KV10 vector was used to express the protein in mammalian cells. Since two CMV promoters are contained in the KV10 vector, two proteins can be expressed simultaneously.
For the expression of IgG, variable heavy chain (VH) and constant gamma chain 1-3 (Cγ1, Cγ2, and Cγ3) genes were inserted into one promoter to express heavy chain, while variable light chain (VL) and constant kappa chain (Cκ) genes were inserted into the other promoter to express light chain. A variable region gene derived from a mouse was inserted upstream of the human IgG1 constant region to be expressed as chimeric IgG. The DNA sequence and amino acid sequence of the variable region gene of the antibody are registered in GenBank and the amino acid sequence is aligned in Table 1 (3D8 VH, GenBank accession number AAF79128; 3D8 VL, AAF79129; 2C281 VH, MH638364; 2C281 VL, MH638365; 6C407 VH, MH638366; 6C407 VL, MH638367; 10C358 VH, MH638368; 10C358 VL, MH638369).
Since the KV10 vector contains different restriction enzymes for each region, it is possible to insert or replace a specific gene at a desired site. For secretion expression of the antibody, the VH region is located between the MluI/NheI and the Cγ1-3 regions between the NheI/BamHI restriction enzyme sites. The Vκ region and the Cκ region are located between DraIII/BsiWI and BsiWI/EcoRI, respectively. There is a leader sequence at the amino
terminus of each variable region. The leader sequence derived from the VH3 gene family for VH and VκI for Vκ is located between MfeI/MluI and BglII/DraIII, respectively. When IgG was expressed in the cytosol, the VH and Vκ gene fragments not containing the leader
12
sequence were prepared and inserted between the restriction sites of MfeI/NheI and BglII/BsiWI, respectively.
For the expression of mutant ΔLd-IgG *#H*#L, all cysteine residues in IgG constant regions were replaced with serine to prevent intra- and inter-chain disulfide bond formation.
Ig-whole constant (Cw), consisting of only constant region without variable region, was constructed by synthesizing Cγ1-3 and Cκ gene with WT and mutant and inserting into KV10 vector. For secretion expression of Ig-Cw, heavy chain was inserted between MluI/BamHI and light chain was inserted between DraIII/EcoRI restriction site. For the cytosolic expression, heavy chain was inserted between MfeI/BamHI and light chain was inserted between BglII/EcoRI. ΔLd-3D8 IgG/H-HA and ΔLd-3D8 IgG/L-Flag were constructed by inserting the Cγ1-3-HA gene between NheI/BamHI and the Cκ-Flag gene between BsiWI/EcoRI.
In order to express scFv, the VH and VL genes of the antibody were linked by a (Gly4Ser)3
linker through PCR. To purify the scFv in E. coli, the scFv gene was inserted between the XmaI/NcoI restriction sites in the pIg20 E. coli expression vector. In order to express scFv in
mammalian cells, scFv-HA and scFv-myc genes were prepared and inserted between the MfeI/NheI for cytosol expression and MluI/NheI for expression through ER-directed pathway of KV10 vector. The stop codon was inserted behind the tag to prevent additional translation.
13
Table 1. Amino acid sequence of anti-KIFC1 antibody variable regions
14 B. Purification of proteins
Chimeric anti-KIFC1 IgG proteins were expressed in the HEK293F cells transfected with KV10 Ld-anti-KIFC1 IgG plasmid. HEK293F cells were cultured in serum-free Freestyle medium (Gibco; cat# 12338018) in 500 ml flask (Corning; cat# 431145) at 8% CO2 and 37C with shaking at 130 rpm. Cells were seeded 1×106 cells/ml density in 100 ml medium 24 h prior to transfection. Plasmids DNA (200 μg) encoding antibody gene was mixed with PEI (Polyscience; cat# 23966-2, 400 μg) in 10 ml of medium and incubated for 10 min at RT. The mixture was inoculated into 100 ml of HEK293F cells culture and incubated for 7 days. The supernatant was harvested by centrifugation and was passed through Protein-A affinity chromatography column (GE Healthcare; cat# 17-1279-02) to purify IgG proteins. After washing the column with PBST, proteins were eluted with 0.1 M of glycine (pH 3.0). The eluate was neutralized with 1 M Tris (pH 9.5) and then concentrated by Vivaspin (molecular cut-off 50,000 kDa, Sartorius; cat# VS2032). The buffer was changed into PBS.
