Expression of galectin-3 in rat brain

(1)

83

^*

1

(: 2004 2 7)

Expression of galectin-3 in rat brain

Yoo-Kyoung Lee¹, Hae Eun Kang, and Hee Jong Woo*

Laboratory of Immunology, College of Veterinary Medicine, Seoul National University, Seoul 151-742, Korea

1Korea Food & Drug Administration, Seoul 122-704, Korea (Accepted February 7, 2004)

Abstract : Galectin family, endogenous β-galactoside-binding animal lectins, is known for the role in cell differentiation, morphogenesis, apoptosis and tumorigenesis. Galectin-3, one of family member, has been studied for its role in cell differentiation and tumor metastasis, and for its expression on epithelial cells of colon and mast cells but not in brain. Several reports, however, suggest its expression in brain including as a prion binding protein. In this report we explored possibility of galectin-3 expression in brain tissue.

With Western blot and RT-PCR with rat brain tissues, we could detect galectin-3 that was not shown by conventional immunohistochemistry. Our results indicated galectin-3 was expressed in brain, and substantiate the previous report on galecin-3 as a prion-related protein in brain.

Key words : galectin-3, brain, prion binding protein, RT-PCR

Galectin family β-glactoside-binding lectin

, , !

"#$ %&. '()* '+, 14-. galectin / 0123, 4 35 galectin, 6 galectin-1, 3, 4

78 9: ;< =>? @A13 %& [1-4, 15].

Thioglycollate BCD macrophage EF /0 D galectin-3 [10] G H I IJK 26-

35 kDa monomer L MN3 /HOL P

QR ST UV -WCX -W Y G HY ! "#$ %!Z, 9: laminin

9[! \] ! "#$ %& [17, 29, 30]. Galectin-3 ^_O< @CT ` ab1c %!Z - L de fS1c mouse, rat, MN3 human a 3D galectin-3 ^_OR '( /0D hamster

galectin-3 ^_O< gh ij 80% T dek

a3 %& [3, 5, 11].

Galectin-3 lm n opq 6, O R g r IZ, s, tr IuD& [22, 28]. Hb mvCwxy m galectin-3 BC D tissue macrophages, dendritic cells, alveolar cells s Kupper cells k z, macrophage {| R [8] +C, }, ~ T &K / 1Z s, IuD& [12, 16]. m UV o / 4 [f 9[ / a31c %! [3], S T 1* & [8]. q galectin-3 mvxy , k Hj! dorsal root ganglion neuronsk [19] t, }

/1* S 1c %&.

Galectin-3 O g fhC RS cZ, g CBP70R \]1c %!

lactose ? galectin-3 RNAX \]3 CBP70< 1c %H galectin-3

*Corresponding author: Hee Jong Woo

Laboratory of Immunology, College of Veterinary Medicine, Seoul National University, Seoul 151-742, Korea [Tel: +82-2-880-1262, Fax: +82-2-877-8284, E-mail: [email protected]]

(2)

N-terminal hnRNPX de, >U ! T3

%& [23, 27]. s, galectin-3 nuclear ribonucleoprotein R ] prion protein (PrP) mRNAX \ ] ^_O a312& [24]. MG g

galectin-3? prion / PQ ! 1Z pre-mRNA substrate PQ splicing

z!¡ mRNA processingR ¢D ! S13

%& [7]. s, scrapie £xD hamster UV

pre-mRNAX \]D galectin-3? /0123 [20], t

r 68 kDa laminin binding proteins? prion \] ^ _! a313 %& [25].

q ¤ => *¥)* /1* & Hb =>\R } prion

\]^_! PQH ¦8 galectin-3? UV

/1c§ ,& ¨ RT-PCR R Western blot analysis Qz! Hb mv xy©! *

¥)* ªf* «¬ UV galectin-3 /k ªf®&.

¯ 5-6°± Sprague-Dawley - i² rat X

~UV RNA H ¦8 acid guanidium thiocyanate-phenol-chloroformk eQ®& [6].

D RNA ethidium bromide? ?D 1% agarose gel

YH³ IN, ¯ OD260 ´µr S

SK®&. RNA &¶ ·¸ ¹º %c eQ D ».iX ¼JH>< diethylpyrocarbonate EN , ¯ eQ®&.

RT-PCRk | galectin-3 9, RNA

H ¦8 ½½ 9[f xH¾ oligonucleotide primer

k 3¿(Table 1), ] Q®&. ½½ senseX antisense primer k U®!Z P< Takarae (Shiga, Japan) À®&.

Reverse transcription solution (dNTP 2 mM, random

primer, MgCl2 1.5 mM, reverse transcriptase, RNase inhibitor) RNA ?, ¯, 25^oC 15IL, 42^oC

60IL, 94^oC 5IL ÁÂ cDNA ]

®&.

