In vitro transcription and translation

About 500 ng of the prepared DNA was used to the 50 ㎕ of transcription reaction. In vitro transcription was conducted same as described protocol 1.2. in vitro transcription of 3D8 VH/κ.

4. In vitro translation

In vitro translation and autoradiography of antibody library was conducted same as described protocol 1.3. in vitro translation of 3D8 VH/κ.

5. Affinity selection

Microtiter plates (Costar) were coated at 4 overnight with 50 ㎕ of TP-peptide solution (1 ìM in PBS) or PBS. The coated plates were washed with PBS and blocked with sterilized 10 % (w/v) skim milk in PBSM (PBS with 5 mM Magnesium chloride) for 30 min at 25℃. After washing with PBS, it was blocked again with blocking buffer (5% (w/v) BSA in PBSM) for 2 hr, followed by washing with PBSM 3 times and incubation on ice for at least 10 min.

Fifty microliter of in vitro translated products were immediately mixed with 150 ㎕ of ice-cold buffer (PBS containing 5 mM magnesium chloride, and 1.5%

(w/v) BSA), mixture was added to the PBS-coated microtiter plate, and incubated at

4℃ for pre-binding. After pre-binding, the supernatant was transferred to a TP-peptide coated well. The plate was incubated for 1 hr on ice, washed 3 times with ice-cold PBSTM (PBS containing 5 mM magnesium chloride, and 0.05% (v/v) Tween 20) and twice with ice-cold PBSM, The retained ribosomal complexes were dissociated with 200 ㎕ of EB20 buffer (PBS containing 20 mM EDTA) for 10 min on ice. The mRNA was isolated from the eluted solution using an RNA isolation kit (Roche Applied Science, Indianapolis, IN, USA), as described by the manufacturer.

6. RT-PCR

RT-PCR was conducted same as protocol 1.5.2. RT-PCR except primers.

T7/back (5’- CAGCTAATACGACTCACTATAGGAACAGACCACCATG(GC)AG GT(GC)CA(GC)CTCGAG(GC)AGTCTGG-3’) and Ck/for (5’-GCTCTAGAACA CTCATTCCTGTTGGAGCT-3’) primers used in reaction. Another downstream primers was used, D2 (5’- CGTGAGGGTGCTGCTCAT-3’) primer in the second cycle, D3 (5’-GCCATTTTGTCGTTCACTGCCATC-3’) in the third cycle, and D4 (5’-CTGGATGGTGGGAAGATGG-3’) in the fourth cycle for nested PCR.

7. Radioimmunoassay (RIA)

Microtiter plates (Costar) were prepared as described for affinity selection.

The translation mixture was prepared as described for affinity selection, except 1 ㎕

of methionine was substituted by 2 ㎕ [³⁵S] methionine (50 ìCi/ml). After translation, 150 ㎕ of ice-cold buffer (PBS containing 5 mM magnesium chloride, and 1.5 % (w/v) BSA) was added to the translation mixture. Binding was performed for 1 hr at 4 . After washing five times with PBST, bound protein was eluted with 200 ㎕ of 4% (w/v) sodium dodecyl sulfate (SDS) at room temperature for 10 min. Bound proteins were quantified with a Microbeta TriLux scintillation counter (PerkinElmer Life and Analytical Sciences, Boston, MA, USA).

8. Cloning and expression

To amplify the scFv DNA sequences from selected DNA, a forward primer,

VH/back_SfiI (5’

GTCGTCGCAACTGCGGCCCAGCCGGCCATGGCC(GC)AGGT

(GC)CA(GC)CTCGAG(GC)AGTCTGG 3’) and a reverse primer, Vk/For_NotI (GAGTCATTCTGCGGCCGCTGCAGCATCAGCCCGTTT) were used in PCR (restriction sites SfiI and NotI, respectively, are underlined). The PCR reaction was performed by pfu DNA polymerase (Bioneer Co) for 25 cycles (94℃ for 30 s, 55℃

for 40 s, 72℃ for 1 min). The amplified scFv DNA and pCANTAB5E vector (Amersham Biosciences) were digested with SfiI (New England Biolabs) and NotI (New England Biolabs) and purified using the QIAexII gel extraction kit (Qiagen).

