Preparation of cell lysates

HEK293T cells were seeded 1×10⁷ cells in 150 mm dish 24 h prior to transfection.

Plasmid DNA (20 μg) and PEI (80 μg) reagent were mixed in 10 ml of media and incubated at RT for 10 min. The mixture was inoculated into cells in 10 ml of Opti-MEM (Gibco; cat#

31985-070) at 37C for 36 h. If it is needed, 50 mM of N-ethyleneamine (NEM, ThermoFisher; cat# 23030) was treated and incubated at 37C for 15 min. After collecting cells by pipetting, cells were washed with PBS for three times and resuspended with ice-cold PBS containing protease inhibitor cocktail (Roche; cat# 11697498001) or 100 mM of NEM.

Cell were lysed by sonication at 30% amplitude by three pulses for 10 sec (Epishear). The lysed solution was centrifuged at 16,000 × g at 4C for 10 min and the supernatant was collected.

16 D. Enzyme-linked immunosorbent assay (ELISA)

Cell lysate ELISA for the analysis of antigen-binding activity

To assess the antigen-binding activity of anti-KIFC1 antibodies (2C281, 6C407 and 10C358), lysates of transfected HEK293T cells were incubated in a 96-well plate coated with synthetic peptide antigens (1 μg/ml, Figure 3). Synthetic peptide antigens for 2C281 consisted of amino acids 70−81 (PSLTTVPQTQGQ, KIFC1 peptide #1) of KIFC1. Peptide antigens for 6C407 and 10C358 consisted of amino acids 43−54 (EDGLEPEKKRTR, KIFC1 peptide

#2) and 99−110 (IATGLKNQKPVP, KIFC1 peptide #3) of KIFC1. Bound anti-KIFC1 IgGs were detected with alkaline phosphatase (AP)-conjugated goat anti-human IgG/Fc antibody (Sigma-Aldrich; cat# A9544). Bound anti-KIFC1 scFvs were detected with rabbit anti-HA antibody (Abcam; cat# ab9110), followed by AP-conjugated goat anti-rabbit IgG/Fc (Thermo; cat# 31341). Where necessary, lysates of transfected HEK293T cells were prepared in the presence of 100 mM NEM. ρ-nitrophenyl phosphate (Sigma-Aldrich; cat# N2765) solution (1 mg/ml in 0.1 M glycine, 1 mM ZnCl2 and 1 mM MgCl2, pH 10.3) was added to each well and the absorbance at 405 nm was measured using a microplate reader (Molecular Devices).

17

Figure 3. Amino acid sequences of the KIFC1 protein and epitopes recognized by antibodies. The epitope sequences recognized by 6C407, 2C281, and 10C358 antibodies are indicated by red, blue, and green amino acids, respectively.

18

Cell lysate ELISA for the analysis of H:L association

To assess the association of heavy and light chains in cells, two different ELISA protocols were used. In the first method, wells of a 96-well polystyrene plate were coated with 100 μl (2 μg/ml) of goat anti-human IgG/Fc antibody (Abcam; cat# ab97221) for 1 h at RT, washed three times with TBST, and blocked with 3% bovine serum albumin (BSA) for 1 h at RT.

Wells were subsequently incubated with lysates of transfected cells (100 μl) for 1 h at RT, rabbit anti-human C antibody (Abcam; cat# ab125919), and AP-conjugated goat anti-rabbit IgG/Fc-specific antibody (Pierce; cat# 31341). Each incubation step was followed by washing three times with TBST. Otherwise, the plate coated with 100 μl (2 μg/ml) of rabbit anti-human C antibody was incubated with lysates of transfected cells, followed by AP-conjugated goat anti-human IgG/Fc-specific antibody (Sigma-Aldrich; cat# A9544). Polyclonal human IgG (Sigma-Aldrich; cat# I8640) was used as a positive control.

ELISA for the analysis of antigen-binding activity of purified scFvs.

