In vitro display - Selection of Single Chain Variable Fragments Specific for HBV DNA Polymerase

fusion protein is constructed in which the domain of interest is fused to a C-terminal

tether, such that this domain can fold while the tether is still in the ribosome tunnel.

This fusion construct lacks a stop codon at the mRNA level, thus preventing the release of mRNA and protein from the ribosome. High concentrations of magnesium and low temperature stabilize the ternary complex. In this system, relatively stable protein-ribosome- mRNA complexes, in which individual nascent proteins remain linked to their encoding mRNA, are formed by stalling ribosome at the end of translation. Protein- ribosome- mRNA linkage allows simultaneous selection of a desired protein and its encoding mRNA from a library (Fig. 3). The selected mRNA can then be converted into cDNA by reverse transcription reaction and amplified by polymerase chain reaction (PCR) (Fig. 4).

The size of a ribosome displa y library potentially very large, since the number of ribosome which can be concentrated into the given reaction volume is high. Thus, it should be possible to create very large libraries more quickly than for cell-dependent systems.

Ribosome display was first developed by Mattheakis et al. for the selection of peptides.³⁶ To produce a population of stalled polysomes, agents such as rifampicin or chloramphenicol, which block prokaryotic translation, were used. A pool of DNA sequences encoding 10¹² random decapeptides was applied for selection.¹² Selection of the antibody fragment was developed by two groups, Hanes and Pluckthun¹⁷ and He and Taussig²⁰. Hanes et al. int roduced additional features to prokaryotic system. One was the stalling of the ribosome through the absence of a stop codon. A number of additions were made to improve the yield of mRNA after

the polysome display cycle, including stem loop structures at the 5’ and 3’ ends of the mRNA, vanadyl ribonucleoside complexes as nuclease inhibitors, protein disulfide isomerase for folding of disulfide-bridged proteins, and an antisense nucleotide to inhibit ssrA RNA, which in the prokaryotic system causes release and degradation of proteins synthesized without stop codon. He et al. applied eukaryotic in vitro expression to ribosome display. This methods derives from two experimental results, namely the functional production of single chain antibodies in vitro in rabbit reticulocyte lysates⁴⁰ and in the absence of a stop codon, individual nascent proteins remain associated with their corresponding mRNA as stable ternary polypeptide-ribosome-mRNA complexes.^{8, 21} According to the Hanes et al., the rabbit reticulocyte lysate system gave rise to lower amounts of functional complexes, lower enrichment factors.¹⁵ However, because the lysate are commercially available and contain a lower intrinsic RNase activity, the use of this system is easier and more convenient than using prokaryotic in vitro expression system. And it is also possible that different proteins might be expressed with different efficiencies in the two translation systems.^{2, 3, 41}

In a model system using two distinct scFv fragments of an antibody, a 10⁹ -fold enrichment of a specific scFv over the nonspecific scFv was achieved by five selection cycles of ribosome display, with an average enrichment of 100 per cycle.¹⁷ In a library selection, ribosome display was applied to the selection and simultaneous evolution of a scFv fragment binding with 40 pM affinity to a Gcn3p mutant peptide, using a library prepared from the spleen of immunized mice.¹⁶ And Starting from the

human combinatorial antibody library HuCAL, picomolar affinity binders to insulin were selected and evolved during ribosome display selection.¹⁸ All selected antibodies had accumulated many mutations during the PCR amplification cycles which is included in the ribosome display protocol, and the affinity of the antibodies had improved up to 40- fold compared to the antibodies initially present in the library.