Ligations of prepared insert DNA and pCANTAB5E vector were carried out using T4 DNA ligase. The insert DNA was mixed with pCANTAB5E vector in 10 ㎕ of

1× ligation buffer and then incubated at 16℃ for overnight in the presence of 1 U of T4 DNA ligase (USB, Cleveland, OH, USA). The ligations were transformed into E.

coli TG1 and soluble proteins were expressed from each clone. Briefly, each single colony was cultured in 5 ㎖ of 2×-YT medium with 100 ㎍/㎖ ampicillin and 0.1%

(w/v) glucose at 30℃ with 250 rpm shaking until they reached an absorbance of 0.7 at 600 nm. Isopropyl-b-D-thiogalactopyranoside (IPTG) was added to obtain a final concentration of 1 mM , and the cells were incubated at 30℃ overnight with shaking at 130 rpm. Cells were pelleted and resuspended in 0.5 ml ice-cold 1× TES buffer (0.2 M Tris-HCl (pH 8.0), 0.5 mM EDTA, 0.5 M sucrose) and 0.75 ㎖ ice-cold 1/4×

TES buffer. After incubation on ice for 30 min, the cells were pelleted by centrifugation at 10,000 rpm for 10 min and the supernatant retained as periplasmic extracts containing the soluble scFvs.

9. Enzyme-l inked i mmunosorbent assay (ELISA)

To screen TP-specific scFvs, periplasmic extracts from each clone were analyzed by ELISA. Microtiter plates (Costar) were coated with synthetic TP-peptide or human HBV DNA polymerase expressed in a baculovirus- infected insect system at 37℃ for 2 hr and 5% (w/v) BSA was used for blocking. After washing, periplasmic extracts with a final concentration of 1% (w/v) BSA were added to the well and incubated overnight at 4℃. To determine the amount of soluble scFv antibody bound, the microtiter plate was incubated with 100 ㎕ of mouse anti- E tag

HRP conjugate (Amersham Biosciences) in blocking buffer (1:4,000) at room temperature for 1 hr. After washing, ABTS (Sigma-Aldrich) was used as a substrate, and absorbance was determined using a microtiter plate reader with a 405 nm measurement filter.

10. Western blot analysis of scFv expression

Periplasmic extracts from selected anti- TP produc ing clones were subjected to SDS-PAGE on a 12% polyacrylamide gel. Prestained SDS-PAGE standards (New England Biolabs) were used to calibrate protein mobilities. After SDS-PAGE, the proteins were transferred to a nitrocellulose membrane (Schleichr & Schuell). The transblotted membrane was blocked for 1 hr at RT with blocking solution (2% (w/v) skim milk in PBS) and then incubated for 1 hr at RT with peroxidase-conjugated mouse anti- E tag (1:1,000 dilution with blocking solution). 4-CN (4-Chloro-1-naphthol, Sigma-Aldrich) was used as a peroxidase substrate to visualize immunoreactivity.

11. Sequence analysis

Plasmid DNA from anti-TP producing clones was isolated from E. coli TG1.

The scFv DNA was sequenced on both strands with the pCANTAB5E sequence primer set (Amersham Biosciences) using an ABI Perkin Elmer 373A automated

DNA sequencer (Applied Biosystems).

III. RESULTS

A. Model system for ribosome display

1. 3D8 VH/ê sequence and in vitro synthesized 3D8 VH/ê

After recombinant PCR and cloning, nucleotide sequencing was performed to check frameshift mutation or stop codon. Assembled DNA was in vitro transcribed by T7 RNA polymerase, and then it was treated with DNaseI to remove the template DNA. The synthesized RNA was checked by agarose gel electrophoresis (Fig. 7A).

