Cloning and expression - TP-specific scFv selection by using ribosome display

B. TP-specific scFv selection by using ribosome display

8. Cloning and expression

To amplify the scFv DNA sequences from selected DNA, a forward primer,

VH/back_SfiI (5’

GTCGTCGCAACTGCGGCCCAGCCGGCCATGGCC(GC)AGGT

(GC)CA(GC)CTCGAG(GC)AGTCTGG 3’) and a reverse primer, Vk/For_NotI (GAGTCATTCTGCGGCCGCTGCAGCATCAGCCCGTTT) were used in PCR (restriction sites SfiI and NotI, respectively, are underlined). The PCR reaction was performed by pfu DNA polymerase (Bioneer Co) for 25 cycles (94℃ for 30 s, 55℃

for 40 s, 72℃ for 1 min). The amplified scFv DNA and pCANTAB5E vector (Amersham Biosciences) were digested with SfiI (New England Biolabs) and NotI (New England Biolabs) and purified using the QIAexII gel extraction kit (Qiagen).

Ligations of prepared insert DNA and pCANTAB5E vector were carried out using T4 DNA ligase. The insert DNA was mixed with pCANTAB5E vector in 10 ㎕ of

1× ligation buffer and then incubated at 16℃ for overnight in the presence of 1 U of T4 DNA ligase (USB, Cleveland, OH, USA). The ligations were transformed into E.

coli TG1 and soluble proteins were expressed from each clone. Briefly, each single colony was cultured in 5 ㎖ of 2×-YT medium with 100 ㎍/㎖ ampicillin and 0.1%

(w/v) glucose at 30℃ with 250 rpm shaking until they reached an absorbance of 0.7 at 600 nm. Isopropyl-b-D-thiogalactopyranoside (IPTG) was added to obtain a final concentration of 1 mM , and the cells were incubated at 30℃ overnight with shaking at 130 rpm. Cells were pelleted and resuspended in 0.5 ml ice-cold 1× TES buffer (0.2 M Tris-HCl (pH 8.0), 0.5 mM EDTA, 0.5 M sucrose) and 0.75 ㎖ ice-cold 1/4×

TES buffer. After incubation on ice for 30 min, the cells were pelleted by centrifugation at 10,000 rpm for 10 min and the supernatant retained as periplasmic extracts containing the soluble scFvs.

9. Enzyme-l inked i mmunosorbent assay (ELISA)

To screen TP-specific scFvs, periplasmic extracts from each clone were analyzed by ELISA. Microtiter plates (Costar) were coated with synthetic TP-peptide or human HBV DNA polymerase expressed in a baculovirus- infected insect system at 37℃ for 2 hr and 5% (w/v) BSA was used for blocking. After washing, periplasmic extracts with a final concentration of 1% (w/v) BSA were added to the well and incubated overnight at 4℃. To determine the amount of soluble scFv antibody bound, the microtiter plate was incubated with 100 ㎕ of mouse anti- E tag

HRP conjugate (Amersham Biosciences) in blocking buffer (1:4,000) at room temperature for 1 hr. After washing, ABTS (Sigma-Aldrich) was used as a substrate, and absorbance was determined using a microtiter plate reader with a 405 nm measurement filter.

10. Western blot analysis of scFv expression

Periplasmic extracts from selected anti- TP produc ing clones were subjected to SDS-PAGE on a 12% polyacrylamide gel. Prestained SDS-PAGE standards (New England Biolabs) were used to calibrate protein mobilities. After SDS-PAGE, the proteins were transferred to a nitrocellulose membrane (Schleichr & Schuell). The transblotted membrane was blocked for 1 hr at RT with blocking solution (2% (w/v) skim milk in PBS) and then incubated for 1 hr at RT with peroxidase-conjugated mouse anti- E tag (1:1,000 dilution with blocking solution). 4-CN (4-Chloro-1-naphthol, Sigma-Aldrich) was used as a peroxidase substrate to visualize immunoreactivity.

11. Sequence analysis

Plasmid DNA from anti-TP producing clones was isolated from E. coli TG1.

The scFv DNA was sequenced on both strands with the pCANTAB5E sequence primer set (Amersham Biosciences) using an ABI Perkin Elmer 373A automated

DNA sequencer (Applied Biosystems).