Anti-3D8 idiotypic O2F3 mouse IgM, which recognizes the conformation of the antigen-binding site composed of VH and VL, was purified from the culture supernatant of O2F3 hybridoma. O2F3 hybridoma cells were cultured in RPMI 1640 media supplemented with 10% FBS at 5% CO2 and 37°C. O2F3 IgM in culture supernatant was purified by affinity chromatography using agarose-goat anti-mouse IgM / μ chain-specific resin (Sigma-Aldrich;
cat# A4540).
Purification of the scFv protein was done in E. coli. BL21 (DE3) pLysE (Novagen) were transformed with pIg20-anti-KIFC1 scFv plasmid and grown in 1 L of Luria Bertani medium with 100 μg/ml of ampicillin and 25 μg/ml of chloramphenicol at 37°C, until absorbance
15
reaches 0.6 at 600 nm. Expression of scFv protein was induced by addition of 0.5 mM of isopropyl 1-thio-β-D-galactopyranoside. After growing cells at 23°C for 18 h, cells were collected by centrifugation at 8000 rpm for 30 min at 4°C. The supernatant was passed through IgG-sepharose affinity column (GE healthcare; cat# 17-1279-02) and scFv protein was eluted by 0.1 M acetic acid (pH 3.4). Eluted solution was concentrated in Vivaspin (molecular cut-off 10,000 kDa, Sartorius; cat# VS2002) by centrifugation and the buffer was changed to PBS.
C. Preparation of cell lysates
HEK293T cells were seeded 1×107 cells in 150 mm dish 24 h prior to transfection.
Plasmid DNA (20 μg) and PEI (80 μg) reagent were mixed in 10 ml of media and incubated at RT for 10 min. The mixture was inoculated into cells in 10 ml of Opti-MEM (Gibco; cat#
31985-070) at 37C for 36 h. If it is needed, 50 mM of N-ethyleneamine (NEM, ThermoFisher; cat# 23030) was treated and incubated at 37C for 15 min. After collecting cells by pipetting, cells were washed with PBS for three times and resuspended with ice-cold PBS containing protease inhibitor cocktail (Roche; cat# 11697498001) or 100 mM of NEM.
Cell were lysed by sonication at 30% amplitude by three pulses for 10 sec (Epishear). The lysed solution was centrifuged at 16,000 × g at 4C for 10 min and the supernatant was collected.
16 D. Enzyme-linked immunosorbent assay (ELISA)
Cell lysate ELISA for the analysis of antigen-binding activity
To assess the antigen-binding activity of anti-KIFC1 antibodies (2C281, 6C407 and 10C358), lysates of transfected HEK293T cells were incubated in a 96-well plate coated with synthetic peptide antigens (1 μg/ml, Figure 3). Synthetic peptide antigens for 2C281 consisted of amino acids 70−81 (PSLTTVPQTQGQ, KIFC1 peptide #1) of KIFC1. Peptide antigens for 6C407 and 10C358 consisted of amino acids 43−54 (EDGLEPEKKRTR, KIFC1 peptide
#2) and 99−110 (IATGLKNQKPVP, KIFC1 peptide #3) of KIFC1. Bound anti-KIFC1 IgGs were detected with alkaline phosphatase (AP)-conjugated goat anti-human IgG/Fc antibody (Sigma-Aldrich; cat# A9544). Bound anti-KIFC1 scFvs were detected with rabbit anti-HA antibody (Abcam; cat# ab9110), followed by AP-conjugated goat anti-rabbit IgG/Fc (Thermo; cat# 31341). Where necessary, lysates of transfected HEK293T cells were prepared in the presence of 100 mM NEM. ρ-nitrophenyl phosphate (Sigma-Aldrich; cat# N2765) solution (1 mg/ml in 0.1 M glycine, 1 mM ZnCl2 and 1 mM MgCl2, pH 10.3) was added to each well and the absorbance at 405 nm was measured using a microplate reader (Molecular Devices).
