• 검색 결과가 없습니다.

Effect of Anti-oxidant, Anti-inflammatory and Anti-invasive of PMA-induced Matrix Metalloproteinase (MMP-2) and MMP-9 Activities of Water Extract and Solvent Fractions of Saururus Chinensis

N/A
N/A
Protected

Academic year: 2021

Share "Effect of Anti-oxidant, Anti-inflammatory and Anti-invasive of PMA-induced Matrix Metalloproteinase (MMP-2) and MMP-9 Activities of Water Extract and Solvent Fractions of Saururus Chinensis"

Copied!
8
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

Effect of Anti-oxidant, Anti-inflammatory and Anti-invasive of PMA-induced Matrix Metalloproteinase (MMP-2) and MMP-9 Activities of Water Extract and Solvent Fractions of Saururus Chinensis

Jun-Ho Kim1 and Eun-Jung Kim2*

1Department of Fine Chemistry and New Materials, Sangji University, Wonju 220-702, Korea

2Department of Biomedical Laboratory Science, Sangji University, Wonju 220-702, Korea

Received February 16, 2016 /Revised April 7, 2016 /Accepted April 11, 2016

Saururus chinensis is a perennial plants, its flavonoid compound is known to exhibit anti-oxidative activity. This study was aimed to investigate the effect of Water Extract and Solvent Fractions of Saururus chinensis on antioxidant, anti-inflammatory and anti-invasive of Phorbol 12-myristate 13-acetate (PMA)-induced matrix metalloproteinase (MMP-2) and MMP-9 activities. Plant samples were fractio- nated into hexane, CHCl3, ethyl acetate, butanol, and water fractions, and each of these was assayed individually. The water fraction showed the highest extraction yield at 9.25%(w/w). Anti-oxidative ac- tivity was analyzed by DPPH assay. Cell viability was detected by the MTS assay. Anti-inflammatory activity was assayed by the nitric oxide (NO) production in mouse macrophage Raw 264.7 cells. The activity and mRNA expression of MMP-2 and MMP-9 in human oral squamous carcinoma YD-10B cells were examined by zymography and RT-PCR. As results, MMP-2/-9 activation was increased in PMA induced YD-10B cells. In PMA-treated YD-10B cells, the increased mRNA expression and protein activation of MMP-2/-9 were significantly inhibited in the ethyl acetate fraction. The ethyl acetate frac- tion showed the highest anti-oxidative activity at 73.38%. The ethyl acetate fraction at non-cytotoxic concentrations significantly exhibited the anti-inflammatory activity of Raw 264.7 cells in dose-depend- ent manner. In conclusion, these findings demonstrate that the ethyl acetate fraction obtained from a chinensis water extract potentiates a promising therapeutic anti-invasive agent and, therefore, as an anti-cancer drug for cancer prevention and therapy in oral cancer.

Key words : Anti-oxidant, anti-inflammatory, anti-invasive, matrix metalloproteinases, Saururus chinensis

*Corresponding author

*Tel : +82-33-738-7683, Fax : +82-33-738-7683

*E-mail : [email protected]

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Journal of Life Science 2016 Vol. 26. No. 5. 584~591 DOI : http://dx.doi.org/10.5352/JLS.2016.26.5.584

서 론

최근 식용이 가능하고 부작용이 적은 천연물을 이용한 건강 기능성 식품과 의약품 개발에 대한 관심이 증가하고 있다. 특 히 천연물에 함유된 폴리페놀(polyphenol)계 화합물은 다양 한 구조로 이루어져 있으며 항산화 활성을 나타내 암 및 심혈 관계 질환 같은 만성질병에 대한 효과가 높으며, 잎, 줄기, 뿌 리, 열매 등에 존재하는 것으로 알려져 있다.

종양을 비롯한 인체 만성질환 대부분을 유발하는 산화적 스트레스의 주요한 원인은 활성산소종(reactive oxygen spe- cies, ROS)이다. 적정농도의 ROS는 세포 내 신호전달의 2차 신호전달물질로서 작용하여 세포분열, 노화, 생존, 사멸 등 세 포의 항상성 유지에 중요한 역할을 한다. 그러나 ROS 수준이

조절되지 않았을 때에는 다양한 종류의 질환과 암을 일으키게 된다[26, 28]. 암 형성에 있어 염증과의 기능적 상관관계는 염 증세포에서 생산된 ROS 및 활성질소종(reactive nitrogen spe- cies, RNS)과도 밀접한 관계가 있는 것으로 밝혀지고 있다 [3,4]. 염증은 악성세포의 생존, 증식 및 전이를 촉진시키며, 적응면역반응을 파괴하고 호르몬과 약물에 대한 반응성을 변 화시킨다. 이에 따라 최근에는 염증과 면역반응, 종양이 기능 적 관계임이 인정되고 있다[7, 23].

