 배양 후 각 well에 IL- Conclusion: IL-17 may be involved in the joint destruction in rheumatoid arthritis by enhancing the production of MMP-3 from rheumatoid arthritis synoviocytes.

ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ Key Words: Rheumatoid arthritis synoviocytes, MMP-3, IL-17

(3)

17을 5, 10, 20, 40 ng/mL로 투여하고, 37^oC, 5% CO2

배양기에서 24, 48시간 배양 후 배양 상층액을 모아 -20C^o에서 보관한 후 MMP-3는 sandwitch ELISA kit (Amersham, UK)을 이용하여 측정하였다.

3. IL-17의 MMP-3 mRNA 발현에 미치는 영향

1) Total RNA 분리: 활막세포(5×10⁴)가 포함된 세 포 배양액 1 mL를 100 cm² dish에 부유한 후 IL-17 을 5, 10, 20, 40 ng/mL로 투여하고, 24시간 37^oC, 5% CO2 배양기에서 배양 후 활막세포로부터 TRIzol 용액(Life Technologies, Inc.NY)을 이용하여 총 RNA 를 추출하였다.

2) cDNA 합성: 각 튜브에 1μg의 총 RNA, 1μL의 Oligo (dT) primer (Promega, USA), 5μL의 M-MLV 5X Reaction Buffer(Promega, USA; 250 mM Tris-HCl, 375 mM KCl, 15 nM MgCl2, 50 mM DTT), 4μL의 2.5 mM dNTP 혼합물(Promega, USA), 25 units의 RNasin (Promega, USA), 200 units의 M-MLV RT (Promega, USA)를 넣어 총 20μL가 되게 한 후 70^oC 에서 10분, 37^oC에서 1시간 동안 반응시켜 cDNA를 얻었다.

3) Real-time quantitative RT-PCR: LightCycler Sys- tem Instrument (Roche Applied Science)를 이용하였 다. Microcapillary tube에 LightCycler-DNA Master SYBR GreenⅠ1X(Roche Applied Science), template 100 ng, β-actin 및 MMP-3의 시발체 0.5 uM, MgCl2

를 4 mM를 혼합 후 증류수로 최종 부피를 20μL로 만든 후 95ôC에서 10분, 95ôC에서 10초, 60ôC에서 5 초, 72ôC에서 10초 동안 40회 반응시켰다. MMP-3 및 β-actin 시발체는 Bioneer (korea)에서 구입하였고 염기서열은 MMP-3 (F:GCAGTTTGCTCAGCCTATCC,

CCTTCCAGCAGATGT, R:CACCTTCACCGTTCCAGTTT) 이다. 발현율이 가장 높을 것으로 예상되는 IL-17 40 ng의 농도로 자극 후 RNA로 합성된 cDNA를 희석 하여 concentration standard로 사용하였다. 각 주기마 다 형광 신호를 모니터링하여 나타나는 threshhold cycle (CT)을 분석하여 각각의 실험군 사이의 mRNA 양을 분석하였다. 각 실험을 3회 실시하여 결과를 분석하였다.

결 과 1. IL-17의 MMP-3 생성에 대한 영향

IL-17 자극 24시간 후 배양 상층액 MMP-3 농도는 대조군 (8.7±0.4 ng/mL)에 비하여 IL-17 투여농도인 5, 10, 20, 40 ng/mL에 따라 2.7배(23.3±2.5 ng/mL), 2.9배(25±2.9 ng/mL), 3.1배(27±2.7 ng/mL), 3.6배(31

±1.9 ng/mL) 증가하였고, 48시간 후 대조군(16±5.2 ng/mL)에 비하여 IL-17 투여농도인 5, 10, 20, 40 ng/mL에 따라 9.9배(157.7±3.5 ng/mL), 10배(160±

9.8 ng/mL), 11배(175±11.2 ng/mL), 12배(185±9.5 ng/mL) 증가하였다(표 1).