In a selection against an unusual DNA structure, namely the guanine quadruplex DNA, it was demo nstrated that antibodies with high specificity could be generated by ribosome display.⁵⁰ Ribosome display selection was applied also to human antibody library using transgenic mice.¹⁹ Progesterone-bovine serum albumin was immunized to transgenic mice carrying human immunoglobulin loci in order to develop human antibody response. Human antibody fragment library from the immunized mice was prepared by recombination. The library was expressed in vitro and selected against progesterone-BSA. Selected antibody fragment have the affinity of ~10^-8 M. The advantages of ribosome display are that, in comparison to phage display, larger libraries can be constructed without the transformation step, and the libraries can be further diversified by PCR during ribosome display.⁵ Ribosome display not only have applied for the selection for binding protein to a wide variety of target but also have great potential for the maturation of high-affinity protein binder and of protein stability.^{25, 26}

Fig. 4. The structure of antibody-ribosome-mRNA complex (ARM) complex.

The absence of stop codon prevents release of mRNA and nascent antibody from the ribosome. The constant region of light chain as a spacer region makes the single-chain antibody fold correctly.

ribosome

mRNA

Ck VH

Single -chain antibody

Translation of mRNA lacking stop codon

Fig. 5. Ribosome display cycle for antibody selection. A. DNA library encoding the antibody fragments. It has genetically fused to a tether, which allows the protein to fold while the tether is still in the ribosomal tunnel. B. in vitro transcription and translation. The resulting construct, which lacks a stop codon, is transcribed in vitro into mRNA and further translated in vitro. A ribosomal pausing is induced during the translation. That result in stable ternary complexes of antibody-ribosome- mRNA (ARM complexes) formed. C. Affinity selection against the antigen on the ELISA plate. The ARM complexes are directly used to select by binding assay on the immobilized target. The mRNA of the bound complexes is rescued by dissociating the ribosome with EDTA. D. RT-PCR. A reverse transcription reaction followed by PCR yields the genetic information of the selected clones. These clones can then be analyzed or used as input for the next selection round.

Purpose and summary of this study

In this study, I established the ribosome display and then selected useful TP-specific scFv by established ribosome display.

Although ribosome display has many advantages theoretically, only 4 reports have been published about antibody selection from a library using ribosome display.16, 18, 19, 50

Moreover, only one of them exploited a eukaryotic translation system.¹⁹ To select anti- TP antibody using ribosome display, it is necessary to establish ribosome display and to test that antibody selection by ribosome display using eukaryotic translation system works properly. After establishing ribosome display, anti-DNA antibody, 3D8 scFv that has binding activity to single stranded DNA (ssDNA), anti- TP scFv was selected from immunized mouse library. Synthetic TP-peptide was used to immunize mice for library construction. mRNA library was obtained from the spleen of the immunized mouse. Recombinant antibody library DNA was constructed by RT-PCR and assembly PCR reaction. From this library DNA, the antibody-ribosome-mRNA (ARM) complexes were prepared by in vitro transcription and in vitro translation. ARM complexes were specifically selected against TP-peptide. After enrichment of antibody library to the TP-peptide by four repeated selection, library was inserted to expression vector. The selected scFvs had binding affinity, for not only the TP-peptide, but also for functional HBV DNA polymerase protein expressed from baculovirus-infected insect cells.

The antibody selection by ribosome display using eukaryotic system was

established and this system was successfully applied to select TP-specific antibody from an antibody library.

II. MATERIALS AND METHODS

A. Model system for ribosome display

1. Construction of VH/ê antibody fragments used for the control reaction of ribosome display

As a model system for ribosome display, previously isolated ssDNA binding scFv (3D8) antibody fragment was used.³⁰ In order for the scFv fragments to be fold outside of the putative ribosomal tunnel, the kappa chain constant region was used as a spacer as schematically shown in Fig. 6. For in vitro transcription and translation, the construct contained the T7 promoter and Kozac sequence. For optimal analysis, such as ELISA, polyhistidine (His6) affinity tag was connected to the 5’ end of the construct. The construct was prepared by assembly PCR. The primers for construction were listed in Table 1. First, 3D8 scFv DNA and the constant region were amplified separately. The 3D8 scFv gene was amplified from pIg20 3D8 plasmid by using 10 pmole primer of 5’ HIS3D8/back (5’-GACCACCATGGACCATCATCATCATCATCATGAGGTCCAGCTGCAGCAG-3’) and 3’ 3D8/for (5’-GTTGGTGCAGCATCAGCCCGTTTTATTTCCAGCTTGGTC-3’) in a reaction volume of 50 ㎕ buffer [10 mM Tris-Hcl (pH 8.3), 40 mM potassium chloride, 10 mM DTT, 1.5 mM magnesium chloride] containing 2 U of

