Analysis of disulfide bonds by Cys-residue PEGylation

H. Measurement of antigen-binding affinity by octet

I. Analysis of disulfide bonds by Cys-residue PEGylation

IgG was expressed in the cytosol of HEK293T by transient expression. Cells were transfected with KV10ΔLd-3D8 IgG/H-HA plasmid DNA using PEI and incubated for 36 hrs. Before harvesting the cells, NEM was treated to the medium at a concentration of 50 mM to block the oxidation of free thiol. Collected cells were washed twice with PBS after centrifugation in 3000 rpm for 10 min at 4°C. The cell pellet was resuspended in PBS containing 100 mM NEM and lysed by sonication at 30% amplitude three times for 10 seconds. The supernatant was collected by centrifugation with 13000 rpm for 10 min at 4°C and concentration of protein was measured by BCA assay. To remove the NEM in the supernatant, cell lysate was passed through desalting column (7 kDa molecular weight cut off, Thermo; cat#89882). For the reduction of disulfide bonds in the proteins, 5 mM of TRIS-(2-carboxyethyl) phosphine (TCEP) in the HEPES (pH 7.0) was treated to the NEM-removed cell lysate and incubated for 1 h at 37°C. Then, a linear monofunctional methyl ether poly-ethylene glycol with a reactive maleimide group (mPEG-MAL, 2 kDa-size, Creative PEGWorks; cat# PSB-235) constituted in PBS (pH 7.4) was treated at a final concentration of 10 mM and incubated for 1 h at 37°C. PEGylated proteins were mixed with SDS sample buffer in reducing condition and separated by 8% SDS-PAGE gel. Heavy chain of PEGylated IgG was detected by mouse anti-HA tag antibody (Millipore; Cat#. 05-904) and HRP conjugated horse anti-mouse IgG (H+L) antibody (Cell Signaling; Cat# 7076). Total PEGylated proteins were detected by rabbit anti-PEG antibody (abcam; Cat# Ab51257) and HRP conjugated goat anti-rabbit IgG (Zymed; Cat# 81-6120).

24 J. Analysis of assembly dynamics

HEK293T cells were transfected with KV10Ld-3D8 IgG or KV10Ld-IgG at 37C for 24 h. Aliquots of transfectant lysates were treated with 100 mM DTT for 30 min, then passed through a desalting column (ThermoFisher; cat# 89882) equilibrated with PBS, followed by micro-dialysis against PBS using a micro-dialyzer (ThermoFisher; cat# 88260) at 4C for 24 h. Proteins were subjected to immunoblotting analysis in non-reducing and denaturing conditions using anti-IgG/Fc antibody. To validate the complete removal of DTT in the above column and dialysis steps, 100 mM DTT in PBS was passed through the desalting column then subjected to dialysis against PBS, and the concentration of DTT was determined using a free thiol detection kit (Abcam; cat# ab112158).

K. Fluorescence microscopy

To observe multipolar spindle formation, anti-KIFC1 scFv was expressed in the cytosol of HeLa, MDA-MB-231, and RPE-1 cells by DNA transfection. The expression level of KIFC1 was knocked down using siRNA as a control for the inhibition of KIFC1 function.

The sequences of siRNA are shown in Table 2. After 24 h, the cells were treated with 100 μM of thymidine for 24 h and released for 9 h. MG132 was treated for 1 h at a final concentration of 10 μM. After fixation and permeation of the cells, the centrosomes were stained with mouse γ-tubulin IgG (Sigma; cat# T6557) and Alexa488-labeled rabbit anti-mouse IgG (Invitrogen; cat# A11059). Stained cells were observed under a fluorescence microscope (Zeiss, Axiovert 200M). The number of cells containing the multipolar spindle was counted at least three times.

25 L. Live cell imaging

For the analysis of the effect of cytosolic anti-KIFC1 scFvs expression on the mitosis duration, live cell imaging was performed. Transfected HeLa cells were placed in a stage-top incubation chamber and monitored every 3 minutes for 48 h by inverted fluorescence time-lapse microscope (Nikon, Ti-E). The mitotic duration was measured from cell round-up to anaphase onset. Mitotic duration refers to the time taken from when the cell begins to rise until it begins to divide.