III. RESULTS

A. Model system for ribosome display

1. 3D8 VH/ê sequence and in vitro synthesized 3D8 VH/ê

After recombinant PCR and cloning, nucleotide sequencing was performed to check frameshift mutation or stop codon. Assembled DNA was in vitro transcribed by T7 RNA polymerase, and then it was treated with DNaseI to remove the template DNA. The synthesized RNA was checked by agarose gel electrophoresis (Fig. 7A).

To obtain the 3D8 VH/κ antibody fragment, the synthesized RNA was in vitro translated by rabbit reticulocyte lysate. Two strategies were used to evaluate to assess if 3D8 VH/κ was synthesized. The translated 3D8 VH/κ protein was labeled with [³⁵S] methionine, and subjected to SDS-PAGE followed by autoradiography (Fig. 7B). The 3D8 VH/κ mRNA translation product migrated as an intact band with molecular weight of 40 kDa approximately. The luciferase RNA translation product was approximately 65 kDa as a positive control. Translation mixture without mRNA or containing cycloheximide which did not show any radioactive band was employed as a negative control. The molecular weight of the synthesized 3D8 VH/κ was similar to those theoretically calculated (40 kDa).

Since the synthesized 3D8 VH/κ protein has polyhistidine (His6) affinity tag

at 5’ end, the 3D8 VH/κ protein could be detected by Western blot with anti- His antibody. A band of approximate 40 kDa was detected by Western blot from the translation mixture with 3D8 VH/κ RNA (Fig. 7c). Another strong band about 45 kDa molecular weight was detected but also detected in negative control reaction, such as translation mixture without RNA or with luciferase RNA. This band could be a protein in rabbit reticulocyte lysate that is reacted with anti-His antibody.

1kb 500 bp

A. B.

Fig. 7. The synthesized 3D8 VH/ê. A. 3D8 VH/ê RNA. After RNA transcription, DNA was removed by DNaseI treatment. The transcribed RNA was checked by gel electrophoresis. B. In vitro translated 3D8 VH/ê. After translation reaction, the translation mixture was subjected to the 12% SDS-PAGE, and detected by autoradiography. The translated 3D8 VH/ê protein was indicated by an arrow.

[¹⁴C] protein molecular weight marker (lane M), luciferase as control (lane 1) and 3D8 VH/ê (lane 2) are shown. C. Western blot of 3D8 VH/ê. Translation of 3D8 VH/ê RNA (lane 1), translation without RNA (lane 2), and translation of 3D8 VH/ê RNA with cycloheximide (lane 3) are shown.

2. Binding activity of translated 3D8 VH/ê

The binding activity of translated 3D8 VH/κ protein was analyzed by ELISA (Fig. 8A). The translation mixture with 3D8 VH/κ RNA was specifically bound to ssDNA but translation mixture without RNA or with cycloheximide which inhibit translation did not show any reactivity to ssDNA.

3. Ribosome display with 3D8 VH/κ

After it was confirmed that in vitro translated 3D8 was bound to ssDNA specifically, it was checked whether 3D8 gene was specifically selected by ribosome display. The 3D8 gene could be selected from ssDNA immobilized surface. After selection with ssDNA coated surface, eluted RNA was amplified by reverse transcription PCR and analyzed by agarose gel electrophoresis. ssDNA reacting translation mixture with 3D8 VH/κ RNA showed a clear amplified band (Fig. 8B).

A faint band was observed when translation mixture with 3D8 VH/κ RNA was reacted with bovine serum albumin and no band was detected from translation mixture without 3D8 VH/κ RNA or with cycloheximide. The binding activity determined by ELISA was consistent with the result of ribosome display. This result indicates that VH/κ-ribosome- mRNA complex is well maintained during the selection process and shows that the antibody gene can be specifically selected by interaction between VH/κ antibodies displayed ribosome complexes and antigen.

Fig. 8. Binding activity and selectivity of 3D8 VH/ê through ribosome display. A.

ELISA of translation mixtures. Each reaction condition was showed as a table.

Translated mixtures with 3D8 VH/ê RNA (1, 3), without RNA (2), and 3D8 VH/ê RNA with cycloheximide (4), were reacted with ssDNA (1, 2, and 4) or BSA (3). B.

Selection and amplification of 3D8 gene by RT-PCR. Translated mixture with 3D8 RNAs (lane 1, 3), distilled water (lane 2), and 3D8 RNAs with cycloheximide (lane 4), were selected with ssDNA (lane 1, 2, and 4) or BSA (lane3).