The antigen-binding activity of anti-KIFC1 scFvs (2C281 and 6C407) was assessed by ELISA using synthetic peptides as antigens. Purified anti-KIFC1 scFvs (1 μM) were treated into the peptide antigens (1 μM)-coated 96-well plate and incubated at RT for 1 hr. Peptide KIFC1 1-50 was used as the 6C407 antigen and KIFC1 51-100 was used as the 2C281 antigen. Bound scFvs were detected by rabbit IgG and AP-conjugated goat anti-rabbit IgG.

DTT was treated to scFv protein at a 55 mM concentration. HW6 scFv was used as a negative control.

19 E. Confocal microscopy

For analysis of colocalization of anti-KIFC1 IgG intrabodies and cellular KIFC1 molecules, HeLa cells stably expressing GFP-KIFC1 were seeded on cover slips and transfected with plasmids encoding 2C281, 6C407, or KV10Ld-10C358. At 24 h after transfection, cells were synchronized at mitosis by double thymidine block. To arrest most cells in G1/S, cells were treated with 2 mM of thymidine for 18 h, washed with PBS three times, and placed in fresh medium for 7 h. After that, to arrest cells at the G2/M phase border, cells were incubated with 9 μM of CDK inhibitor RO3306 (Sigma-Aldrich; cat# SML0569) for 2 h, and then placed in fresh medium for 30 min, fixed, and permeabilized. Cells were incubated with goat anti-human IgG/Fc-specific antibody (Abcam cat# ab97221) followed by TRITC-conjugated rabbit anti-goat IgG (Abcam; cat# ab50623).

Finally, cell nuclei were stained with Hoechst 33342 (Vector Laboratories) for 30 min at RT.

Thereafter, cells on coverslips were mounted with Vectashield mounting medium (Vector Laboratories). Images were obtained using a laser scanning confocal fluorescence microscope (Carl Zeiss, LSM710).

To analyze colocalization of cytosolically expressed 3D8 IgG and O2F3 antibodies (mouse IgM specific for conformational variable regions of 3D8 (Kwon et al., 2002)), HEK293T cells were seeded on poly L lysine-coated glass coverslips in 24-well plates at a density of 4×10⁴ cells/well, prior to transfection with KV10Ld-3D8 plasmid using Lipofectamine 2000 reagent (Life Technologies). At 24 h after transfection, cells were washed three times with ice-cold PBS (pH 7.2), and fixed with 4% paraformaldehyde in PBS for 10 min at 4C. After washing cells three times with PBS, cell membranes were

20

permeabilized with P buffer consisting of 1% BSA, 0.1% saponin, and 0.1% sodium azide in PBS for 10 min at RT. Cells were incubated overnight at 4C with O2F3 antibody, and then with an Alexa Fluor 647-conjugated rat anti-mouse IgM/µ chain-specific antibody (BioLegend; cat# 406526). After each incubation for 1 h at 4C, cells were washed three times with ice-cold PBS.

For the in vitro staining using purified anti-KIFC1 scFvs, HeLa cells expressing KIFC1-GFP were fixed with 4% paraformaldehyde in PBS (pH 7.4) following cell membrane permeation with P buffer in the dark. Purified scFvs (10 μM) were treated and incubated for 1h at RT. Rabbit IgG (Sigma; cat# I5006) and TRITC conjugated goat anti-rabbit IgG (Sigma;

cat# T6778) were treated to detect purified scFvs tagged with protein A.

To analyze co-localization of cytosolic anti-KIFC1 scFv and endogenous KIFC1, scFvs labeled with HA tag was expressed in the cytosol of HeLa GFP-KIFC1 cells. Cells were synchronized at mitosis by double thymidine block, fixed with 4% paraformaldehyde in PBS and membrane was permeabilized with P buffer. Cytosolic anti-KIFC1 scFv was detected by mouse anti-HA antibody (Millipore; cat# 05-904) and TRITC conjugated goat anti-mouse IgG (Abcam; cat# ab47832). After nucleus staining and mounting, stained cells were observed with a confocal microscope.