M. Analysis of meta-to-anaphase delay

The meta-to-anaphase delay of the mitotic cell was confirmed by immunoblotting when scFv was expressed in the cytosol. Plasmids encoding the scFv gene are transfected into HeLa cells and treated with 100 μM of thymidine. After 24 h, the medium was replaced with thymidine-free medium and cells were harvested every hour from 8 h later. Harvested cells were mixed with 2xSDS buffer and directly lysed at 100°C for 5 min. SDS-PAGE and immunoblotting were performed to detect phospho-histone H3 (Cell signaling; cat# 9706), cyclin B1 (Santa Cruz; cat# SC-245), and GAPDH (Cell signaling; cat# 2118) levels in the cell lysate.

26 Table 2. Sequence of siRNA

Oligo sequence 5’-3’

si-control UUCUCCGAACGUGUCACGUTT

si-KIFC1

UAACUGACCCUUUAAGUCCUU AGUGUUGUGCGCUCUGUCCUU GACACAAGCACGCAAGUUCUU UGGUCCAACGUUUGAGUCCUU

III. RESULTS

A. Expression of IgGs in the cytosol

To investigate whether the characteristics of the antibody expressed in the cytosol are determined according to the variable region sequence, chimeric IgG was constructed by fusing four variable regions of mouse-derived antibodies (3 anti-KIFC1 antibodies and an anti-nucleic acid antibody) with the human IgG1 constant region (Figure 4A). A heavy chain and a light chain gene of IgG were inserted into a vector containing two promoters so that each chain could be expressed simultaneously. At the N-terminus of each chain, there is a leader sequence that transfers proteins to the ER when protein translation begins. The IgG expressed in ER was designated Ld. Cytosolic expression was achieved by removing the leader sequence at the N-terminus of the heavy and light chains, and the antibody expressed in the cytosol was labeled as ΔLd. IgGs were expressed in the ER or cytosol of HEK293T cells and expression level was confirmed by immunoblotting (Figure 4B). In the results, all heavy chains were expressed at similar levels regardless of the leader sequence. Light chain of 3D8 and 10C358 showed slightly lower cytosolic expression levels than those expressed in ER (Figure 4B).

Figure 4. Expression of IgGs in the ER or cytosol of HEK293T cells. (A) Schematic diagram of plasmids construction to express chimeric IgGs in the ER (Ld) or cytosol (ΔLd).

Heavy and light chains of IgG were expressed simultaneously using dual promoter vector.

(B) Immunoblotting for detection of heavy and light chains in lysates of HEK293T cells. An anti-DNA antibody (3D8) and three anti-KIFC1 antibodies (2C281, 6C407, and 10C358) were expressed in the ER or cytosol of HEK293T cells. The expressions of heavy and light chains were detected by goat anti-human IgG (Fc specific) antibody and goat anti-human kappa chain antibody followed by HRP-conjugated rabbit anti-goat IgG (H+L).

29 B. Antigen-binding activity of cytosolic IgGs

Antigen-binding activity of cytosolic IgGs was confirmed by ELISA and confocal microscopy. In ELISA, cell lysates prepared by disrupting HEK293T cells expressing cytosolic IgG were used. The ELISA plate coated with KIFC1 peptide antigens for anti-KIFC1 antibodies or single-strand DNA antigen for 3D8. All antibodies, except 10C358, expressed in the cytosol showed antigen-binding activity. All the antibodies expressed in ER had antigen-binding activity (Figure 5). This result was confirmed again by confocal microscopy (Figure 6). To confirm whether the cytosolic anti-KIFC1 IgG binds not only to the peptide antigen but also to the intracellular full-size KIFC1, co-localization of cytosolic anti-KIFC1 IgG with GFP-KIFC1 expressed in the HeLa was observed by confocal microscopy (Figure 6A). In interphase, KIFC1 is in the nucleus and cannot interact with IgG expressed in the cytosol. KIFC1 binds to the microtubule that forms a mitotic spindle in the metaphase of mitosis and moves toward the centrosome (minus-directed). Therefore, anti-KIFC1 IgG expressed in the cytosol can bind to anti-KIFC1 in mitosis. Similar to the cell lysate ELISA results, of the three anti-KIFC1 IgGs, 6C407 and 2C281 co-localized with KIFC1 in the mitotic phase, whereas 10C358 did not (Figure 6A). In the case of cytosolic 3D8 IgG, there is no antigen that can be used in cells. To confirm whether the antigen-binding site of cytosolic 3D8 IgG was properly formed, O2F3 IgM, an anti-idiotypic antibody that recognizes the conformation of the variable region of 3D8 IgG, were used to confocal microscopy (Figure 6B). HEK293T cells expressing cytosolic 3D8 IgG were fixed and permeabilized, and then treated with O2F3 IgM and its specific fluorescent-labeled antibody.