17
Figure 3. Amino acid sequences of the KIFC1 protein and epitopes recognized by antibodies. The epitope sequences recognized by 6C407, 2C281, and 10C358 antibodies are indicated by red, blue, and green amino acids, respectively.
18
Cell lysate ELISA for the analysis of H:L association
To assess the association of heavy and light chains in cells, two different ELISA protocols were used. In the first method, wells of a 96-well polystyrene plate were coated with 100 μl (2 μg/ml) of goat anti-human IgG/Fc antibody (Abcam; cat# ab97221) for 1 h at RT, washed three times with TBST, and blocked with 3% bovine serum albumin (BSA) for 1 h at RT.
Wells were subsequently incubated with lysates of transfected cells (100 μl) for 1 h at RT, rabbit anti-human C antibody (Abcam; cat# ab125919), and AP-conjugated goat anti-rabbit IgG/Fc-specific antibody (Pierce; cat# 31341). Each incubation step was followed by washing three times with TBST. Otherwise, the plate coated with 100 μl (2 μg/ml) of rabbit anti-human C antibody was incubated with lysates of transfected cells, followed by AP-conjugated goat anti-human IgG/Fc-specific antibody (Sigma-Aldrich; cat# A9544). Polyclonal human IgG (Sigma-Aldrich; cat# I8640) was used as a positive control.
ELISA for the analysis of antigen-binding activity of purified scFvs.
The antigen-binding activity of anti-KIFC1 scFvs (2C281 and 6C407) was assessed by ELISA using synthetic peptides as antigens. Purified anti-KIFC1 scFvs (1 μM) were treated into the peptide antigens (1 μM)-coated 96-well plate and incubated at RT for 1 hr. Peptide KIFC1 1-50 was used as the 6C407 antigen and KIFC1 51-100 was used as the 2C281 antigen. Bound scFvs were detected by rabbit IgG and AP-conjugated goat anti-rabbit IgG.
DTT was treated to scFv protein at a 55 mM concentration. HW6 scFv was used as a negative control.
19 E. Confocal microscopy
For analysis of colocalization of anti-KIFC1 IgG intrabodies and cellular KIFC1 molecules, HeLa cells stably expressing GFP-KIFC1 were seeded on cover slips and transfected with plasmids encoding 2C281, 6C407, or KV10Ld-10C358. At 24 h after transfection, cells were synchronized at mitosis by double thymidine block. To arrest most cells in G1/S, cells were treated with 2 mM of thymidine for 18 h, washed with PBS three times, and placed in fresh medium for 7 h. After that, to arrest cells at the G2/M phase border, cells were incubated with 9 μM of CDK inhibitor RO3306 (Sigma-Aldrich; cat# SML0569) for 2 h, and then placed in fresh medium for 30 min, fixed, and permeabilized. Cells were incubated with goat anti-human IgG/Fc-specific antibody (Abcam cat# ab97221) followed by TRITC-conjugated rabbit anti-goat IgG (Abcam; cat# ab50623).
Finally, cell nuclei were stained with Hoechst 33342 (Vector Laboratories) for 30 min at RT.
Thereafter, cells on coverslips were mounted with Vectashield mounting medium (Vector Laboratories). Images were obtained using a laser scanning confocal fluorescence microscope (Carl Zeiss, LSM710).
To analyze colocalization of cytosolically expressed 3D8 IgG and O2F3 antibodies (mouse IgM specific for conformational variable regions of 3D8 (Kwon et al., 2002)), HEK293T cells were seeded on poly L lysine-coated glass coverslips in 24-well plates at a density of 4×104 cells/well, prior to transfection with KV10Ld-3D8 plasmid using Lipofectamine 2000 reagent (Life Technologies). At 24 h after transfection, cells were washed three times with ice-cold PBS (pH 7.2), and fixed with 4% paraformaldehyde in PBS for 10 min at 4C. After washing cells three times with PBS, cell membranes were
20
permeabilized with P buffer consisting of 1% BSA, 0.1% saponin, and 0.1% sodium azide in PBS for 10 min at RT. Cells were incubated overnight at 4C with O2F3 antibody, and then with an Alexa Fluor 647-conjugated rat anti-mouse IgM/µ chain-specific antibody (BioLegend; cat# 406526). After each incubation for 1 h at 4C, cells were washed three times with ice-cold PBS.