암은 우리나라 환자의 사망원인 1위로, 암 중에서도 편평세 포암종은 가장 많은 부분을 차지하고 있으며 특히 구강 암에 서는 90% 이상을 차지하고 있다[27]. 암은 다단계의 발생과정 을 거친다고 알려져 있다. 이와 같은 이유로 암을 치료하거나 극복하는데 여전히 어려움이 있다. 그러므로 진행된 암의 치 료보다는 암 발생 전에 미리 예방하는 것이 가장 최선책이다.

천연물에 존재하는 파이토케미컬(phytochemicals)는 기존 항 암제에 비해 독성이 적은 안전한 화학물질로서 암을 예방하는 데 중요한 역할을 할 것으로 기대되고 있다[22, 24, 25].

기질 금속단백분해효소(matrix metalloproteinases, MMPs) 류는 조직의 분해 및 재형성과정, 동맹경화, 염증, 류마티스 관절염 그리고 종양의 침윤 및 전이 등과 같은 다양한 질환들

(2)

에 매우 중요한 역할을 하는 것으로 알려져 있다[1, 8, 12, 19].

특히 암 침윤(invasion)는 종양세포의 기저막(basement mem- brane, BM) 의 파괴와 세포외기질(extracellular matrix, ECM) 분해작용을 통해 진행되며, 이와 같은 작용에 MMP-2 (gelati- nase-A, 72 kDa)와 MMP-9 (gelatinase-B, 92 kDa)이 가장 핵심 적인 역할을 하는 것으로 이미 널리 알려져 있다[3, 20].

삼백초는 후추목(Piperales), 삼백초과(Saururaceae), 삼백초 속(Saururus)에 속하는 여러해살이풀로서 한국, 일본, 동남아 시아에 분포하며, 저습지에 군생하는 것으로 알려져 있다[5].

강력한 항산화 활성을 갖는 플라보노이드(flavonoid) 화합물 을 다량 포함하고 있는 것으로 알려져 있다[14]. 삼백초에 관한 연구를 통하여 항산화효과[11], 항염증효과[21], 항천식효과 [17] 및 항암효과[16] 등 다양한 약리 활성이 규명되고 있으나, 암 발생 또는 진행억제 약리작용 및 다양한 생리활성에 관한 기전 연구는 부족한 실정이다. 따라서 본 연구에서는 삼백초 의 물 추출물 및 유기용매 분획물의 항산화 효과, 항염증 효과 및 인간구강암세포주에서의 MMP-2와 MMP-9의 발현 및 활 성 억제에 의한 암 침윤 억제 효과를 조사하였다.

재료 및 방법

삼백초 물 추출물과 유기용매 분획물 조제

본 실험에서 사용한 삼백초(Saururus chinensis)는 국내산으 로 농협으로부터 구입하여 사용하였다. 삼백초 일정량에 20 배(wt/vol)의 증류수를 가하고 환류 냉각시키면서 3시간 동 안 가열 추출 후 흡입기를 이용하여 감압여과(Whattman, No. 1)하였다. 이 열수추출물을 같은 부피의 헥산(hexane), 클 로로포름(CHCl3), 에틸 아세테이트(Ethyl acetate), 부탄올 (butanol)로 차례로 3번씩 추출 후 각각의 추출물을 농축 시키 고, 마지막에 남은 물 층을 동결 건조하여 물 분획물을 얻었 다. 실험에 사용한 열수추출물 과 분획별 시료는 Dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA)와 증 류수에 1 mg/ml로 준비하여 항산화활성 측정에 사용하였고, 항염증 및 암 침윤억제 측정에는 100 mg/ml 농도로 사용하 였다.

전자공여능 측정

Blois [2] 및 Kim 등[15]의 방법에 따라 준비한 삼백초 추출 물과 분획물의 0.4 ml를 시험관에 넣고, 1×10-4 M의 1,1-di- phenyl-2-picrylhydrazyl (DPPH) ethanol 용액 5.6 ml을 가하 여 6 ml이 되도록 하였다. 이 혼합액을 4분간 반응시키고 다시 여과한 다음, 총 반응시간이 10분이 되면 525 nm에서 흡광도 를 측정하였다(UV-1201, Shimadzu Co., Japan). 전자공여능은 다음 식에 의해 산출하였다.

전자공여능={1-(O.D.시료 / O.D.증류수)}×100

세포 및 시약

RAW 264.7 마우스대식세포와 YD-10B 인간구강암세포는 한국세포주은행(Korea Cell Line Bank [KCLB], Seoul, Korea) 에서 분양 받아 사용하였다. 세포는 DMEM (Gibco-BRL, Life technologies Inc., Grand Island, New York, USA)배지에 10%

FBS (Gibco-BRL), 1% penicillin/streptomycin (Gibco-BRL)을 첨가하여 37℃, 5% CO2 조건의 배양기에서 계대 배양하였다.

1,1-diphenyl-2-picrylhydrazyl (DPPH), Griess reagent, Lipo- polysaccharides (LPS) 및 Phorbol 12-myristate 13-acetate (PMA)는 (Sigma-Aldrich, St. Louis, MO, USA)에서 구입하여 사용하였다.