2. IL-17의 MMP-3 mRNA 발현에 대한 영향

1) Melting curve: MMP-3 melting temperature (Tm.) 는 약 83^oC이고 단일 산물이 증폭됨을 확인하였으 며, agarose gel에 전기 영동하여 250 bp의 크기의 단 일 band가 나타남을 확인하였다.

2) Standard curve: 각 증폭 단계에서 생성된 산물 의 양을 로그화하였을 때 상관계수는 -1.0으로 증 폭횟수와 생성된 산물의 양은 양호한 상관관계를 나 타냈다.

Table 1. Stimulation of IL-17 on cultured rheumatoid arthritis synoviocytes enhanced the production of matrix matalloproteinase-3. Fibroblast-like synovial cells (FLS) were prepared from the synovial tissues of rheumatoid arthritis patients and cultured in the presence of various concentration of IL-17. The production of MMP-3 was determined by sandwitch ELISA

ꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧꠧ

Concentration of IL-17 (ng/mL)

Control ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ

5 10 20 40

ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ

MMP-3 24h 8.7±0.4 23.3±2.5 25±2.9 27±2.7 31±1.9

(ng/mL) 48h 16±5.2 157.7±3.5 160±9.8 175±11.2 185±9.5

ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ

(4)

3) IL-17의 투여 농도에 따른 MMP-3 mRNA의 발 현은 증폭 그래프에서 각 그룹 간에 증폭의 차이, 즉 CT 값의 차이가 있었다. MMP-3 mRNA의 발현량 을 β-actin mRNA의 발현량으로 보정하여 발현 차이 를 측정한 상대적 CT 분석법을 적용하였다. IL-17 자극 24시간 후 활막세포에서의 MMP-3 mRNA는 대 조군에 비하여 IL-17 투여농도인 5, 10, 20, 40 ng/

mL에 따라 3.2±0.5, 5.7±1.0, 9.9±1.9, 30.5±4.8배 증가하였다(그림 1).

고 찰

본 연구는 IL-17이 류마티스 관절염 활막세포에서 MMP-3의 생성을 증가시킴을 확인하였다.

IL-17은 Th1 세포에서 생성되는 염증유발 사이토 카인으로 류마티스 관절염의 염증지속 및 관절파괴 에 주요한 역할을 한다. Collagen induced arthritis (CIA)에서 IL-17은 관절염의 발생초기에 발현이 증 가되고, IL-17을 관절 내 투여 시 염증을 악화시키고 관절 내 골 및 연골의 파괴가 증가된다²⁶⁾. 이러한 골 파괴는 파골세포의 활성에 의한 골흡수가 증가되 기 때문이며, 파골세포는 표면에 존재하는 receptor

activator of NFκB (RANK)가 관절 내 염증세포 및 활막세포에서 유리되는 RANK ligang (RANKL)과 결 합 시 활성화되며, osteoprotegerin (OPG)과 결합 시 활성이 억제된다²⁷⁾. Proinflammatory 사이토카인들은 RANKL/OPG 균형의 변화를 유발하여 골 파괴를 일 으키는 것으로 추측되며²⁸⁾, CIA에서 IL-17이 RANKL/

OPG 균형의 변화를 유발하여 골 미란을 일으킴이 보고되었다²⁹⁾.

류마티스 관절염의 연골 파괴에서 MMPs의 역할 이 주요하며, 이들의 생성은 성장인자, 호르몬 및 다 양한 종류의 사이토카인에 영향을 받으며, 활성은 tissue inhibitors of meatlloproteinases (TIMPs)에 의하 여 엄격히 조절된다³⁰⁾. MMP-1 및 MMP-3는 류마티 스관절염의 연골파괴에 주요한 MMPs로 IL-1, tumor necrosis factor-α (TNF-α) 및 IL-17에 의해 활막세포 에서 MMP-1의 생성을 촉진시키고, IL-4, IL-13 및 IL-10은 MMP-1의 생성 감소 및 TIMP-1의 생성을 촉진시킨다²⁾.