For the in vitro staining using purified anti-KIFC1 scFvs, HeLa cells expressing KIFC1-GFP were fixed with 4% paraformaldehyde in PBS (pH 7.4) following cell membrane permeation with P buffer in the dark. Purified scFvs (10 μM) were treated and incubated for 1h at RT. Rabbit IgG (Sigma; cat# I5006) and TRITC conjugated goat anti-rabbit IgG (Sigma;
cat# T6778) were treated to detect purified scFvs tagged with protein A.
To analyze co-localization of cytosolic anti-KIFC1 scFv and endogenous KIFC1, scFvs labeled with HA tag was expressed in the cytosol of HeLa GFP-KIFC1 cells. Cells were synchronized at mitosis by double thymidine block, fixed with 4% paraformaldehyde in PBS and membrane was permeabilized with P buffer. Cytosolic anti-KIFC1 scFv was detected by mouse anti-HA antibody (Millipore; cat# 05-904) and TRITC conjugated goat anti-mouse IgG (Abcam; cat# ab47832). After nucleus staining and mounting, stained cells were observed with a confocal microscope.
21 F. Immunoblotting
For SDS-PAGE analysis under non-reducing conditions, samples were diluted 1:1 in 2 Laemmli sample buffer (Bio-Rad). For reducing conditions, samples were diluted 1:1 in 2 Laemmli sample buffer supplemented with 2.5% 2-mercaptethanol or 100 mM DTT.
In both cases, samples were heated at 100C for 10 min, then loaded on 8%, 10%, or 4−20%
acrylamide gels. Following electrophoresis, resolved proteins were transferred onto polyvinylidene fluoride membranes. Membranes were rinsed with PBS, then blocked with 5% milk (w/v) in TRIS-buffered saline (TBS, 50 mM TRIS-Cl, 50 mM NaCl, pH 7.2) containing 0.05% Tween-20 (TBST) at RT for 2 h. Membranes containing Ig proteins were probed with primary goat anti-human IgG/Fc antibody (Pierce; cat# 31125) plus rabbit anti-human Ig chain antibody (Abcam; cat# ab134083) in 5% milk-TBST at 4C overnight. After washing three times with PBS containing 0.05% Tween-20 (PBST), membranes were incubated with secondary horseradish peroxidase (HRP)-conjugated anti-goat IgG (Invitrogen; cat# 81-1620) plus HRP-conjugated anti-rabbit IgG (Invitrogen; cat#
81-6120) for 1 h. After washing five times with TBST, protein signals on membranes were visualized with an ECL kit (GE Healthcare; cat# RPN2106). Where necessary, membranes were probed with primary mouse anti-HA antibody (Millipore; cat# 05-904) plus mouse Flag antibody (Sigma-Aldrich; cat# F3165), followed by HRP-conjugated horse anti-mouse IgG (Cell Signaling; cat# 7076).
22 G. Immunoprecipitation (IP)
Aliquots (500 μg) of cell lysate was subjected to IP with Protein A/G coupled to resin (ThermoFisher; cat# 26146) according to the manufacturer’s instructions. After washing the resin, immunoprecipitated heavy chain of antibody were eluted and resolved by SDS-PAGE.
Co-immunoprecipitated light chain was detected by immunoblotting with rabbit anti-human Ig chain antibody (Abcam; cat# ab134083).
For the IP of myc-tagged anti-KIFC1 scFvs, mouse anti-myc antibody (IGTHERAPY;
cat# IG-A200302) was coupled to agarose resin (ThermoFisher; cat# 26146). Lysates of HeLa cells expressing scFvs (500 μg) were incubated with the anti-myc IgG coupled resin at 4°C overnight. Bound scFvs were eluted according to the manufacturer’s instructions. Eluted proteins were separated by SDS-PAGE and immunoblotting were performed with rabbit anti-KIFC1 antibody (abcam; cat# ab172620) and mouse anti-myc antibody.