Cell Viability assay

삼백초 추출물에 따른 세포독성을 조사하기 위해 Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan)을 이용하여 측정하였다. 96-well plate에 well (200 μl) 당 RAW 264.7 세포는 2×104개, YD-10B 세포는 5×103개의 수 로 접종하여 12시간 동안 배양한 후, 추출물 및 분획물을 적정 농도로 처리하였다. 그리고 추가적으로 37℃ 배양기에서 48시 간 동안 반응시킨 후, CCK-8 용액을 세포배양액에 10 μl/ well 을 첨가하고 3시간 동안 37℃ 배양기에서 반응하였다. 반응 후, microplate reader (Molecular Devices, Sunnydale, CA, USA)를 이용하여 450 nm에서 흡광도를 측정하였다.

Nitric oxide (NO) assay

생성된 NO의 양을 조사하기 위해 RAW 264.7 세포를 96- well plate에 5×104개/well (200 μl)의 수로 접종하고 12시간 동안 배양하였다. 그 다음 NO 생성을 유도하기 위해 1 ug/ml 농도 Lipopolysaccharide (LPS)를 1시간 전 처리하고, 추가적 으로 추출물 및 분획물 농도를 적정농도로 처리하고 37℃ 배 양기에서 24시간 동안 배양하였다. 배양 후, 세포 배양 상층액 과 Griess reagent (Sigma-Aldrich)을 1:1 비율로 반응시켜 실 온에서 15분 동안 반응한 후, microplate reader를 이용하여 540 nm에서 흡광도를 측정하였다.

Gelatin Zymography

100 ug/ml 농도의 삼백초 추출물 및 분획물과 0.5 uM 농도 의PMA을 단독 또는 동시에 처리된 혈청 없는 배지에서 YD- 10B (5×105) 세포를 24시간 동안 배양한 후, 배지를 모아 Cen- triprep YM-10 (Millipore, Billerica, MA, USA)을 사용하여 농 축하였다. 20 ug농도의 농축된 단백질은 non-reducing sam- ple buffer (0.5 M Tris-Cl pH 6.8, 5% SDS, 20% glycerol, 1%

bromphenol blue)와 함께 혼합하여 0.1% gelatin이 포함된 10% sodium dodecyl sulphate-polyacrylamide gel electro- phoresis (SDS-PAGE)에서 전기영동 하였다. 전기영동 후, washing buffer (50 mM Tris-Cl pH 7.5, 10 mM CaCl2, 2.5%

(3)

Table 1. Effects of solvent fractions obtained from a Saururus chinensis on free radical diphenylpicrylhydrazyl scav- enging activity

Sample Antioxidant activity

Water extract Hexane fraction Chloroform fraction Ethyl acetate fraction Butanol fraction H2O fraction

40.42±0.79 25.62±0.10 19.03±0.21 73.38±0.40 69.48±0.41 15.58±0.61

F-value 8410.89***

Values represent the Mean ± standard derivation (SD) from triplet repeat replication.

***p<0.001 (ANOVA followed by Duncan’s new multiple-range test).

Table 2. Primers for RT-PCR

Gene Primer sequence (5’-3’) Annealing temperature (℃) PCR product size (bp)

MMP-2 F: GCGACAAGAAGTATCGCTTC

R: TGCCAAGGTCAATGTCAGGA 58 390

MMP-9 F: CCATTTCGACGATGACGAGTT

R: CTTGTCGCTGTCAAAGTTCGAG 58 530

GAPDH F: GAAGGTGAAGGTCGGAGT

R: GAAGATGGTGATGGGATTTC 58 226

Triton X-100, 1.0 uM ZnCl2)로 SDS을 제거하고 incubation buffer (50 mM Tris-Cl pH 7.5, 10 mM CaCl2, 150 mM NaCl, 0.02% NaN3)로 37℃에서 18시간 동안 반응하였다. Gel은 Coomassie Brilliant Blue (7% glacial acetic acid, 40% Metha- nol, 0.25% coomassie blue)로 1시간 동안 염색한 후, destain- ing solution (7% glacial acetic acid, 40% Methanol)으로 탈색 하여 white band을 확인하였다.

Reverse transcription-polymerase chain reaction (RT-PCR)

세포로부터 TRIzol 시약(Invitrogen Co., Carlsbad, CA, USA)을 사용하여 총 RNA를 추출하였다. 1 ug의 RNA를 가지 고 ReverTra ACE PCR RT Master Mix Kit (TOYOBO Co., Osaka, Japan) 을 이용하여 PCR를 수행하였다. 본 실험에서는 MMP-2, MMP-9 및Glyceraldehyde-3-phosphate dehydroge- nase (GAPDH) primers (Table 2)을 사용하였고, Housekeep- ing 유전자인 GAPDH 유전자를 internal control로 사용하였 다. 증폭된 PCR 생성물은 ethidium bromide가 포함된 1.5%

agarose gel 에 전기영동 하여 UV light상에서 확인하였다.