MMP-3는 류마티스 관절염의 활막세포 및 연골세 포에서 생성되어 4형, 5형, 9형 및 10형 콜라겐과 aggrecan을 파괴하고^20,21), MMP-2 및 MMP-9를 활성 화해²²⁾ 연골파괴에 주요한 역할을 하며²³⁾, 임상적으 로 MMP-3 혈중 농도는 초기 류마티스관절염 환자 에서 관절파괴를 예측할 수 있는 인자이다^15-19). MMP-3의 생성은 단핵구 및 대식세포에서 유리되는 IL-1β 및 TNF-α에 의하여 강력히 촉진되며^31-34), TIMP-1에 의하여 활성이 엄격히 조절된다. Koshy 등²⁴⁾은 IL-17이 배양된 우형 연골세포에서 MMP-1, MMP-3 및 MMP-13의 발현을 증가시키고, IL-1 및 TNF-α와 함께 투여 시 상승작용이 있으며, 제 2형 콜라겐 및 proteoglycan의 파괴가 증가됨을 보고하였 다. Bamba 등³⁵⁾은 대장의 상피하 근육섬유모세포에 서 IL-17, TNF-α 및 IL-1 β는 MMP-3의 생성을 증 가시키고, 특히 IL-17은 TNF-α 또는 IL-1 β의 MMP- 3 생성 및 TIMP-1 발현을 증가시킨다고 보고하였다.

본 연구는 Th1 세포에서 생성되는 IL-17이 류마티 스 관절염 활막세포에서 MMP-3의 생성을 증가시킴 을 확인하였으며, 이러한 결과는 IL-17이 활막세포를 자극하여 MMP-3 생성을 증가시켜 연골파괴에 관여 함을 추측할 수 있었다. IL-17의 MMP-3의 생성 증 가는 IL-17이 활막세포에 직접 작용하여 MMP-3 생 Fig 1. Comparison of real-time quantitative RT-PCR

analysies in the presence of various concentration of IL-17. Stimulation of FLS by IL-17 with 5, 10, 20, 40 ng/mL concentrations increased the MMP-3/β-actin mRNA ratio by 3.2±0.5, 5.7±1.0, 9.9±1.9, 30.5±4.8 fold after 24 hours over the constitutive levels of unstimulated FLS.

MMP-3/-actin mRNAβ

Control IL-17

5 ng IL-17

10 ng IL-17

20 ng IL-17 40 ng

(5)

성을 증가시켰거나, 활막세포에서 TNF-α 및 IL-1의 생성을 증가시켜 이들에 의하여 활막세포가 MMP-3 생성을 촉진시킬 수 있다. TNF-α 및 IL-1이 주로 단핵구에서 생성되는 염증 사이토카인이므로 후자의 영향이 적을 것으로 추측되나, 향후 대조군 및 IL-17 의 투여군 배양액에서 TNF-α 및 IL-1의 생성을 비 교 측정하는 것은 도움이 될 것으로 생각된다. 본 연구에서 대조군과 IL-17 투여군에서 MMP-3의 mRNA 농도와 단백생성량의 상대적 차이는 각 측정방법의 민감도와 mRNA의 단백생성에 대한 효율성 등이 연 관될 것으로 추측된다.

연골 파괴는 다양한 종류의 MMPs가 관여하므로, 향후 활막 섬유모세포에서 각 MMPs의 생성과 MMP- 3의 활성을 조절하는 TIMP-1의 발현에 대한 IL-17의 영향, MMP-3의 생성에 대한 다른 염증 사이토카인 들의 영향과 IL-17과의 상호작용 등에 대한 연구가 진행되어야 할 것으로 생각된다.

결 론

저자들은 IL-17이 류마티스 관절염 활막 세포에서 MMP-3 생성을 증가시켜 관절 파괴에 관여함을 알 수 있었다.

REFERENCES

1) MJM Chaboud, Durand, Buchs N, Fossiez F, Page G, Frappart L, Miossec P. Human interleukin- 17:

a T cell-derived proinflammatory cytokine produced by the rheumatoid synovium. Arthritis Rheum 1999;

42:963.

2) Pierre Miossec. Interleukin-17 in rheumatoid arthritis; If T cells were to contribute to inflammation and destruction through synergy. Arthritis Rheum 2003;48:594-601.