H. Measurement of antigen-binding affinity by octet
Affinities of purified anti-KIFC1 IgGs and scFvs against peptide antigen were measured by octet systems (Fortebio). Biotin-conjugated synthetic KIFC1 peptides (KIFC1 1-50 for 6C407 and KIFC1 51-100 for 2C281) were immobilized to streptavidin coated biosensor in an optimized concentration condition (1 μg/ml of KIFC1 1-50 for 6C407 IgG, 1 μg/ml of KIFC1 1-50 for 6C407 IgG, 0.25 μg/ml of KIFC1 51-100 for 2C281 scFv, and 0.5 μg/ml of KIFC1 51-100 for 2C281 IgG). Proteins that were serially diluted 2-fold starting at 200 nM concentration were analyzed for more than 4 concentrations. The association and dissociation of the antibody was measured for 300 sec or more. Fitting curves and dissociation constant (KD) were obtained using the Fortebio Data analysis program provided by the manufacturer.
23
I. Analysis of disulfide bonds by Cys-residue PEGylation
IgG was expressed in the cytosol of HEK293T by transient expression. Cells were transfected with KV10ΔLd-3D8 IgG/H-HA plasmid DNA using PEI and incubated for 36 hrs. Before harvesting the cells, NEM was treated to the medium at a concentration of 50 mM to block the oxidation of free thiol. Collected cells were washed twice with PBS after centrifugation in 3000 rpm for 10 min at 4°C. The cell pellet was resuspended in PBS containing 100 mM NEM and lysed by sonication at 30% amplitude three times for 10 seconds. The supernatant was collected by centrifugation with 13000 rpm for 10 min at 4°C and concentration of protein was measured by BCA assay. To remove the NEM in the supernatant, cell lysate was passed through desalting column (7 kDa molecular weight cut off, Thermo; cat#89882). For the reduction of disulfide bonds in the proteins, 5 mM of TRIS-(2-carboxyethyl) phosphine (TCEP) in the HEPES (pH 7.0) was treated to the NEM-removed cell lysate and incubated for 1 h at 37°C. Then, a linear monofunctional methyl ether poly-ethylene glycol with a reactive maleimide group (mPEG-MAL, 2 kDa-size, Creative PEGWorks; cat# PSB-235) constituted in PBS (pH 7.4) was treated at a final concentration of 10 mM and incubated for 1 h at 37°C. PEGylated proteins were mixed with SDS sample buffer in reducing condition and separated by 8% SDS-PAGE gel. Heavy chain of PEGylated IgG was detected by mouse anti-HA tag antibody (Millipore; Cat#. 05-904) and HRP conjugated horse anti-mouse IgG (H+L) antibody (Cell Signaling; Cat# 7076). Total PEGylated proteins were detected by rabbit anti-PEG antibody (abcam; Cat# Ab51257) and HRP conjugated goat anti-rabbit IgG (Zymed; Cat# 81-6120).
24 J. Analysis of assembly dynamics
HEK293T cells were transfected with KV10Ld-3D8 IgG or KV10Ld-IgG at 37C for 24 h. Aliquots of transfectant lysates were treated with 100 mM DTT for 30 min, then passed through a desalting column (ThermoFisher; cat# 89882) equilibrated with PBS, followed by micro-dialysis against PBS using a micro-dialyzer (ThermoFisher; cat# 88260) at 4C for 24 h. Proteins were subjected to immunoblotting analysis in non-reducing and denaturing conditions using anti-IgG/Fc antibody. To validate the complete removal of DTT in the above column and dialysis steps, 100 mM DTT in PBS was passed through the desalting column then subjected to dialysis against PBS, and the concentration of DTT was determined using a free thiol detection kit (Abcam; cat# ab112158).
K. Fluorescence microscopy
To observe multipolar spindle formation, anti-KIFC1 scFv was expressed in the cytosol of HeLa, MDA-MB-231, and RPE-1 cells by DNA transfection. The expression level of KIFC1 was knocked down using siRNA as a control for the inhibition of KIFC1 function.