Statistical Analysis

3회 반복 실험을 통하여 얻은 결과는 mean ± SD로 나타내 었으며, 각 실험군 간의 통계학적 분석은 Student t-test를 실시

하여 유의한 결과를 얻었다.

결과 및 고찰

용매별 분획물의 수득율

삼백초 300 g을 이용하여 얻은 열수추출물을 여러 가지 용 매로 분획화하고 분획물의 수득율을 확인한 결과, n-hexane 추출물 0.04%, CHCl3 추출물 0.29%, ethyl acetate 추출물 0.78

%, n-butanol 추출물 2.25%, H2O 추출물 9.25%로, 물 분획물의 수득율이 가장 높았다.

항산화 효과

ROS 는 정상적으로는 세포의 중요한 신호전달체계를 활성 화시켜 항상성을 유지시키는 반면에, 항상성이 조절되지 않을 때에는 비정상적인 기능에 의해 종양을 비롯한 인체 다양한 질환 대부분을 일으키는 주요한 원인이 된다[2, 3]. 따라서 최 근에는 ROS를 제거하는 능력인 항산화 능력을 가진 천연 소 재에 대한 연구가 활발히 증대되고 있다. 본 연구에서는 삼백 초 추출물과 분획물을 가지고DPPH를 환원시키는 능력을 측 정하여 항산화효과를 조사하였다. 전자 공여능에 이용되는 DPPH는 화학적으로 안정된 자유라디칼형태로서 본래는 자 주색을 띄고 있으며 반응에 의해 자유라디칼이 제거됨에 따라 색이 옅어지는 정도를 측정하는 것으로 지질과산화반응의 억 제 정도에 따른 항산화 활성 측정에도 적용되기 때문에 신뢰 성이 높은 항산화 능력 측정법이다[2, 15].

측정결과 에틸 아세테이트 분획물이 73.38%의 가장 높은 항산화 효과를 함유하고 있었으며, 그 다음으로는 부탄올 분 획물이 69.48%의 높은 항산화 효과을 나타냈다(Table 1). 이와 같은 결과를 바탕으로 본 연구에서는 삼백초의 물 추출에 의 한 에틸 아세테이트 분획물과 부탄올 분획물에서 항산화 물질 이 다량 함유되어 있음을 확인할 수 있었다. 이는 삼백초 추출 에틸 아세테이트 분획이 가장 높은 항산화 활성을 보인다는 Kang등의 기존 보고[10]를 뒷받침하고 있다.

마우스 대식세포 Raw 264.7에 대한 세포독성 효과 삼백초 추출물 및 분획물의 마우스 대식세포주인 Raw 264.7세포에 대한 세포 독성 효과를 조사하기 위해, LPS 단독

(4)

A B

C D

E F

Fig. 1. In vitro cytotoxicity effects of solvent frac- tions obtained from a Saururus chinensis wa- ter extract in RAW 264.7 cells. The cells were treated with solvent fractions obtained from a S. chinensis water extract at different concentrations for 48 hr. Data represent the mean ± S.D. of three independent experi- ments. (A) WE: Water extract. (B) Hx:

Hexane fraction. (C) B: Butanol fraction. (D) CF: Chloroform fraction. (E) DW: H2O fraction. (F) EA: Ethyl acetate fraction. (*;

p<0.05 compared with untreated control, **;

p<0.01 compared with untreated control).

그리고 LPS와 다양한 농도로 함께 처리하여 24시간 동안 반응 하였다. 그 결과 대조군과 비교했을 때, 물 추출물, 부탄올 및 물 분획물은 100 ug/ml농도에서55.28%, 74.7% 및 71.47%, 10 ug/ml농도에서는 77.80%, 75.35% 및 71.81%의 생존율을 보였 으며 그리고 헥산, 클로로포름, 에틸 아세테이트 분획물은 10 ug/ml농도에서 51.22%, 64.86% 및 77.48%, 0.1 ug/ml농도에 서는 77.24%, 71.30% 및85.88%의 생존율을 나타냈다(Fig. 1).

이와 같은 결과에서 물 추출물과 헥산 분획물은 고농도에서 50% 정도로 낮은 생존율과 함께 농도 의존적으로 유의하게 세포 성장이 억제됨을 알 수 있었고, 부탄올, 에틸 아세테이트 및 물 분획물은 모든 농도에서 70% 이상의 생존율을 보였다.

따라서 본 연구에서는 세포성장에 영향을 주지 않는 70% 이상 의 생존율을 보이는 삼백초 추출물 및 분획물의 농도를 기준 으로 항산화 및 항염증 효과를 관찰하였다.

Nitric Oxide (NO) 생성에 미치는 효과

대식세포(Macrophage cells)는 외부 침입한 세균들의 세포 구성 성분이나 면역세포에서 분비된 cytokines에 의해 활성화 되어 tumor necrosis factor-α (TNF-α), nitric oxide (NO), prostaglandin E2 (PGE2) 등과 같은 물질의 분비를 조절한다.