Confocal microscopy confirmed that cytosolic 3D8 IgG was recognized by O2F3, indicating

that the antigen binding site of cytosolic 3D8 IgG is properly formed. The results of the antigen-binding activity of cytosolic IgG showed that the variable region of the antibody determines the antigen-binding activity of cytosolic IgG.

Figure 5. Evaluation of binding activity of cytosolic IgGs. (A) The antigen-binding activity of cytosolic anti-KIFC1 IgG was analyzed by ELISA using peptide antigens synthesizing the epitope amino acid sequence of each antibody (KIFC1 peptide #1 for 2C281,

#2 for 6C407, and #3 for 10C358). Lysates of transfectants were placed in wells coated with specific antigens and bound IgGs were detected with AP-conjugated anti-human IgG/Fc.

Purified IgGs from HEK293F cells were used as positive control. (B) Binding activity of 3D8 anti-DNA IgG was analyzed by ELISA using synthetic single-strand DNA antigen. The subsequent ELISA procedure was performed in the same manner as in (A). Data are presented as mean ± SEM, n = 3. (C) An illustration showing the progress of the experiment.

Figure 6. Confocal microscopic analysis to confirm antigen-binding site of the cytosolic IgGs. (A) Cellular antigen-binding activity of cytosolic anti-KIFC1 IgGs were analyzed by confocal microscopy. HeLa cells stably expressing GFP-KIFC1 were transfected with the plasmids encoding ΔLd-anti-KIFC1 IgG gene. After synchronization of cells to mitotic phase, cells were fixed and stained with a primary antibody for anti-human IgG/Fc, followed by rhodamine-conjugated anti-goat IgG. (B) Formation of antigen-binding site of cytosolic 3D8 IgG was analyzed by confocal microscopy. Transiently transfected HEK293T cells were fixed, permeabilized, and then incubated with O2F3 (mouse IgM), followed by an Alexa Fluor 647-conjugated anti-mouse IgM/μ chain antibody. Bar = 10 μm.

C. Association of heavy and light chains of cytosolic IgGs

To explore why the antigen-binding activities of cytosolic IgGs are different each other, association between heavy and light chains of IgG was examined. We examined the association between heavy and light chains that compose the antigen binding site. Heavy chains of IgG in the HEK293T transfectants were immuno-precipitated by Protein-A/G and light chains interacting with the heavy chains were detected by western blot (Figure 7). As a result, H:L association was not observed in cytosolic 10C358 IgG that lost antigen-binding activity when expressed in the cytosol. The association of heavy and light chains of IgG was also confirmed through ELISA (Figure 8). Heavy chain of cytosolic IgG in the cell lysate is captured by Fc-specific antibody that is coated on the ELISA plate. The light chain associated with the heavy chain of cytosolic IgG is detected as a Cκ-specific antibody, and the AP-conjugated secondary antibody and the substrate are treated sequentially. ELISA was also performed to reverse the order of the antibodies used for capture and detection. After coating the Ck-specific antibody on the plate, the light chain of the cytosolic IgG was captured, and the heavy chain associated with the light chain was detected as AP-conjugated Fc-specific antibody. As a result, association between heavy and light chains was not observed in cytosolic 10C358 IgG as in IP results. These results confirm that the difference in antigen-binding of cytosolic IgG is related to the association of heavy and light chains.

Figure 7. Association of heavy and light chains of cytosolic IgGs. HEK293T cells lysates of IgGs transfectants were immunoprecipitated using Protein A/G-agarose. Input and IP samples were resolved by reducing SDS-PAGE and detected with goat anti-human IgG (Fc specific), goat anti-human IgG (kappa chain specific), and rabbit anti-cytoskeletal actin antibody, followed by HRP-conjugated rabbit goat IgG and HRP-conjugated goat anti-rabbit IgG, respectively. Input represents 10% of the total amount of lysate used in for IP.