3) Libby P, Aikawa M. New insights into plaque stabilization by lipid lowering. Drug 1998;56:9-13.

4) McCawley LJ, Matirsian LM. Matrix metalloproteinases: multifunctional contributors to tumor progression. Mol Med today 2000;6:149-56.

5) Walakovits LA, Moore VL, Bhardwaj N, Gallick GS, Lark MW. Detection of stromelysin and collagenase in synovial fluid from patients with rheumatoid arthritis and posttraumtic knee injury.

Arthritis Rheum 1992;35:35-42.

6) Konttinen YT, Ainola M, Valleala H, Ma J, Ida H, Madelin J, et al. Analysis of 16 different matrix metalloproteinases (MMP-1 to MMP-20) in the synovial membrane: different profiles in trauma and rheumatoid arthritis. Ann Rheum Dis 1999;

58:691-7.

7) McCachren SS. Expression of metalloproteinases and metalloproteinase inhibitor in human arthritis synovium. Arthritis Rheum 1991;34:1085-93.

8) Gravallese EM, Darling JM, Ladd AL, Katz JN, Gilmcher LH. In situ hybridization studies of stromelysin and collagenase messenger RNA expression in rheumatoid synovium. Arthritis Rheum 1991;34:1076-84.

9) Keyszer G, Lambiri I, Nagel R, Keysser C, Keys- ser M, GromnicaIhle E, et al. Circulating levels of matrix metalloproteinases MMP3 and MMP1, tissue inhibitor of metalloproteinases 1 (TIMP1) and MMP1/TIMP1 complex in rheumatic disease: cor- relation with clinical activity of rheumatoid arthritis versus other surrogate markers. J Rheumatol 1999;26:251-8.

10) Taylor TJ, Cheung NT, Dawes PT. Increased serum proMMP3 in inflammatory arthritides: a potential indicator of synovial inflammatory mono- kine activity. Ann Rheum Dis 1994;53:768-72.

11) Tetlow LC, Woolley DE. Mast cells, cytokines, and metalloproteinases at the rheumatoid lesion:

dual immunolocalisation studies. Ann Rheum Dis 1995;54:896-903.

12) Wooley ED, Crossley MJ, Evanson JM. Colla- genase at sites of cartilage erosion in the rheumatoid joint. Arthritis Rheum 1997;20:1231-9.

13) Reife RA, Hasty KA, Mainardi CL, Stuart JM.

Immunolocalization of metalloproteinases in collagen autoimmune arthritis. Matrix 1992;Suppl 1:397.

14) Trabandt A, Gay RE, Girkedal-Hansen H, Gay S.

Expression of collagenase and potential transcriptional factors in the MRL/l mouse arthropathy.

Semin Arthritis Rheum 1992;21:246-51.

15) Posthummus MD, Limburg PC, Westra J. Serum levels of matrix metalloproteinase-3 in relation to the development of radiological damage in patients with eraly rheumatoid arthritis. Rheumatology 1999;

38:1081-7.

16) Fenner H, Rau R, Herborn G. Can circulationg proMMP-1/pro-MMP-3 levels predict radiographic outcome in rheumatoid arthritis. Ann Rheum Dis

(6)

1999;S363.

17) Yamaknaka H, Matsuda Y, Tanaka M, Sendo W, Nakajima H, Taniguchi A, et al. Serum matrix metalloproteinase 3 as a predictor of the degree of joint destructinn during the six months after mea- surement, in patients with early rheumatoid arthritis. Arthritis Rheum 2000;43:852-8.

18) Cunnane G, Fitzgerald O, Beeton C, Cawston TE, Gresnihan G. Early joint erosions and serum level of matrix metalloproteinase 1, matrix metalloproteinase 3, and tissue inhibitor of metalloproteina- sese 1 in rheumatoid arthritis. Arthritis Rheum 2001;44:2263-74.

19) Green MJ, Gough AKS, Devlin J, Simth J, Astin P, Taylor D, et al. Serum MMP-3 and MMP-1 and progression of joint damage in early rheumatoid arthritis. Rheumatology 2003;42:83-8.