pfu DNA polymerase (Bioneer, Daejun, Korea). After 5 min of denaturation at 94 , samples were amplified for 25 cycles (1 min at 94℃, 1 min at 55℃ and 1 min at 72℃). For Ck DNA amplification, RNA was isolated from a mouse spleen. In brief, the spleen from BALB/c mouse was removed and the tissue was teased apart using either sterile forceps and then disrupt between microscope slides glass to produce a single cell suspension of lymphocytes and erythrocytes. Total RNA was extracted from the cell suspension by using RNA extraction kit (Amersham Biosciences, Piscataway, NJ, USA). First strand cDNAs were synthesized from prepared total RNA using superscript II RNaseH^-reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Ck DNA was amplified from the cDNA by using 10 pmole primer of 5’

Ck/back (5’-AAACGGGCTGATGCTGCA-3’) and 3’ Ck/for_XmaI (5’-TCCCCCCGGGCTCTAGAACACTCATTCCTGTTGGAGCT-3’) in a reaction volume of 50 ㎕ buffer (10 mM Tris-Hcl (pH 8.3); 40 mM potassium chloride; 10 mM DTT; 1.5 mM magnesium chloride) containing 2.5 U of Taq DNA polymerase (Bioneer Co). After 5 min of denaturation at 94 , samples were amplified for 25 cycles (1 cycle is 30 sec at 94℃, 30 sec at 55℃ and 30 sec at 72℃). 3D8/for and Ck/back primers are designed in such a way that both the scFv DNA at its 3’ end and the spacer DNA at its 5’ end contain an identical sequence of 18 nucleotides. The PCR fragments were purified by QIAexII gel extraction kit (Qiagen, Stanford Valencia, CA, USA) and used for assembly PCR. The assembly PCR was conducted in a 50 ㎕ PCR mixture containing 5U of pfu DNA polymerase for 25 cycles (1 cycle is 1 min at 94℃, 1 min at 55℃ and 1 min at 72℃) with the primer ST7/back and

Ck/for_XmaI. The amplified product was purified by gel extraction and cloning to pUC18. Amplified DNA fragment was cloned into SmaI (New England Biolabs, Beverly, MA, USA) of pUC18 vector. In brief, the amplified DNA fragment was mixed with pUC18 vector in 10 ㎕ of 1x ligation buffer and then incubated at 16 for overnight in the presence of 1 U of T4 DNA ligase (USB, Cleveland, OH, USA).

After the ligations mixture was transformed into E . coli DH5á. Five were picked and grown at 37℃ for overnight in 5 ㎖ of ampicillin containing LB broth. The plasmids were isolated using plasmid mini-prep kit (Bioneer) and sequenced with the ABI Perkin Elmer automated DNA sequencer (Applied Biosystems, Foster, CA, USA).

Using the pUC sequencing primer (5’-GTTTTCCCAGTCACGAC-3’) and the pUC reverse sequencing primer (5’-AGCGGATAACAATTTCACACAGGA-3’). The plasmid with expected sequences was digested with SmaI. The restricted DNA was extracted and purified by a subsequent ethanol precipitation for in vitro transcription.

Fig. 6. DNA structure used for ribosome display. A. T7 denotes the T7 promoter, ATG the protein initiation sequence, VH the variable region of heavy chain, Vk variable region of kappa chain, Ck the constant region of kappa chain that act as a spacer region connecting the folded protein to the ribosome. Large arrows indicate the transcriptional start and protein coding sequence. Small arrows are the primers used for this system. B. DNA sequence of promoter, transcription initiation site and translation initiation site used for ribosome display.