Figure 8. Evaluation of H:L association of cytosolic IgGs. (A) Anti-human IgG/Fc was used as a capture antibody, followed by treatment of IgGs transfectants. Bound IgGs were detected by anti-human C and AP-conjugated secondary antibody. Asterisk (*) indicates negative control to ensure that the anti-rabbit IgG/Fc-specific antibody does not directly react with human IgG/Fc. (B) Anti-human C was used as a capture antibody. Lysates of HEK293T cells expressing IgGs were treated and detected by AP-conjugated anti-human IgG/Fc. Data are presented as mean ± SEM, n = 3.

D. H:L association in the absence of formation of the correct antigen-binding site If the antigen-binding activity of the variable region is not present, does it mean that the H:L association not occur? To explore this, hybrid 2C281 was constructed by replacing the Vκ site of cytosolic 2C281 IgG with a pseudo Vκ that does not bind to KIFC1, thereby eliminating the antigen-binding activity and comparing its characteristics with the original 2C281 IgG (Figure 9A). ELISA was performed to investigate antigen-binding activity and confirmed that the cytosolic hybrid 2C281 IgG did not bind to its peptide antigen (Figure 9B).

However, the results of H:L assembly-ELISA and IP showed that the heavy and light chain assembly of the cytosolic hybrid 2C281 IgG was maintained (Figure 9C, D). It was confirmed that even though the antigen-binding site is not properly formed, H:L association can occur irrespective of the antigen-binding site formation.

Figure 9. Association of heavy and light chains without formation of the correct antigen-binding site. (A) Schematic representation of Ld-hybrid IgG1 possessing 2C281 VH and pseudo Vκ as variable regions. (B) Evaluation of antigen-binding activity by ELISA. Lysates of HEK293T cells expressing ΔLd-2C281 or ΔLd-hybrid IgG were treated in wells coated with KIFC1 #1 peptide and bound chimeric IgGs were detected with AP-conjugated anti-human IgG/Fc antibody. (C) Evaluation of association between heavy and light chains by ELISA. Lysates of HEK293T cells expressing ΔLd-2C281 or ΔLd-hybrid IgG were treated in wells coated with anti-human C, and bound IgGs were detected with AP-conjugated anti-human IgG/Fc antibody. In (B, C), data are presented as mean ± SEM, n = 6. (D) Co-IP to

confirm assembly of heavy and light chains. Lysates of HEK293T cells expressing ΔLd-2C281 or ΔLd-hybrid IgG were immunoprecipitated using Protein A/G-agarose. Proteins in the eluate were detected with goat anti-human IgG (Fc specific), goat anti-human IgG (Cκ

specific), and rabbit anti-actin antibody, followed by HRP-conjugated rabbit anti-goat IgG and HRP-conjugated goat anti-rabbit IgG, respectively. Input and elution samples were resolved by reducing SDS-PAGE. Input represents 10% of the total amount of lysate used for IP.

E. Effect of structural integrity of the constant region on H:L association and formation of the correct antigen-binding site in cytosolic IgGs

If so, is the heavy and light chain linkage of the cytosolic IgG determined entirely by the variable region? To analyze the effect of constant region on H:L association, disulfide bonds were focused , which play an important role in heavy and light chain interaction. The mutant ΔLd-IgG *#H*#L, which cannot form all disulfide bond, was expressed by replacing all cysteine residues in the constant region with serine residues which have same structure with cysteine but one oxygen atom instead of sulfur (Figure 10A). Expression of mutant and wildtype cytosolic IgGs was confirmed by western blotting (Figure 10B) and the assembly of heavy and light chains and antigen-binding activity were confirmed by ELISA (Figure 10C, D). As a result, interaction of heavy chain-light chain and antigen-binding activity were not observed in all mutants. This shows that the constant region of cytosolic IgG may affects the H:L association and antigen-binding activity.