1 2 3 4

Antigen ssDNA ssDNA - ssDNA 3D8 VH/ê

RNA + - + +

Cycloheximide - - - +

1 2 3 4

Antigen ssDNA ssDNA - ssDNA 3D8 VH/ê

RNA + - + +

Cycloheximide - - - +

B. B. TP-specific scFv selection by using ribosome display

1. Immunization of mice

Blood samples from TP-peptide immunized mice were taken 7 days after the fourth boost and antibody production was determined by ELISA. The ELISA results from the mouse sera that had highest titer presented as a graph (Fig. 9). Splenic cells were isolated from the spleen immunized mouse that showed the highest antibody titer.

2. PCR amplification and preparation of mRNA

VH and kappa-chain DNA were amplified by RT-PCR and assembled into VH/ê-DNA fragments using the (Gly4Ser)3 linker sequence, upstream T7/back primer and downstream Ck/for primer (Fig. 10). The T7/back primer contained a T7 promoter and ribosome binding site and the Ck/for primer had no stop codon. The Ck region of kappa chain acts as a spacer that tethers the synthesized protein to the ribosome and helps proper folding of scFv. Assembled VH/ê chain DNAs of 1.1 kb was used for preparation of mRNA.

0 0.2 0.4 0.6 0.8 1 1.2

1:5000 1:10000 1:20000 1:40000 1:80000 1:160000 s e r u m d i l u t i o n

Absorbance at 405 nm

Fig. 9. Titration of immunized sera by indirect ELISA. After immunization with TP-peptide, antibody production of immunized mouse was determined by ELISA. The ELISA results from the mouse sera that had highest titer presented.

Relative antigen binding curves were plotted for immunized sera (u) and pre-immunized sera (n).

Fig. 10. Amplified DNA fragments of VH DNA, kappa chain DNA and assembled VH/k DNA in agarose gel electrophoresis. VH DNA and kappa chain DNA were separately amplified by RT-PCR from the total RNA of lymphocytes that were obtained from a terminal protein (TP)-peptide immunized mouse. After gel purification, VH DNA and kappa chain DNA were assembled with (Gly4Ser)3 linker DNA by PCR. A. Purified VH and kappa chain DNA. Lane 1: 1kb plus DNA marker, Lane 2: 340 bp VH DNA, Lane 3: purified VH DNA, Lane 4: 750 bp scFv, Lane 5:

kappa chain DNA. B. Assembled VH/ê DNA library. Lane 1: 1 kb plus DNA marker, Lane 2: 1.2 kb-sized assembled scFv DNA library.

1 kb ▶

1 2

1 kb ▶

1 2 3 4 5

3. In vitro transcription and translation

The prepared VH/κ-DNA library was used to transcribe in vitro RNA with T7 RNA polymerase. The transcribed mRNA revealed a single band of an expected size by gel electrophoresis. After the synthesized mRNA was translated by a Flexi rabbit reticulocyte lysate system, the translation mixture was subjected to SDS-PAGE followed by autoradiography (Fig. 11). The translated products were detected as two major band s of about 35 kDa and 45 kDa. The translated product with luciferase mRNA had a radioactive band of 61 kDa in size. The unexpected 35kDa protein might be dead end product resulted from stop codon within library DNA.

Luciferase, 61 kDa

Library proteins 45 kDa ▶

1 2 3

30 kDa ▶

20 kDa ▶

Fig. 11. In vitro translated library proteins detected by autoradiography. In vitro translation was carried out with in vitro transcribed mRNA. After in vitro translation with [³⁵S] labeled methionine, the products of the translation reaction were separated by SDS-PAGE and visualized by autoradiography. Lane 1: [¹⁴C] methylated protein molecular weight markers, Lane 2: synthesized library proteins, Lane 3: protein translated with luciferase mRNA as control

4. Selection of TP-specific scFv gene

Microtiter plates were used for affinity selection. After selection, eluted mRNA was amplified by RT-PCR to confirm the specificity of synthesized ARM complex against TP-peptide. A single clear DNA band was detected only from translation mixture selected against TP-peptide. No band was observed from PBS-coated wells or when untranslated mixture (translated for 0 min) was used (Fig. 12).

This result indicated that TP-peptide-specific scFvs genes could be selected against immobilized TP-peptide antigen by ribosome display.

During four rounds of selection, nested PCR primers such that primers for the next round that those for the previous round, i.e., D2 in the second, D3 in the third, and D4 in the fourth round were used. Thus, the recovered DNA became progressively shorter in each cycle. The recovered band was clearer when an inner 3’

end primer was used rather than the same primer (Fig. 13). To confirm TP-specific selection, a negative control reaction was included for each selection process. No band was recovered from the PBS-coated wells in any round of selection. However, a recovered band was observed in the non-translation control of the third round of selection. This might be because the translation reaction was not completely blocked.