Table 1. Primers used for 3D8C VH/κ construct

A. Primers used to generate the 3D8 scFv DNA

T73D8 /back

5’-GCAGCTAATACGACTCACTATAGGAACAGACCGACCACCATGGA CCATC-3’

The T7 promoter sequence is underlined. Kozac sequence is indicated as box.

Hi s3D8/back

5’-GACCACCATGGACCATCATCATCATCATCATGAGGTCCAGCTGCA GCAG-3’

3D8/for

5’-GTTGGTGCAGCATCAGCCCGTTTTATTTCCAGCTTGGTC-3’

B. Primers used to generate the complete mouse kappa light chain

Ck/back

5’-AAACGGGCTGATGCTGCA-3’

Ck/for_XmaI

5’-TCCCCCCGGGCTCTAGAACACTCATTCCTGTTGGAGCT-3’

XmaI restriction enzyme site is underlined.

2. In vitro transcription of 3D8 VH/κ

3D8 VH/κ mRNA that encodes recombinant antibody that composed of 3D8 scFv and kappa chain constant region was obtained by in vitro transcription from the constructed structure. Briefly, approximately 500 ng of prepared DNA was added to the transcription mixture containing 10 ㎕ of 10 mM NTP mix (2.5 mM ATP, 2.5mM CTP, 2.5mM UTP, 1.25mM GTP; Invitrogen), 5 ㎕ of 10 mM RNA Capping analog, 2.5 ㎕ of 10 mM DTT, 40 U of RNase inhibitor (Invitrogen) and 30 U of T7 RNA polymerase (Bioneer). The mixture was incubated at 37℃ for 1 hr and the reaction was stopped by phenol/chloroform extraction. The transcripts were precipitated using 5 M ammonium acetate and dissolved in diethyl pyrocarbonate (DEPC)-treated water.

3. In vitro translation of 3D8 VH/κ

Flexi rabbit reticulocyte lysate (Promega, Madison, WI, USA) was used to in vitro translation reaction. About 5 ㎍ of 3D8 VH/ê RNA was denatured at 65℃ for 10 min. The reaction mixture containing 1.6 ㎕ of 2.5 M potassium chloride, 1.4 ㎕ of 25 mM magnesium chloride, 1 ㎕ of 1 mM methionine or [³⁵S] labeled methionine (Amersham Biosciences), 1 ㎕ of 1 mM amino acid mixture without methionine, 40 U of RNase inhibitor and 33 ㎕ of rabbit reticulocyte lysate was added to the prepared RNA, and incubated at 30℃ for 6 min. After in vitro translation, the

translated protein was detected by Western blot analysis using anti-His antibody or autoradiography for radiolabeled proteins. Five microliters of translated protein were suspended in 20 ㎕ of sample buffer (62.5 mM Tris pH 6.8; 10% glycerol; 10% 2-mercaptoethanol; 3% SDS and 0.1% bromophenol blue), boiled for 2 min prior to loading onto a gel. The prepared protein was subjected to SDS-PAGE on a 12%

polyacrylamide gel. After SDS-PAGE, the gel was either transferred to a nitrocellulose membrane (Schleichr & Schuell, Keene, NH, USA) for Western blot or fixed and dried for autoradiography. For Western blot analysis, the transblotted membrane was blocked for 1 hr at 25℃ with blocking solution (3% (w/v) bovine serum albumin in PBS) and then incubated for 1 hr at 25℃ with anti-His antibody (1:1,000 dilution with blocking solution; Qiagen). After washing, alkaline phosphatase conjugated goat anti- mouse IgG antibody was treated (1:2,000 dilution with blocking solution; Pierce, Rockford, IL, USA) for 1 hr at 25℃. BCIP/NBT (bromo-chloro- indolyl-phosphate/nitroblue tetrazolium chloride; Sigma-Aldrich, Milwaukee, MI, USA) was used as AP substrate to visualize immunoreactivity. For autoradiography, the gel was fixed in 7% acetic acid for 10 min and rinsed briefly in deinonized water. The gel was dried onto a piece of Whatman 3MM paper using a gel dryer and exposed to a X-ray film at -70℃ for overnight prior to development.