Figure 10. Effect of the absence of disulfide bonds in constant regions on H:L association and correct folding of antigen-binding site in cytosolic IgGs. (A) Schematic representation of Ld-IgG*^#H*^#L. Sharp (#) means disruption of intra-chain disulfide bonds and asterisk (*) means disruption of inter-chain disulfide bonds. (B) Heavy and light chains in lysates of HEK293T cells transiently transfected with KV10 vectors encoding wt ΔLd-IgG and mutant ΔLd-IgG*^#H*^#L were detected by immunoblotting. Heavy chain was detected with goat anti-human IgG (Fc specific) and light chain was detected by goat anti-anti-human IgG (Cκ specific),

followed by HRP-conjugated rabbit anti-goat IgG. (C) ELISA to evaluate association of heavy and light chains was performed using anti-human C as a capture antibody. Lysates of HEK293T cells expressing wt ΔLd-IgG and mutant ΔLd-IgG*^#H*^#L were treated and bound IgGs were detected with AP-conjugated anti-human IgG/Fc antibody. (D) ELISA to evaluate antigen-binding of wt ΔLd-IgG and mutant ΔLd-IgG*^#H*^#L was performed. Lysates of HEK293T cells expressing wt ΔLd-IgG and mutant ΔLd-IgG*^#H*^#L were treated to wells coated with their specific antigens and bound IgGs were detected with AP-conjugated anti-human IgG/Fc antibody.

F. Importance of intra-chain disulfide bonds in H:L association and antigen-binding site formation of cytosolic IgGs

In order to understand disulfide bonds present in the constant region, antibodies were expressed without the variable region and designated as Ig-Cw (Immunoglobulin whole constant region). I constructed a *#CH*#CL mutant that does not form all disulfide bonds and *CH*CL mutant that does not form inter-chain disulfide bonds (Figure 11A). Protein expression was confirmed by immunoblotting (Figure 11B), and expression levels were extremely low when all disulfide bonds were eliminated regardless of the leader sequence. It is presumed that the absence of disulfide bonds has some influence on the stability of the protein. ELISA showed that H:L association was observed in CHCL and *CH*CL, which have all disulfide bonds and intra-chain disulfide bonds, respectively. However, heavy and light chains of *#CH*# CL, which eliminated all disulfide bonds, was not assembled (Figure 11C). These results indicated that intra-chain disulfide bonds are important to association of heavy and light chain.

Figure 11. Effect of intrachain disulfide bonds on H:L association and antigen-binding site formation of cytosolic IgGs. (A) Schematic representation of Ld-Ig-Cw (whole constant region) mutants. Sharp (#) means disruption of intra-chain disulfide bonds and asterisk (*) means disruption of inter-chain disulfide bonds. The black square at the N-terminus of Cw means leader sequence. (B) Heavy and light chains in lysates of HEK293T cells transiently transfected with KV10 vectors encoding Ig-Cw with or without Ld were detected by immunoblotting. Heavy chain was detected with goat anti-human IgG (Fc specific) and light chain was detected by goat anti-human IgG (C specific), followed by HRP-conjugated rabbit anti-goat IgG. (C) ELISA to evaluate association of heavy and light chains was performed using anti-human C as a capture antibody. Lysates of HEK293T cells expressing Ld-Ig-Cw and ΔLd-Ig-Cw constructs were treated and bound Ig-Cw were detected with AP-conjugated anti-human IgG/Fc antibody. Data are presented as mean ± SEM, n = 3.

G. Partial formation of intra-chain disulfide bonds in heavy and light chains of cytosolic IgGs

Cysteine residues in the state of reduced cytosol environment can form disulfide bonds without enzymatic reaction when cells are destroyed and exposed to an oxidizing environment in the air. To exclude this possibility, I compared the differences between the cells after exposure to air for 0 and 12 h by western blotting. The HA or Flag tag were labeled to the carboxy terminal of the heavy or light chain of 3D8 IgG and expressed in the cytosol, and the expression level was confirmed by western blotting (Figure 12A, B). Analysis showed no difference between the 0 and 12 h-exposed samples in the air. When treated with the thiol alkylating agent NEM, some cysteine residues in the IgG were alkylated and the band size was slightly increased (Figure 12B, lane 3,4). The reason for the alkylation of cytosolic IgG by NEM is that some cysteine residues exist in reduced form without forming intra-disulfide bonds. Thus, this suggests that the disulfide bond in the cytosolic IgG is partially formed.

문서에서 Structural and Functional Properties of the Recombinant anti-KIFC1 Antibodies Expressed in the Cytosol (페이지 34-0)