21 F. Immunoblotting

For SDS-PAGE analysis under non-reducing conditions, samples were diluted 1:1 in 2 Laemmli sample buffer (Bio-Rad). For reducing conditions, samples were diluted 1:1 in 2 Laemmli sample buffer supplemented with 2.5% 2-mercaptethanol or 100 mM DTT.

In both cases, samples were heated at 100C for 10 min, then loaded on 8%, 10%, or 4−20%

acrylamide gels. Following electrophoresis, resolved proteins were transferred onto polyvinylidene fluoride membranes. Membranes were rinsed with PBS, then blocked with 5% milk (w/v) in TRIS-buffered saline (TBS, 50 mM TRIS-Cl, 50 mM NaCl, pH 7.2) containing 0.05% Tween-20 (TBST) at RT for 2 h. Membranes containing Ig proteins were probed with primary goat anti-human IgG/Fc antibody (Pierce; cat# 31125) plus rabbit anti-human Ig  chain antibody (Abcam; cat# ab134083) in 5% milk-TBST at 4C overnight. After washing three times with PBS containing 0.05% Tween-20 (PBST), membranes were incubated with secondary horseradish peroxidase (HRP)-conjugated anti-goat IgG (Invitrogen; cat# 81-1620) plus HRP-conjugated anti-rabbit IgG (Invitrogen; cat#

81-6120) for 1 h. After washing five times with TBST, protein signals on membranes were visualized with an ECL kit (GE Healthcare; cat# RPN2106). Where necessary, membranes were probed with primary mouse anti-HA antibody (Millipore; cat# 05-904) plus mouse Flag antibody (Sigma-Aldrich; cat# F3165), followed by HRP-conjugated horse anti-mouse IgG (Cell Signaling; cat# 7076).

22 G. Immunoprecipitation (IP)

Aliquots (500 μg) of cell lysate was subjected to IP with Protein A/G coupled to resin (ThermoFisher; cat# 26146) according to the manufacturer’s instructions. After washing the resin, immunoprecipitated heavy chain of antibody were eluted and resolved by SDS-PAGE.

Co-immunoprecipitated light chain was detected by immunoblotting with rabbit anti-human Ig  chain antibody (Abcam; cat# ab134083).

For the IP of myc-tagged anti-KIFC1 scFvs, mouse anti-myc antibody (IGTHERAPY;

cat# IG-A200302) was coupled to agarose resin (ThermoFisher; cat# 26146). Lysates of HeLa cells expressing scFvs (500 μg) were incubated with the anti-myc IgG coupled resin at 4°C overnight. Bound scFvs were eluted according to the manufacturer’s instructions. Eluted proteins were separated by SDS-PAGE and immunoblotting were performed with rabbit anti-KIFC1 antibody (abcam; cat# ab172620) and mouse anti-myc antibody.

H. Measurement of antigen-binding affinity by octet

Affinities of purified anti-KIFC1 IgGs and scFvs against peptide antigen were measured by octet systems (Fortebio). Biotin-conjugated synthetic KIFC1 peptides (KIFC1 1-50 for 6C407 and KIFC1 51-100 for 2C281) were immobilized to streptavidin coated biosensor in an optimized concentration condition (1 μg/ml of KIFC1 1-50 for 6C407 IgG, 1 μg/ml of KIFC1 1-50 for 6C407 IgG, 0.25 μg/ml of KIFC1 51-100 for 2C281 scFv, and 0.5 μg/ml of KIFC1 51-100 for 2C281 IgG). Proteins that were serially diluted 2-fold starting at 200 nM concentration were analyzed for more than 4 concentrations. The association and dissociation of the antibody was measured for 300 sec or more. Fitting curves and dissociation constant (KD) were obtained using the Fortebio Data analysis program provided by the manufacturer.