To obtain the 3D8 VH/κ antibody fragment, the synthesized RNA was in vitro translated by rabbit reticulocyte lysate. Two strategies were used to evaluate to assess if 3D8 VH/κ was synthesized. The translated 3D8 VH/κ protein was labeled with [³⁵S] methionine, and subjected to SDS-PAGE followed by autoradiography (Fig. 7B). The 3D8 VH/κ mRNA translation product migrated as an intact band with molecular weight of 40 kDa approximately. The luciferase RNA translation product was approximately 65 kDa as a positive control. Translation mixture without mRNA or containing cycloheximide which did not show any radioactive band was employed as a negative control. The molecular weight of the synthesized 3D8 VH/κ was similar to those theoretically calculated (40 kDa).

Since the synthesized 3D8 VH/κ protein has polyhistidine (His6) affinity tag

at 5’ end, the 3D8 VH/κ protein could be detected by Western blot with anti- His antibody. A band of approximate 40 kDa was detected by Western blot from the translation mixture with 3D8 VH/κ RNA (Fig. 7c). Another strong band about 45 kDa molecular weight was detected but also detected in negative control reaction, such as translation mixture without RNA or with luciferase RNA. This band could be a protein in rabbit reticulocyte lysate that is reacted with anti-His antibody.

1kb 500 bp

A. B.

Fig. 7. The synthesized 3D8 VH/ê. A. 3D8 VH/ê RNA. After RNA transcription, DNA was removed by DNaseI treatment. The transcribed RNA was checked by gel electrophoresis. B. In vitro translated 3D8 VH/ê. After translation reaction, the translation mixture was subjected to the 12% SDS-PAGE, and detected by autoradiography. The translated 3D8 VH/ê protein was indicated by an arrow.

[¹⁴C] protein molecular weight marker (lane M), luciferase as control (lane 1) and 3D8 VH/ê (lane 2) are shown. C. Western blot of 3D8 VH/ê. Translation of 3D8 VH/ê RNA (lane 1), translation without RNA (lane 2), and translation of 3D8 VH/ê RNA with cycloheximide (lane 3) are shown.

2. Binding activity of translated 3D8 VH/ê

The binding activity of translated 3D8 VH/κ protein was analyzed by ELISA (Fig. 8A). The translation mixture with 3D8 VH/κ RNA was specifically bound to ssDNA but translation mixture without RNA or with cycloheximide which inhibit translation did not show any reactivity to ssDNA.

3. Ribosome display with 3D8 VH/κ

After it was confirmed that in vitro translated 3D8 was bound to ssDNA specifically, it was checked whether 3D8 gene was specifically selected by ribosome display. The 3D8 gene could be selected from ssDNA immobilized surface. After selection with ssDNA coated surface, eluted RNA was amplified by reverse transcription PCR and analyzed by agarose gel electrophoresis. ssDNA reacting translation mixture with 3D8 VH/κ RNA showed a clear amplified band (Fig. 8B).

A faint band was observed when translation mixture with 3D8 VH/κ RNA was reacted with bovine serum albumin and no band was detected from translation mixture without 3D8 VH/κ RNA or with cycloheximide. The binding activity determined by ELISA was consistent with the result of ribosome display. This result indicates that VH/κ-ribosome- mRNA complex is well maintained during the selection process and shows that the antibody gene can be specifically selected by interaction between VH/κ antibodies displayed ribosome complexes and antigen.

Fig. 8. Binding activity and selectivity of 3D8 VH/ê through ribosome display. A.

ELISA of translation mixtures. Each reaction condition was showed as a table.

Translated mixtures with 3D8 VH/ê RNA (1, 3), without RNA (2), and 3D8 VH/ê RNA with cycloheximide (4), were reacted with ssDNA (1, 2, and 4) or BSA (3). B.

Selection and amplification of 3D8 gene by RT-PCR. Translated mixture with 3D8 RNAs (lane 1, 3), distilled water (lane 2), and 3D8 RNAs with cycloheximide (lane 4), were selected with ssDNA (lane 1, 2, and 4) or BSA (lane3).