NO는 활성산소종의 하나로, 정상적으로는 세포 내에서 세포 신호 전달을 통한 항상성 기능 조절에 관여하나, 체내 염증과

정에서는nitric oxide synthase (iNOS)에 의해 과량의 NO가 생성되어 주변조직의 손상을 유도하고, 만성염증을 유발한다 고 알려져 있다[6].

본 연구에서는 삼백초 추출물 및 분획물들의 항염증 효과을 조사하기 위해, 마우스 대식세포주인 Raw 264.7세포에 1 ug/

ml농도의 LPS를 처리하여 대식세포를 활성화시켜 염증을 유 발시킨 후, 다양한 농도의 시료들을 24시간 동안 처리하여 염 증 정도의 지표인 NO생성능을 측정하였다. 그 결과, 에틸 아 세테이트 분획물에서는 LPS를 함께 처리했을 때, 0.1, 1 및 10 ug/ml의 모든 농도에서 양성대조군인 LPS 단독 처리군에 비 해 1.6, 2.0 및 2.2배의 높은 NO 생성 억제를 보였으며, 클로로 포름 분획물에서는 0.1 ug/ml 농도에서 1.5배의 NO 생성 억 제, 헥산 분획물에서는 0.1 ug/ml 농도에서 1.5배의 NO 생성 억제, 부탄올 분획물에서는 1, 10 및 100 ug/ml 농도에서 2.0, 2.2 및 2.5배의 NO 생성 억제, 물 분획물에서는 1, 10 및 100 ug/ml 농도에서 1.5, 2.2 및 2.0배의 NO 생성 억제, 그리고 물 추출물에서는 1, 10 ug/ml 농도에서 2.1, 2.1배의 NO 생성 이 억제됨을 확인하였다. 이와 같은 결과들을 바탕으로 LPS 단독 처리군은 대조군에 비해 NO생성은 5배 정도 현저히 증 가하였고, 각각의 추출물 및 분획물은 세포 성장에 영향을 주 지 않는 농도에서LPS 단독 처리군에 비해 유의하게 낮은 NO 생성능을 보였다(Fig. 2).

(5)

A B

C D

E F

Fig. 2. Inhibitory effects of solvent fractions obtained from a Saururus chinensis a water extract on LPS-induced NO production in RAW 264.7 cells. The cells were incubated for 24 hr with LPS in presence or absence of in- dicated concentrations of solvent fractions obtained from a S. chinensis water extract. Data represent the mean ± S.D. of three independent experiments. (A) WE: Water extract.

(B) He: Hexane fraction. (C) B:

Butanol fraction. (D) CF: Chloro- form fraction. (E) DW: H2O fraction.

(F) EA: Ethyl acetate fraction. (*;

p<0.05 versus only LPS-treated group,

**; p<0.01 versus only LPS-treated group).

A B

C D

E F

Fig. 3. In vitro Cytotoxicity effects of sol- vent fractions obtained from a Saururus chinensis water extract in YD-10B cells. YD-10B cells were treated with solvent frac- tions obtained from a S. chinensis water extract at different concen- trations for 48 hr. Data represent the mean ± S.D. of three in- dependent experiments. (A) WE:

Water extract. (B) Hx: Hexane fraction. (C) B: Butanol fraction.

(D) CF: Chloroform fraction. (E) DW: H2O fraction. (F) EA: Ethyl acetate fraction. (*; p<0.05 com- pared with untreated control, **;

p<0.01 compared with untreated control).

(6)

A

B C

Fig. 4. Effect of solvent fractions obtained from a Saururus chinensis on mRNA expression of MMP-2/9 in PMA-treated YD-10B cells. YD-10B cells were treated with the indicated concentration (100 ug/ml) of solvent fractions obtained from a S. chinensis water extract 2 hr prior to PMA (0.5 uM) stimulation. (A) 24 hr later, the levels of MMP-2/9 mRNA were determined by RT-PCR. GAPDH were used as the internal control. (B, C) The relative expressions of MMP-2/9 mRNA were analyzed the band intensity using a GelQuant.NET program. WE: Water extract, Hx: Hexane fraction, CF: Chloroform fraction, EA:

Ethyl acetate fraction, B: Butanol fraction, DW: H2O fraction.

인간구강암세포(YD-10B)에서의 세포독성 효과

Oral Squamous cell carcinoma (구강편평세포암종, OSCC) 은 암의 가장 흔한 형태로서 90% 이상을 차지하고 있다[27].

또한 다른 암과는 다르게 구강암은 조기 발견과 치료 및 예방 효과를 육안적으로 관찰하기에 용이하여 암 예방을 위한 가장 좋은 모델로 인정받고 있다. 본 연구에서 사용된 YD-10B 세포 는 Yook et al. [25]에 의해 처음 확립되었고, Kim et al. [13]

및 Hwang et al. [9]들에 의하여 종양형성, 암 침윤 및 암 전이 와 연관성이 있음을 이미 보고되었다.