23

I. Analysis of disulfide bonds by Cys-residue PEGylation

IgG was expressed in the cytosol of HEK293T by transient expression. Cells were transfected with KV10ΔLd-3D8 IgG/H-HA plasmid DNA using PEI and incubated for 36 hrs. Before harvesting the cells, NEM was treated to the medium at a concentration of 50 mM to block the oxidation of free thiol. Collected cells were washed twice with PBS after centrifugation in 3000 rpm for 10 min at 4°C. The cell pellet was resuspended in PBS containing 100 mM NEM and lysed by sonication at 30% amplitude three times for 10 seconds. The supernatant was collected by centrifugation with 13000 rpm for 10 min at 4°C and concentration of protein was measured by BCA assay. To remove the NEM in the supernatant, cell lysate was passed through desalting column (7 kDa molecular weight cut off, Thermo; cat#89882). For the reduction of disulfide bonds in the proteins, 5 mM of TRIS-(2-carboxyethyl) phosphine (TCEP) in the HEPES (pH 7.0) was treated to the NEM-removed cell lysate and incubated for 1 h at 37°C. Then, a linear monofunctional methyl ether poly-ethylene glycol with a reactive maleimide group (mPEG-MAL, 2 kDa-size, Creative PEGWorks; cat# PSB-235) constituted in PBS (pH 7.4) was treated at a final concentration of 10 mM and incubated for 1 h at 37°C. PEGylated proteins were mixed with SDS sample buffer in reducing condition and separated by 8% SDS-PAGE gel. Heavy chain of PEGylated IgG was detected by mouse anti-HA tag antibody (Millipore; Cat#. 05-904) and HRP conjugated horse anti-mouse IgG (H+L) antibody (Cell Signaling; Cat# 7076). Total PEGylated proteins were detected by rabbit anti-PEG antibody (abcam; Cat# Ab51257) and HRP conjugated goat anti-rabbit IgG (Zymed; Cat# 81-6120).

24 J. Analysis of assembly dynamics

HEK293T cells were transfected with KV10Ld-3D8 IgG or KV10Ld-IgG at 37C for 24 h. Aliquots of transfectant lysates were treated with 100 mM DTT for 30 min, then passed through a desalting column (ThermoFisher; cat# 89882) equilibrated with PBS, followed by micro-dialysis against PBS using a micro-dialyzer (ThermoFisher; cat# 88260) at 4C for 24 h. Proteins were subjected to immunoblotting analysis in non-reducing and denaturing conditions using anti-IgG/Fc antibody. To validate the complete removal of DTT in the above column and dialysis steps, 100 mM DTT in PBS was passed through the desalting column then subjected to dialysis against PBS, and the concentration of DTT was determined using a free thiol detection kit (Abcam; cat# ab112158).

K. Fluorescence microscopy

To observe multipolar spindle formation, anti-KIFC1 scFv was expressed in the cytosol of HeLa, MDA-MB-231, and RPE-1 cells by DNA transfection. The expression level of KIFC1 was knocked down using siRNA as a control for the inhibition of KIFC1 function.

The sequences of siRNA are shown in Table 2. After 24 h, the cells were treated with 100 μM of thymidine for 24 h and released for 9 h. MG132 was treated for 1 h at a final concentration of 10 μM. After fixation and permeation of the cells, the centrosomes were stained with mouse γ-tubulin IgG (Sigma; cat# T6557) and Alexa488-labeled rabbit anti-mouse IgG (Invitrogen; cat# A11059). Stained cells were observed under a fluorescence microscope (Zeiss, Axiovert 200M). The number of cells containing the multipolar spindle was counted at least three times.

25 L. Live cell imaging

For the analysis of the effect of cytosolic anti-KIFC1 scFvs expression on the mitosis duration, live cell imaging was performed. Transfected HeLa cells were placed in a stage-top incubation chamber and monitored every 3 minutes for 48 h by inverted fluorescence time-lapse microscope (Nikon, Ti-E). The mitotic duration was measured from cell round-up to anaphase onset. Mitotic duration refers to the time taken from when the cell begins to rise until it begins to divide.