The selected DNA pools were analyzed by radioimmunoassay to verify the enrichment of binding activity to TP-peptide (Fig. 14). Luciferase was used as a negative control. Progressive enrichment was observed by RIA and the binding activity of after 3 rounds of selection was about five times higher than the negative

control.

Fig. 12. Selection and amplification of VH/ê gene against TP -peptide.

Confirmation of the specificity against TP-peptide was conducted under various conditions. After selection, eluted RNA was amplified by RT-PCR and the RT-PCR products were analyzed by agarose gel electrophoresis. This result ind icates that selection of scFv that binds to TP-peptide was successfully and the library DNA could be amplified by their specific interaction. Lane 1: translation mixture selected from a TP-peptide-coated well. Lane 2: translation mixture selected from a PBS-coated well. Lane 3: untranslated mRNA of VH/ê. Lane 4: RT-PCR with elution buffer.

M 1 2 3 4

M 1 2 3 4

Fig. 13. Effect of internal primer in RT-PCR. Two different primers were used for RT-PCR. The amplification was much better using D4, internal primer (lane 2) than D3, 3’ primer (lane 1). The reaction with Distilled water (lane 3, lane 4) by these primers was used as negative control. This result indicates that the use of an internal primer increases a sensitivity and specificity of RT-PCR.

Fig. 14. Analysis of enriched TP -peptide -specific scFv pools. Recovered DNAs from each round of ribosome display were used to analyze the presence of specific binders. Similar quantities of DNA from each round were used for in vitro transcription/translation. The [³⁵S] methionine labeled in vitro translated protein was bind to TP-peptide, and analyzed by RIA. Luciferase protein was translated as a negative control (-). 1st, 2nd, and 3rd selected pool are marked as 1st, 2nd, and 3rd.

0 500 1000 1500 2000 2500 3000

(-) 1st 2nd 3rd

t r a n s l a t e d p r o t e i n s

cpm

5. Soluble scFv production and sequence analysis

The DNA selected after the fourth round was inserted into the expression vector, pCANTAB5E. Approximately 150 colonies were isolated and their respective soluble proteins were expressed. The periplasmic extracts from individual colonies were tested for production of antigen-specific scFvs by indirect ELISA (Fig. 15).

Several clones showed binding activity to TP-peptide. Among these clones, the four clones which exhibit the highest immunoreactivity with TP-peptide were isolated.

ELISA results showed that the isolated scFv clones also have binding activity to the functional human HBV DNA polymerase expressed by baculovirus expression system (Fig. 16).

The expression of each scFv was confirmed by Western blot analysis using anti-E tag antibodies (Fig. 17). Proteins of approximately 35 kDa in size were expressed from each of the four selected clones. The deduced amino acid sequences of these four scFvs are shown in Fig. 18. Using the DNA sequences, I designated the VH and Vk ge ne families of the clones based on Werner Müller’s database (http://www.dnaplot.de/input/mouse_v.html). The heavy chain of clones G6 and F7 belo nged to the VH1 gene family, that of clone G2 belonged to the VH3 gene family and that of the D10 clone belonged to the VH5 gene family. The light chain of clone G6 belonged to the Vk 21 group III subgroup, that of clone G2 belonged to the Vk 4/5 group IV subgroup and that of clones F7 and D10 belonged to the Vk 9B group V subgroup. Sequencing alignment using the Vector NTI software program showed

that the light chains of the F7 and D10 clones have very similar sequences (97%).

The linker sequence had some mutations, but the se were mostly silent mutations or did not influence protein structure to any great extent presumably. This result indicates that random mutation is introduced and intact scFv structures are selected by ribosome display.

Fig. 15. Isolation of scFvs after 4^th selection. The DNA selected after the fourth round was inserted into the expression vector, pCANTAB5E. Approximately 150 colonies were isolated and the periplasmic extracts from individual colonies were tested for production of antigen-specific scFvs by indirect ELISA. Several clones have binding activity to TP-peptide.

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7

1 14 27 40 53 66 79 92 105 118 131 144 Clones from 4th selection

Absorbance at 405 nm__

Fig. 16. Binding activity of selected anti-TP scFvs. After the 4th selection, selected scFv DNAs were cloned into the pCANTAB5E vector. The periplasmic extracts from each clone were tested for binding activity against TP-peptide and HBV DNA polymerase by ELISA. Full length HBV DNA polymerase (FPL-pol), TP-peptide, bovine serum albumin (BSA) and PBS were used to test the binding activity.