YD-10B 세포에서 삼백초 추출물 및 분획물들의 세포독성 효과를 조사하기 위해, 시료들을 다양한 농도로 함께 처리하 여 48시간동안 반응하였다. 그 결과 대조군과 비교했을 때,

100 ug/ml 농도 처리에서 물 추출물, 에틸 아세테이트, 부탄올 및 물 분획물은 82.82%, 70.67%, 82.13% 및 85.43%로 모두 70%

이상의 생존율을 보였으며, 헥산과 클로로포름 분획물은 61.80%와 68.89%로 낮은 생존율을 나타냈다(Fig. 3). 이와 같은 결과를 바탕으로 물 추출물, 에틸 아세테이트, 부탄올 및 물 분획물은 YD-10B 세포의 생존율에 영향을 미치지 않음을 알 수 있었고, 헥산과 클로로포름 분획물은 YD-10B 세포의 증식 억제 효과를 보임을 알 수 있었다. 그러므로 삼백초 추출물 및 분획물들 중에서 물 추출물, 에팉아세트, 부탄올 및 물 분획 물들이 YD-10B 구강암세포를 이용한 암 침윤성과 연관된 MMP-2와 MMP-9에 미치는 효능 연구를 위한 유효한 물질임 을 알 수 있었다.

(7)

Fig. 5. Effect of solvent fractions obtained from a S. chinensis on the activities of MMP-2/9 in PMA-treated YD-10B cells. YD-10B cells were treated with the indicated con- centration (100 ug/ml) of solvent fractions obtained from a S. chinensis water extract 2 hr prior to PMA (0.5 uM) stimulation. 24 hr later, the activities of MMP-2/9 protein in the conditioned media were determined by gelatin zymography. WE: Water extract, Hx: Hexane fraction, CF: Chloroform fraction, EA: Ethyl acetate frac- tion, B: Butanol fraction, DW: H2O fraction.

인간구강암세포(YD-10B)에서의 MMP-2와 MMP-9의 발 현 및 활성 억제 효과

본 연구에서는 삼백초 추출물 및 분획물들의 YD-10B 인간 구강암세포에서 PMA에 의한 암 침윤 및 MMP-2와 MMP-9 활성 증가에 미치는 효과를 조사하였다. 이를 위하여 100 ug/

ml 농도의 삼백초 추출물 및 분획물과 0.5 uM 농도의 PMA을 단독 또는 동시에 처리하여 YD-10B 세포를 혈청 없는 배지에 서 배양하였다. 그리고 24 시간 동안 배양한 후, 배지의 상층액 은 gelatin zymography법을 통해 MMP-2 및 MMP-9 단백질 의 활성을 관찰하였고, 배양된 세포에서는 RT-PCR법을이용 하여 MMP-2 및 MMP-9 mRNA 발현을 분석하였다. 그 결과 는 Fig. 3. 그리고 Fig. 4에서 나타난 것처럼, PMA를 단독 처리 한 세포에서는 아무것도 처리하지 않은 세포에 비해 MMP-2 및 MMP-9의 단백질 활성 및 mRNA 발현이 모두 뚜렷하게 증가하였으며, 이는 기존의 PMA에 의한 암세포에서의 MMP- 2/-9에 대한 연구와 유사한 결과이다[4, 9]. 본 연구 결과에서 는 PMA와 삼백초 추출물 및 분획물을 동시 처리한 세포에서 에틸 아세테이트 분획물이 PMA에 의해 유도된 MMP-2 및 MMP-9의 단백질 활성 및 mRNA 발현 모두에서 가장 뚜렷하 게 억제하였고, 그 다음으로는 물 추출물이 유의하게 억제함 을 알 수 있었다.

결 론

삼백초의 물 추출물과 유기용매 분획물의 항산화 효과, 항 염증 효과 및 인간구강암세포, YD-10B 세포에서의 MMP-2와 MMP-9의 발현 및 활성 억제에 의한 암 침윤 억제 효과를 확인 하였다. 본 연구를 통하여 삼백초 추출 에틸 아세테이트 분획 물은 가장 우수한 항산화 및 항염증 작용을 보였으며 또한 YD-10B 구강암세포에서 MMP-2 및 MMP-9의 발현과 활성을 억제함으로써 암 침윤을 억제하는 것으로 나타났다. 이와 같

은 본 연구 결과는 구강 암의 예방 및 치료를 위한 항암제로서 의 가능성을 암시하고 있다. 하지만 향후 다양한 암세포주와 in vivo에서의 항암작용과 이들에 대한 기전 연구가 추가적으 로 더 필요할 것으로 사료된다.

References

1. Back, M., Ketelhuth, D. F. and Agewall, S. 2010. Matrix met- alloproteinases in atherothrombosis. Prog. Cardiovasc. Dis.

52, 410-428.

2. Blois, M. S. 1958. Antioxidant determinations by the use of a stale free radical. Nature 181, 1119-1120.

3. Chernov, A. V. and Strongin, A. Y. 2011. Epigenetic regu- lation of matrix metalloproteinases and their collagen sub- strates in cancer. Biomol. Concepts 2, 135-147.