M. Analysis of meta-to-anaphase delay

The meta-to-anaphase delay of the mitotic cell was confirmed by immunoblotting when scFv was expressed in the cytosol. Plasmids encoding the scFv gene are transfected into HeLa cells and treated with 100 μM of thymidine. After 24 h, the medium was replaced with thymidine-free medium and cells were harvested every hour from 8 h later. Harvested cells were mixed with 2xSDS buffer and directly lysed at 100°C for 5 min. SDS-PAGE and immunoblotting were performed to detect phospho-histone H3 (Cell signaling; cat# 9706), cyclin B1 (Santa Cruz; cat# SC-245), and GAPDH (Cell signaling; cat# 2118) levels in the cell lysate.

26 Table 2. Sequence of siRNA

Oligo sequence 5’-3’

si-control UUCUCCGAACGUGUCACGUTT

si-KIFC1

UAACUGACCCUUUAAGUCCUU AGUGUUGUGCGCUCUGUCCUU GACACAAGCACGCAAGUUCUU UGGUCCAACGUUUGAGUCCUU

27

III. RESULTS

A. Expression of IgGs in the cytosol

To investigate whether the characteristics of the antibody expressed in the cytosol are determined according to the variable region sequence, chimeric IgG was constructed by fusing four variable regions of mouse-derived antibodies (3 anti-KIFC1 antibodies and an anti-nucleic acid antibody) with the human IgG1 constant region (Figure 4A). A heavy chain and a light chain gene of IgG were inserted into a vector containing two promoters so that each chain could be expressed simultaneously. At the N-terminus of each chain, there is a leader sequence that transfers proteins to the ER when protein translation begins. The IgG expressed in ER was designated Ld. Cytosolic expression was achieved by removing the leader sequence at the N-terminus of the heavy and light chains, and the antibody expressed in the cytosol was labeled as ΔLd. IgGs were expressed in the ER or cytosol of HEK293T cells and expression level was confirmed by immunoblotting (Figure 4B). In the results, all heavy chains were expressed at similar levels regardless of the leader sequence. Light chain of 3D8 and 10C358 showed slightly lower cytosolic expression levels than those expressed in ER (Figure 4B).

28

Figure 4. Expression of IgGs in the ER or cytosol of HEK293T cells. (A) Schematic diagram of plasmids construction to express chimeric IgGs in the ER (Ld) or cytosol (ΔLd).

Heavy and light chains of IgG were expressed simultaneously using dual promoter vector.

(B) Immunoblotting for detection of heavy and light chains in lysates of HEK293T cells. An anti-DNA antibody (3D8) and three anti-KIFC1 antibodies (2C281, 6C407, and 10C358) were expressed in the ER or cytosol of HEK293T cells. The expressions of heavy and light chains were detected by goat anti-human IgG (Fc specific) antibody and goat anti-human kappa chain antibody followed by HRP-conjugated rabbit anti-goat IgG (H+L).

29 B. Antigen-binding activity of cytosolic IgGs

Antigen-binding activity of cytosolic IgGs was confirmed by ELISA and confocal microscopy. In ELISA, cell lysates prepared by disrupting HEK293T cells expressing cytosolic IgG were used. The ELISA plate coated with KIFC1 peptide antigens for anti-KIFC1 antibodies or single-strand DNA antigen for 3D8. All antibodies, except 10C358, expressed in the cytosol showed antigen-binding activity. All the antibodies expressed in ER had antigen-binding activity (Figure 5). This result was confirmed again by confocal microscopy (Figure 6). To confirm whether the cytosolic anti-KIFC1 IgG binds not only to the peptide antigen but also to the intracellular full-size KIFC1, co-localization of cytosolic anti-KIFC1 IgG with GFP-KIFC1 expressed in the HeLa was observed by confocal microscopy (Figure 6A). In interphase, KIFC1 is in the nucleus and cannot interact with IgG expressed in the cytosol. KIFC1 binds to the microtubule that forms a mitotic spindle in the metaphase of mitosis and moves toward the centrosome (minus-directed). Therefore, anti-KIFC1 IgG expressed in the cytosol can bind to anti-KIFC1 in mitosis. Similar to the cell lysate ELISA results, of the three anti-KIFC1 IgGs, 6C407 and 2C281 co-localized with KIFC1 in the mitotic phase, whereas 10C358 did not (Figure 6A). In the case of cytosolic 3D8 IgG, there is no antigen that can be used in cells. To confirm whether the antigen-binding site of cytosolic 3D8 IgG was properly formed, O2F3 IgM, an anti-idiotypic antibody that recognizes the conformation of the variable region of 3D8 IgG, were used to confocal microscopy (Figure 6B). HEK293T cells expressing cytosolic 3D8 IgG were fixed and permeabilized, and then treated with O2F3 IgM and its specific fluorescent-labeled antibody.