G6 G2 F7 D10 M

Fig. 17. Detection of the expressed anti-TP scFvs by Western blot. Four clones designated as F7, D10, G6 and G2, that had the highest signal in ELISA were selected and their expressions were confirmed by Western blotting. M: size marker, scFv protein size is arrowed.

47 83

32.5

6.5 16.5 25 kDa 175

Fig. 18. Alignment of the amino acid sequence of selected TP-specific scFvs. CDRs and (Gly4Ser)3 linker worked as box. The identical and conserved sequences in black and gray respectively are indicated. The labeling of CDRs was performed according to standard antibody engineering protocols.⁴³

IV. DISCUSSION

In this study, the slightly modified ribosome display using eukaryotic translation system was established. Anti-DNA antibody, 3D8 was specifically selected against ssDNA as a model system. The selected 3D8 RNAs sequences from translation complexes were recovered by RT-PCR. By applying this model system, TP-specific scFvs were selected and enriched from the immunized mouse library.

Four TP-specific scFv clones were selected and their sequences were analyzed.

These four scFvs showed intact scFv structure and specific binding activity to TP-peptide; three of them, the G6, G2, and D10 clones, also bound functional human HBV DNA polymerase in an ELISA. These selected anti- TP scFvs could be used in the future to further understand HBV replication.

In vitro display techniques have some potential advantages over in vivo display. These include ease of generation of larger libraries; fewer biases caused by cellular expression; and more facile application of round-by-round mutagenesis.

Ribosome display, one of the in vitro display methods, was achieved here using an in vitro transcription and translation process. These processes, which were based on Escherichia coli or rabbit reticulocyte system, have been described previously.^{17, 20} In these reports, functional scFvs were expressed and selected by ribosome display.

Since TP-peptide was poorly immunogenic, I needed a large library to obtain specific scFvs using the display method. Because the library size of a ribosome

display is not limited by transformation, antigen-specific scFvs would be more easily obtained from DNA libraries using ribosome display than by in vivo display methods.

A eukaryotic method was slightly modified from that described by He et al. and Makeyev et al.^{20, 33} In my work, the transcription and translation steps were carried out separately and the latter being performed using a rabbit reticulocyte system. By uncoupling transcription and translation, translation without a reducing agent was possible, and this could potentially result in greater functional expression of a single-chain antibody.⁴⁸ Translation using a rabbit reticulocyte system has some potential advantages over an E. coli ribosome display system in that the selection conditions are less complex due to lower RNase activity.¹⁵ Moreover, eukaryotic conditions might improve the translation and/or folding efficiency of some proteins.

Internal primers were used for the RT-PCR in this system. In principle, there should be no advantage to use an internal primer in ribosome display since mRNA is released from the complex before RT-PCR. However, the results are much better with an internal primer than with a 3' end primer (Fig. 12). If some of the ribosomes remained associated with mRNA after the dissociation procedure, this might inhibit the RT-PCR reaction. However, I treated the samples with EDTA and an RNA isolation kit to dissociate the mRNA from the ribosomes. Furthermore, little mRNA should remain associated with the ribosome after processing, as an RNA isolation kit was used originally for isolation from the cell. However, using nested PCR with internal primers seems to increase the sensitivity and specificity of repeated PCR of a library.

One advantage of ribosome display is the ease of generating larger libraries.

In this study, even after one round of selection, some portion of library was able to bind to the antigen, indicating that the library was of sufficient size. The selected anti-TP scFvs had higher immunogenecity than anti- TP clone s selected by phage display in direct comparison with periplasmic extracts³⁸ (Fig. 19). Notably, however, the selected antibody library was still diversified after four rounds of selection.

Although I observed antigen-specific gene recovery by RT-PCR and monitored the enrichment rate during the selecting procedure, our results suggest that four rounds may not be sufficient for complete selection. One reason may be that low temperature and RNase-free conditions are required to maintain the ARM complex, which hampers efficient selection in ribosome display. A modified ribosome display method, the ribosome- inactivation display system (RIDS), has been reported to have enhanced stability at room temperature, but has not yet been applied to selection

문서에서 Selection of Single Chain Variable Fragments Specific for HBV DNA Polymerase Using a Ribosome Display = An Event-Based Session Timeout Management Policy (페이지 49-0)