20) Okada Y, Hagase H, Harris ED. A metalloproteinase from human rheumatoid synovial fibrobl- asts that digests connective tissue matrix compo- nents. J Biol Chem 1986;261:14245-55.

21) Okada Y, Konomi H, Yada T, Kimata K, Nagase H. Degradation of type IX collagen by matrix metalloproteinse 3 (stromelysin) from human rheumatoid synovial cells. FEBS lstt 1989;244:473-6.

22) Ito A, Nagase H. Evidence that human rheumatoid synovial matrix metalloproteinase 3 is an endogenous activator of procollagenase 1. Arch Biochem Biophys 1989;267:211-6.

23) Xie DL, Hui F, Meyers R, Homandberg GA.

Cartilage chondrolysis by fibronectin fragments is associated with several proteinases: stromelysin plays a major role in chondrolysis. Arch Biocehm Biophys 1994;311:205-12.

24) Koshy PJ, Henderson N, Logan C, Life PF, Ca- wston TE, Rowan AD. Interleukin 17 induces cartilage collagen breakdown: novel synergistic effects in combination with proinflammatory cytokines.

Ann Rheum Dis 2002;61:704-13.

25) Chabaud M, Lubbert E, Joosten LAB, van den Berg W, Miossec P. IL-17 derived from juxta- articular bone and synovium contribute to joint degradation in rheumatoid arthritis. Arthritis Res 2001;3:168-77.

26) Lubberts E, Joosten LAB, Oppers B, van den Bersselaar L, Coenen-de Roo CJJ, Kolls JK, et al.

IL-1-independent role of IL-17 in synovial inflammation and joint destruction during collagen-induced arthritis. J Immunol 2001;167:1004-13.

27) Bolon B, Shalgoub V, Kostenuik PJ, Campagnuolo G, Morony S, Boyle WJ, et al. Osteoprotegerin, an endogenous antiosteoclast factor for protecting bone in rheumatoid arthritis. Arthritis Rheum 2002;

46:3121-35.

28) Hofbauer LC, Khosla S, Lacey DL, Dunstan CR, Boyle WJ, Riggs BL. The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J Bone Miner Res 2000;

15:2-12.

29) Lubberts E, Van den Bersselaar L, Oppers-Walg- reen B, Schwarzenberger P, Coenen-de Roo CJJ, Kolls JK, et al. IL-17 promotes bone erosion in murine collagen-induced arthritis through loss of the receptor activator of NF-κB ligand/osteoprotegerin balance. J Immunol 2003;170:2655-62.

30) Bigg HF, Roward AD. The inhibition of metalloproteinases as a therapeutic target in rheumatoid arthritis and osteoarthritis. Curr Opin Pharmacol 2001;1:314-20.

31) Frisch SM, Ruley HE. Transcription from the stromelysin promoter is induced by interleukin-1 and repressed by dexamethasone. J Biol Chem 1987;

262:16300-4.

32) Qyubibes S, Saus J, Otani Y, Harris ED, Kurkinen M. Transcriptional regulation of human stromelysin. J Biol Chem 1989;264:8399-44.

33) Pender SL, Quinn JJ, Sanderson IR, MacDonald TT. Butyrate upregulates stromelysin-1 production by intestinal mesenchymal cells. Am J Physiol 2000;279:G918-24.

34) MacNaul KL, Chartrain N, Lark M, Tocci MJ, Hutchinson NI. Discordinate expression of stromelysin, collagenase, and tissue inhibitor of metalloproteinases-1 in rheumatoid human synovial fi- broblasts. Synergistic effects of interleukin-1 and tumor necrosis factor-alpha on stromelysin expression. J Biol Chem 1990;265:17238-45.

35) Bamba S, Andoh A, Yasui H, Araki Y, Bamba T, Fujiyama Y. Matrix metalloproteinase-3 secretion from human colonic subepithelial myofibroblasts:

role of interleukin-17. J Gastroenterol 2003;38:

548-54.