Confocal microscopy confirmed that cytosolic 3D8 IgG was recognized by O2F3, indicating

30

that the antigen binding site of cytosolic 3D8 IgG is properly formed. The results of the antigen-binding activity of cytosolic IgG showed that the variable region of the antibody determines the antigen-binding activity of cytosolic IgG.

31

Figure 5. Evaluation of binding activity of cytosolic IgGs. (A) The antigen-binding activity of cytosolic anti-KIFC1 IgG was analyzed by ELISA using peptide antigens synthesizing the epitope amino acid sequence of each antibody (KIFC1 peptide #1 for 2C281,

#2 for 6C407, and #3 for 10C358). Lysates of transfectants were placed in wells coated with specific antigens and bound IgGs were detected with AP-conjugated anti-human IgG/Fc.

Purified IgGs from HEK293F cells were used as positive control. (B) Binding activity of 3D8 anti-DNA IgG was analyzed by ELISA using synthetic single-strand DNA antigen. The subsequent ELISA procedure was performed in the same manner as in (A). Data are presented as mean ± SEM, n = 3. (C) An illustration showing the progress of the experiment.

32

Figure 6. Confocal microscopic analysis to confirm antigen-binding site of the cytosolic IgGs. (A) Cellular antigen-binding activity of cytosolic anti-KIFC1 IgGs were analyzed by confocal microscopy. HeLa cells stably expressing GFP-KIFC1 were transfected with the plasmids encoding ΔLd-anti-KIFC1 IgG gene. After synchronization of cells to mitotic phase, cells were fixed and stained with a primary antibody for anti-human IgG/Fc, followed by rhodamine-conjugated anti-goat IgG. (B) Formation of antigen-binding site of cytosolic 3D8 IgG was analyzed by confocal microscopy. Transiently transfected HEK293T cells were fixed, permeabilized, and then incubated with O2F3 (mouse IgM), followed by an Alexa Fluor 647-conjugated anti-mouse IgM/μ chain antibody. Bar = 10 μm.

33

C. Association of heavy and light chains of cytosolic IgGs

To explore why the antigen-binding activities of cytosolic IgGs are different each other, association between heavy and light chains of IgG was examined. We examined the association between heavy and light chains that compose the antigen binding site. Heavy chains of IgG in the HEK293T transfectants were immuno-precipitated by Protein-A/G and light chains interacting with the heavy chains were detected by western blot (Figure 7). As a result, H:L association was not observed in cytosolic 10C358 IgG that lost antigen-binding activity when expressed in the cytosol. The association of heavy and light chains of IgG was also confirmed through ELISA (Figure 8). Heavy chain of cytosolic IgG in the cell lysate is captured by Fc-specific antibody that is coated on the ELISA plate. The light chain associated with the heavy chain of cytosolic IgG is detected as a Cκ-specific antibody, and the AP-conjugated secondary antibody and the substrate are treated sequentially. ELISA was also performed to reverse the order of the antibodies used for capture and detection. After coating the Ck-specific antibody on the plate, the light chain of the cytosolic IgG was captured, and the heavy chain associated with the light chain was detected as AP-conjugated Fc-specific antibody. As a result, association between heavy and light chains was not observed in cytosolic 10C358 IgG as in IP results. These results confirm that the difference in antigen-binding of cytosolic IgG is related to the association of heavy and light chains.