1 2 3 4

Antigen ssDNA ssDNA - ssDNA 3D8 VH/ê

RNA + - + +

Cycloheximide - - - +

1 2 3 4

Antigen ssDNA ssDNA - ssDNA 3D8 VH/ê

RNA + - + +

Cycloheximide - - - +

B.

B. TP-specific scFv selection by using ribosome display

1. Immunization of mice

Blood samples from TP-peptide immunized mice were taken 7 days after the fourth boost and antibody production was determined by ELISA. The ELISA results from the mouse sera that had highest titer presented as a graph (Fig. 9). Splenic cells were isolated from the spleen immunized mouse that showed the highest antibody titer.

2. PCR amplification and preparation of mRNA

VH and kappa-chain DNA were amplified by RT-PCR and assembled into VH/ê-DNA fragments using the (Gly4Ser)3 linker sequence, upstream T7/back primer and downstream Ck/for primer (Fig. 10). The T7/back primer contained a T7 promoter and ribosome binding site and the Ck/for primer had no stop codon. The Ck region of kappa chain acts as a spacer that tethers the synthesized protein to the ribosome and helps proper folding of scFv. Assembled VH/ê chain DNAs of 1.1 kb was used for preparation of mRNA.

0 0.2 0.4 0.6 0.8 1 1.2

1:5000 1:10000 1:20000 1:40000 1:80000 1:160000 s e r u m d i l u t i o n

Absorbance at 405 nm

Fig. 9. Titration of immunized sera by indirect ELISA. After immunization with TP-peptide, antibody production of immunized mouse was determined by ELISA. The ELISA results from the mouse sera that had highest titer presented.

Relative antigen binding curves were plotted for immunized sera (u) and pre-immunized sera (n).

Fig. 10. Amplified DNA fragments of VH DNA, kappa chain DNA and assembled VH/k DNA in agarose gel electrophoresis. VH DNA and kappa chain DNA were separately amplified by RT-PCR from the total RNA of lymphocytes that were obtained from a terminal protein (TP)-peptide immunized mouse. After gel purification, VH DNA and kappa chain DNA were assembled with (Gly4Ser)3 linker DNA by PCR. A. Purified VH and kappa chain DNA. Lane 1: 1kb plus DNA marker, Lane 2: 340 bp VH DNA, Lane 3: purified VH DNA, Lane 4: 750 bp scFv, Lane 5:

kappa chain DNA. B. Assembled VH/ê DNA library. Lane 1: 1 kb plus DNA marker, Lane 2: 1.2 kb-sized assembled scFv DNA library.

A.

1 kb ▶

B.

1 2

1 kb ▶

1 2 3 4 5

3. In vitro transcription and translation

The prepared VH/κ-DNA library was used to transcribe in vitro RNA with T7 RNA polymerase. The transcribed mRNA revealed a single band of an expected size by gel electrophoresis. After the synthesized mRNA was translated by a Flexi rabbit reticulocyte lysate system, the translation mixture was subjected to SDS-PAGE followed by autoradiography (Fig. 11). The translated products were detected as two major band s of about 35 kDa and 45 kDa. The translated product with luciferase mRNA had a radioactive band of 61 kDa in size. The unexpected 35kDa protein might be dead end product resulted from stop codon within library DNA.

Luciferase, 61 kDa

Library proteins 45 kDa ▶

1 2 3

30 kDa ▶

20 kDa ▶

Fig. 11. In vitro translated library proteins detected by autoradiography. In vitro translation was carried out with in vitro transcribed mRNA. After in vitro translation with [³⁵S] labeled methionine, the products of the translation reaction were separated by SDS-PAGE and visualized by autoradiography. Lane 1: [¹⁴C] methylated protein molecular weight markers, Lane 2: synthesized library proteins, Lane 3: protein translated with luciferase mRNA as control