4. ELISA using translated 3D8 VH/κ

The binding activity of the translated 3D8 VH/κ to ssDNA was determined

by ELISA. Microtiter plates (Costar, High Wycombe, UK) were coated with 50 of l ssDNA solution (5 ㎍/㎖ in PBS) or PBS as negative control at 4℃ overnight. The coated plates were washed with PBS 3 times and blocked with 3 % (w/v) BSA in PBS for 1 h at 37℃. After washing with PBS, translated protein in ice-cold PBSM (PBS containing 5 mM magnesium chloride) was added and incubated for 1 hr at 4℃.

The wells were washed with PBST 3 times and then anti-His antibody (1:1,000;

Qiagen) as secondary antibody was added to each well. After incubation for 1hr at RT, the plate was washed 3 times with PBST. HRP-conjugated anti- mouse IgG antibody (Zymed Laboratories., South San Francisco, CA, USA) was reacted for 1h at RT. After washing as described above, 100 ㎕ of ABTS (2,2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid); Amersham Biosciences) substrate solution per well was added for measuring at A405 .

5. Ribosome display using 3D8 VH/κ

5.1. Affinity selection

Microtiter plates (Costar) were coated overnight at 4℃ with 50 ㎕ of ssDNA solution (5 ㎍/㎖ in PBS) or PBS as negative control. The coated plates were washed, blocked for 1 hr at 37℃, washed with PBSM 3 times, and incubated on ice for at least 10 min.

For in vitro translation of ribosome display, Flexi rabbit reticulocyte lysate

(Promega ) was used. The reaction mixture was prepared as described in Section 1.3.

The library mRNA was incubated for 5 min at 65℃, and then added to the in vitro translation reaction mixture. After 20 min of in vitro translation at 30℃, ice-cold buffer (PBS containing 5 mM magnesium chloride, and 1.5% (w/v) BSA) was immediately added to the mixture. This mixture was transferred to the prepared plate that coated with ssDNA and washed with PBSM. The plate was incubated for 1 hr in a cold room on ice. After three washes with ice-cold PBSTM (PBS containing 5 mM magnesium chloride, and 0.05% (v/v) Tween 20) and two washes with ice-cold PBSM, the retained ribosomal complexes were dissociated with 200 ㎕ of EB20 buffer (PBS containing 20 mM EDTA) for 10 min on ice. The mRNA was isolated from the eluted solution by an RNA isolation kit (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer’s instruction.

5.2. Reverse transcriptase-polymerase chain reaction (RT-PCR)

Selected mRNA was reverse transcribed to cDNA using superscript II RNaseH^-reverse transcriptase (Invitrogen). The elution buffer containing selected mRNA was denatured at 70℃ for 10 min and then added to final volume of 10 ㎕ of containing 2 ㎕ of 5× buffer, 1 ㎕ of 10 mM dNTP, 1 ㎕ of 10 mM DTT, 20 U of RNase inhibitor (Invitrogen), Ck/for primer (5’-GCTCTAGAACACTCATTCCTGT TGGAGCT-3’) and 0.5 ㎕ of superscript II RNaseH^-reverse transcriptase. The

reaction mixture was incubated at 42℃ for 1 hr and 70℃ for 15 min. The VH and linker region of 3D8 scFv was amplified in a 50 ㎕ PCR mixture containing 5 ㎕ of 10× buffer, 2 ㎕ of RT reaction mixture, 10 mM dNTP, 5 pmol of His3D8/back primer (Table 1) and 5 pmol of 3D8re/for (5’-CAGCCAGGGAGGATGGAGAC-3’) primer and 5 U of Taq DNA polymerase (Genesis, Daejun, Korea). After 5 min of denaturation at 95℃ for 2 min, sample was amplified for 30 cycles (1 cycle is 20 sec s at 95 , 40 sec at 55 , 1 min at 68 ). The reaction products were analyzed by electrophoresis in a 1% agarose gel.