4. Choi, Y. H. and Kim, S. O. 2012. Grnistein suppresses TPA-induced matrix metalloproteinases activity and cell in- vasion in human breast adenocarcinoma cells. J. Life Sci. 22, 964-969.

5. Chung, B. S. and Shin, M. G. 1990. Dictionary of Korean Folk Medicine. Young Lim Sa, Seoul, pp. 813-814.

6. Coleman, J. W. 2001. Nitric oxide in immunity and in- flammation. Int. Immnopharmacol. 1, 1397-1406.

7. Grivennikov, S. I., Greten, F. R. and Karin, M. 2010.

Immunity, inflammation, and cancer. Cell 140, 883-899.

8. Hadler-Olsen, E., Fadnes, B., Sylte, I., Uhlin-Hansen, L. and Winberg, J. O. 2011. Regulation of matrix metalloproteinases in health and disease. FEBS J. 278, 28-45.

9. Hwang, Y. S., Park, K. K. and Chung, W. Y. 2012. Kalopa- naxsaponin a inhibits the invasion of human oral squamous cell carcinoma by reducing metalloproteinase-9 mRNA sta- bility and protein trafficking. Biol. Pharm. Bull. 35, 289-300.

10. Kang, C. S., Lee, M. J., Park, C. B. and Bang, I. S. 2012.

Study on the antioxidative and physiological activities of Saururus chinensis. J. Life Sci. 22, 807-814.

11. Kang, T. H., Cho, H., Oh, H., Sohn, D. H. and Kim, Y. C.

2005. Flavonol glycosides with free radical scavenging activ- ity of Saururus chinensis. Fitoterapia 76, 115-117.

12. Kieseier, B. C., Seifert, T., Giovannoni, G. and Hartung, H.

P. 1999. Matrix metalloproteinases in inflammatory demyeli- nation. Neurology 53, 20-25.

13. Kim, E. J., Che, Z. M., Park, Y. J., Hwang, Y. S., Kim, K.

Y., Jung, D. W., Jeon, N. K., Choi, Y. W., Lee, E. J. and Kim, J. 2009. Morphogenesis and biological significance of spindle cell transformation in a spindle cell carcinoma.

Cancer Lett. 275, 61-71.

14. Kim, S. K., Ban, S. Y., Kim, J. S. and Chung, S. K. 2005.

Change of antioxidant activity and antioxidant compounds in Saururus chinensis by extraction conditions. J. Kor. Soc.

Appl. Biol. Chem. 48, 89-92.

15. Kim, Y. J., Kim, C. K. and Kwon, Y. J. 1997. Isolation of antioxidative components of Perillae semen. Kor. J. Food Sci.

Technol. 29, 38-43.

16. Lee, A. Y., Han, Y. A., Kim, J. E., Hong, S. H., Park, E. J.

and Cho, M. H. 2015. Saururus chinensis Baill induces apop-

(8)

초록:삼백초 물 추출물과 유기용매 분획물의 항산화, 항염증 및 PMA에 의해 유도된 MMP-2 및 MMP-9활성 침윤 억제 효과

김준호1․김은정2*

(1상지대학교 정밀화학신소재학과, 2상지대학교 임상병리학과)

삼백초는 항산화 활성을 갖는 플라보노이드 화합물을 포함하고 있는 여러해살이 식물로 알려져 있다. 본 연구 에서는 삼백초 물 추출물과 유기용매 분획물의 항산화 활성, 항염증 활성 및 PMA에 의해 유도된 MMP-2 및 MMP-9활성 억제 효과를 조사하였다. 시료들은 삼백초 물 추출을 헥산(hexane), 클로로포름(CHCl3), 에틸 아세테 이트(Ethyl acetate), 부탄올(butanol) 및 물(water)과 같은 용매로 분획화하여 사용하였고, 물 분획물의 수득율이 9.25%로 가장 높았다. 항산화 활성은 DPPH assay, 세포 생존율 측정은 MTS assay, 항염증 활성은 마우스 대식세 포 Raw 264.7세포에서NO 생성 그리고 MMP-2 및 MMP-9의 mRNA 발현 및 단백질 활성 억제는 인간구강편평세 포암종 YD-10B 세포에서 RT-PCR과 zymography방법을 통해 측정하였다. 본 연구의 결과에 의하면 MMP-2/-9 활성은 PMA에 의해 YD-10B세포에서 증가하였다. PMA 처리된 YD-10B 세포에서, 에틸 아세테이트 분획물이 증 가된 MMP-2/-9의 mRNA 발현 및 단백질 활성을 유의하게 억제하였다. 그리고 항산화 활성도 에틸아세트 분획물 이 73.38%의 가장 높게 나타났다. 또한 세포 독성을 나타내지 않는 농도에서, 에틸아세트 분획물이 Raw 264.7세포 에서 농도 의존적으로 유의하게 항염증 활성을 보였다. 그러므로 본 연구에서는 삼백초 물 추출의 에틸아세트 분획물이 구강암의 암 침윤을 억제할 수 있는 효과적인 암 예방 및 치료를 위한 항암제로서의 가능성을 암시하고 있다.

tosis through endoplasmic reticulum stress in HepG2 hep- atocellular carcinoma cells. Food Chem. Toxicol. 83, 183- 192.