The sequences of siRNA are shown in Table 2. After 24 h, the cells were treated with 100 μM of thymidine for 24 h and released for 9 h. MG132 was treated for 1 h at a final concentration of 10 μM. After fixation and permeation of the cells, the centrosomes were stained with mouse γ-tubulin IgG (Sigma; cat# T6557) and Alexa488-labeled rabbit anti-mouse IgG (Invitrogen; cat# A11059). Stained cells were observed under a fluorescence microscope (Zeiss, Axiovert 200M). The number of cells containing the multipolar spindle was counted at least three times.
25 L. Live cell imaging
For the analysis of the effect of cytosolic anti-KIFC1 scFvs expression on the mitosis duration, live cell imaging was performed. Transfected HeLa cells were placed in a stage-top incubation chamber and monitored every 3 minutes for 48 h by inverted fluorescence time-lapse microscope (Nikon, Ti-E). The mitotic duration was measured from cell round-up to anaphase onset. Mitotic duration refers to the time taken from when the cell begins to rise until it begins to divide.
M. Analysis of meta-to-anaphase delay
The meta-to-anaphase delay of the mitotic cell was confirmed by immunoblotting when scFv was expressed in the cytosol. Plasmids encoding the scFv gene are transfected into HeLa cells and treated with 100 μM of thymidine. After 24 h, the medium was replaced with thymidine-free medium and cells were harvested every hour from 8 h later. Harvested cells were mixed with 2xSDS buffer and directly lysed at 100°C for 5 min. SDS-PAGE and immunoblotting were performed to detect phospho-histone H3 (Cell signaling; cat# 9706), cyclin B1 (Santa Cruz; cat# SC-245), and GAPDH (Cell signaling; cat# 2118) levels in the cell lysate.
26 Table 2. Sequence of siRNA
Oligo sequence 5’-3’
si-control UUCUCCGAACGUGUCACGUTT
si-KIFC1
UAACUGACCCUUUAAGUCCUU AGUGUUGUGCGCUCUGUCCUU GACACAAGCACGCAAGUUCUU UGGUCCAACGUUUGAGUCCUU
27
III. RESULTS
A. Expression of IgGs in the cytosol
To investigate whether the characteristics of the antibody expressed in the cytosol are determined according to the variable region sequence, chimeric IgG was constructed by fusing four variable regions of mouse-derived antibodies (3 anti-KIFC1 antibodies and an anti-nucleic acid antibody) with the human IgG1 constant region (Figure 4A). A heavy chain and a light chain gene of IgG were inserted into a vector containing two promoters so that each chain could be expressed simultaneously. At the N-terminus of each chain, there is a leader sequence that transfers proteins to the ER when protein translation begins. The IgG expressed in ER was designated Ld. Cytosolic expression was achieved by removing the leader sequence at the N-terminus of the heavy and light chains, and the antibody expressed in the cytosol was labeled as ΔLd. IgGs were expressed in the ER or cytosol of HEK293T cells and expression level was confirmed by immunoblotting (Figure 4B). In the results, all heavy chains were expressed at similar levels regardless of the leader sequence. Light chain of 3D8 and 10C358 showed slightly lower cytosolic expression levels than those expressed in ER (Figure 4B).
28
Figure 4. Expression of IgGs in the ER or cytosol of HEK293T cells. (A) Schematic diagram of plasmids construction to express chimeric IgGs in the ER (Ld) or cytosol (ΔLd).
Heavy and light chains of IgG were expressed simultaneously using dual promoter vector.
(B) Immunoblotting for detection of heavy and light chains in lysates of HEK293T cells. An anti-DNA antibody (3D8) and three anti-KIFC1 antibodies (2C281, 6C407, and 10C358) were expressed in the ER or cytosol of HEK293T cells. The expressions of heavy and light chains were detected by goat anti-human IgG (Fc specific) antibody and goat anti-human kappa chain antibody followed by HRP-conjugated rabbit anti-goat IgG (H+L).
29 B. Antigen-binding activity of cytosolic IgGs
Antigen-binding activity of cytosolic IgGs was confirmed by ELISA and confocal
Antigen-binding activity of cytosolic IgGs was confirmed by ELISA and confocal