B. TP-specific scFv selection by using ribosome display

1. Immunization of Mice

Biotinylated TP-peptide was prepared by chemical synthesis and has the sequence biotin-KVGNFTGLYSSTVPIFNPEWQTPS. Neutravidin (Sigma-Aldrich) was conjugated to TP-peptide as a carrier protein by the N terminally linked biotin.

Female BALB/c mice were given an intraperitoneal injection of conjugated protein (80 ㎍ of TP-peptide and 400 ㎍ of neutravidin), emulsified in the same amount of complete Freund’s adjuvant (Sigma-Aldrich), followed by one intraperitoneal injection with incomplete Freund’s adjuvant (Sigma-Aldrich) over a 3-week period.

The mice were boostered with an intraperitoneal injection twice at 2-week intervals.

Total 4 mice were immunized. The sera were collected for ELISA from their tails before euthanasia. A spleen from an immunized mouse that had the highest titer of sera was removed and cells were isolated.

2. Construction of VH/ê chain library and mRNA preparation

Splenic cells were prepared by the spleen from the immunized BALB/c mouse was removed and teasing apart using a sterile forceps, and squeezing between microscope slides. From these cells total RNA was extracted from this cell suspension using RNA extraction kit (Amersham Biosciences). The mRNA was

prepared from extracted total RNA using an oligo(dT)-cellulose column. DNAs encoding the mouse VH and VL chains were obtained as follows. The reaction mixture containing 10 ㎕ of 5× reaction buffer, 1 ㎕ of 10 mM dNTP mix, 2 ㎕ of 25mM magnesium sulfate, 10 pmol of 5’ primers T7Ab/back (5’- CAGCTAATACGACTCACTATAGGAACAGACCACCATG(GC)AGGT(GC)CA(G C)CTCGAG(GC)AGTCTGG-3’), 10 pmol of 3’ primer VH/for (5’- TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC-3’), 5 U of AMV reverse transcriptase and 5 U of Tfl DNA polymerase were used for amplification of DNA encoding VH. The reaction mixture was incubated at 48℃ for 45 min and then amplified 35 cycle of PCR reaction (1 cycle is 30 sec at 94℃, 1 min at 54℃, and 2 min at 68℃). Primers of Vk2/back (5’-GACATTGAGCTCACCCAGTCTCCA-3’) and Ck/for (5’-GCTCTAGAACACTCATTCCTGTTGGAGCT-3’) were used for amplification of DNA encoding the kappa chain of a mouse antibody. A 93-bp DNA linker (Amersham Biosciences), encoding (Gly4Ser)3, was amplified with primers LINKBACK GGGACCACGGTCACCGTCTCCTCA-3’) and LINKFOR (5’-TGGAGACTGGGTGAGCTCAATGTC-3’) using Taq polymerase (Genesis) with 25 cycles of PCR (1 cycle is 1 min at 94℃, 1 min at 55℃, and 1 min at 72℃). After gel purification with a QIAexII gel extraction kit (Qiagen), 15 ng of VH DNA, 20 ng of linker DNA, and 50 ng of kappa chain DNA were mixed with 25 ㎕ of PCR mixture containing 2.5 ㎕ of 10x buffer, 0.5 ㎕ of 10 mM dNTP mix and 5 U of Taq polymerase (Genesis). For joining the linker DNA with VH and k-chain DNA, reaction mixture was cycled 25 times (1 cycle is 1 min at 94℃, 2 min at 60℃, 2 min

at 72℃). For amplification of assembled DNA, 5 µl previous reaction product was subjected to PCR in a total volume of 50 ㎕ containing 1× reaction buffer, 0.2 mM dNTP, 10 pmol of 5’ primer T7/back, 10 pmol of 3’ primer Ck/for and 5 U Taq polymerase. The sample was amplified for 25 cycles in a DNA thermal cycler

문서에서 Selection of Single Chain Variable Fragments Specific for HBV DNA Polymerase Using a Ribosome Display = An Event-Based Session Timeout Management Policy (페이지 25-0)