17. Lee, E., Haa, K., Yook, J. M., Jin, M. H., Seo, C. S., Son, K. H., Kim, H. P., Bas, K. H., Kan, S. S., Son, J. K. and Chang, H. W. 2006. Anti-asthmatic activity of an ethanol extract from Saururus chinensis. Biol. Pharm. Bull. 29, 211-215.

18. Lee, E. J., Kim, J., Lee, S. A., Kim, E. J., Chun, Y. C., Ryu, M. H. and Yook, J. I. 2005. Characterization of newly estab- lished oral cancer cell lines derived from six squmous cell carcinoma and two epidermoid carcinoma cells. Exp. Mol.

Med. 37, 379-390.

19. Mignatti, P. and Fifkin, D. B. 1993. Biology and biochemistry of proteinases in tumor invasion. Physiol. Rev. 73, 161-195.

20. Mook, O. R., Frederiks, W. M. and Van Noorden, C. J. 2004.

The role of gelatinases in colorectal cancer progession and metastasis. Biochem. Biophys. Acta 1705, 69-89.

21. Park, H. C., Be, H. B., Jeong, C. W., Lee, S. H., Jeung, H.

J. and Kwak, S. H. 2012. Effect of manassantin B, a lignin isolated from Saururus chinensis on lipopolysaccharide-in- duced interleukin-1β in RAW 264.7 cells. Kor. J. Anesthesiol.

62, 161-165.

22. Pezzuto, J. M. 1997. Plant-derived anticancer agents.

Biochem. Pharmacol. 53, 121-133.

23. Reuter, S., Gupta, S. C., Chaturvedi, M. M. and Aggarwal, B. B. 2010. Oxidative stress, inflammation, and cancer. Free Radic. Biol. Med. 49, 1603-1616.

24. Salagami, H., Kobayashi, M., Chien, C. H., Kanegae, H. and Kavase, M. 2007. Selective toxicityand type of cell death in- duced by various natural and synthetic compounds in oral squamous cell carcinoma. In Vivo 21, 311-320.

25. Shin, H. K., Kim, J., Lee, E. J. and Kim, S. H. 2010. Inhibitory effect of curcumin on motility of human oral squamous car- cinoma YD-10B cells via suppression of ERK and NF-kB activations. Phototherapy Res. 24, 577-582.

26. Shouval, R. S. and Elazar, Z. 2007. ROS, mitochondria and the regulation of autophagy. Trends Cell Biol. 17, 422-427.

27. Sudbo, J., Bryne, M., Mal, L., Lotan, R., Reith, A. and Kildal, W. 2003. Molecular based treatment of oral cancer. Oral Oncol. 39, 749-758.

28. Wink, D. A., Hines, H. B., Cheng, R. Y. S., Swizer, C. H., Santana, W. F., Vitek, M. P., Ridnour, L. A. and Colton, C.

A. 2011. Nitric oxide and redox mechanism in the immune response. Free Radic. Biol. Med. 89, 873-891.

수치

Table  2.  Primers  for  RT-PCR
Fig.  1.  In  vitro  cytotoxicity  effects  of  solvent  frac- frac-tions  obtained  from  a  Saururus  chinensis   wa-ter  extract  in  RAW  264.7  cells
Fig.  2.  Inhibitory  effects  of  solvent  fractions  obtained  from  a  Saururus  chinensis  a  water  extract  on  LPS-induced  NO  production  in  RAW  264.7  cells
Fig.  4.  Effect  of  solvent  fractions  obtained  from  a  Saururus  chinensis  on  mRNA  expression  of  MMP-2/9  in  PMA-treated  YD-10B  cells
+2

참조

관련 문서

1 John Owen, Justification by Faith Alone, in The Works of John Owen, ed. John Bolt, trans. Scott Clark, &#34;Do This and Live: Christ's Active Obedience as the

Keywords: Anti-Soviet &amp; Anti-Communist Movement, North Korea, Sinuiju Incident, Anti-Trusteeship Movement, Land Reform, Provincial, City and County People's

In this study, sequential solvent fractions of hot water extract and 70% ethanol extract were prepared from domestic (Imsil region) and foreign (Chile

Anti-fungal effect of isolated bactrial strains was tested in vitro by incubating in potato dextrose agar with isolates of four fungal plant pathogens

Objectives: This study aimed to investigate the relationship between job stress and turnover intention of employed opticians and to investigate the mediating effect of burnout

Oxidative injury and inflamma- tory periodontal disease: The challenge of anti-oxidants to free radicals and reactive oxygen species.. The role of oxygen and

Pro-allergic cytokines were important mediators of allergic inflammation, cell recruitment and allergenic response decided to further investigate the

This study researched the possibility of using natural products for hair growth agents and hair loss prevention materials based on the test for the antioxidant and