PCR< thermal cycler (Perkin Elmer, USA) Q

30 cycle Ák iA®!Z Ã*Ä cycle ¯

»ÅD DNA 72^oC 10IL }Æ&. PCR hÇ

< 2% Nusieve agarose gel (FMC Co. Ltd., USA) Y H³®&.

,È, eQ, primers sequence(5' É 3') &F R Ê&. Y© primer (¦Ë; 415-495) G3F (actgactagtgccctacgatatgccctgcc), ¯© primer (¦

Ë; 815-846) G3R (gcccaccccttctggcttaga)k ¹º eQ

®&.

RT-PCR hÇ Ì mRNA , Ík ªf

H ¦8 Southern blot analysis iA®&. RT-PCR h Çk 2% agarose gel YH³, ¯, MeOH BC Î nylon membrane (Boehringer-Mannheim, Germany)

ÏH3 UV 5IL Ðc 3S®&. membrane k prehybridization solution (50% formamide, 0.5%

Tween-20, 5X Denhardt's solution) Ñ? 45-55^oC

20IL ÁÎ &F 100 ug/ml sonicated salmon sperm DNAX digoxigenin-labelled specific oligonucleotides? c % hybridization solution Ñ? 45-55^oC ÒÓ ¿ ÁÆ&. Membrane< anti-digoxigenin alkaline phosphatase conjugate antibody? ?D TBST (Tris-buffered saline, 1% Tween-20) ÁÎ ¯, p- nitroblue tetrazolium chlorideR 5-bromo-4-chloro-3- indolyl-phosphate? zD TBS /yÆ&.

Ether EN, ¯ 5-6°± Sprague-Dawley - i

² rat X ~UV ÔÕ homogenizer (M.

Zipperer, Germany) Ö×, ¯, 14,000 g 30I ¿

1Ø ÌÙIN TÚÛk Üi®&. & 20,000 g

1L ¿ ÌÙIN Ý< TÚÛ< asialofetuin k Q, affinity chromatography IÞ12&.

Asialofetuin affinity column< iCÎ cyanate-activated sepharose 4B beads (Sigma, St. Louis, USA) asialofetuin 50 mg/mlk z, PBS (pH 8.0) Ñ? 4^oC Ò Ó ¿ ÁÎ &F phosphate buffer (10 mM phosphate with 2 mM dithiothreitol (DTT), 1 mM MgSO4, 0.2 mM phenylmethylsulfonylfluoride (PMSF), MN3 0.2% NaN3, pH 7.2) ßk àá P®&. Column Table 1. Design of primers for RT-PCR

Primer Sequence(5'3') Size Location G3F actgactagtgccctacgatatgccctgcc 30 bp 415-495 G3R gcccaccccttctggcttaga 21 bp 815-846 RPF ggtctatagccaaagaagcactg 23 bp 1045-1068 RPR ttatgagacacgacctaattctagc 25 bp 1387-1411

(3)

k |, ^_O zdÛ< & column â#°c Ü iã »7 ä®3, 3-5å column volume

phosphate buffer æ®&. AsialofetuinR \]D galectin-3 0.4 M lactoseX 2 mM DTTk zd, PBS

Üi®&. S RS 4 Ýc@ IÞ ^_

O W< Lowry q SK12&. ,È, W 7U ç! E. Coli systemk Q ¤ ¹º¹  U, dYJ èU] human galectin-3 eQ®& [13].

! "

UV , ^_OR affinity chromatography

S, ^_O< Laemmli © q UD sodium dodecyl sulfate (SDS) 12% polyacrylamide gelR 3.5%

stacking gelk eQ éÌ Uê iA12&. Y H³ ëì gel T band PVDF membrane 30 V 3L ¿ Æ!Z, galectin-3 ªfH

¦8 9[f M3/38 hybridoma åW TÚÛk 1 Ø í Q®& [10]. 2Ø í

horseradish peroxidase-conjugated goat anti-rat antibody (Promega Biotec, Adison, WI) eQ®3, 3,3'- diaminutesobenxidine tetrahydrochloride solution! Tî

30¼ ¿ /yÆ& [21].

Fig. 1A ~X UV ï galectin-3 9[f primer Q, RT-PCR \R&. ~ UV (lane 1)

R UV ªfD band ðH 7ñ 430 bp

òó&. ,È, ô Ýc@ band? galectin-3

mRNA »Å12* ªfH ¦8 cDNA 9

[! fõ internal probek Q, Southern blot analysis iA®&. Fig. 1B D öX Ê » ÅD band galectin-3 mRNA d÷12F ª f123, RT-PCR 8 Ýc@ \R densitometric analysis (Molecular analyst, Bio-Rad, USA) SK[!

Iø8 aùk UV band úr ~ UV

u8 8I 1 Srf ! ªf12&.

,È, %c /D mRNA? Hû[ ^_O

Fig. 1. Expression of galectin-3 mRNA in rat tissues.

(A) RT-PCR products separated on 2% agareose gel. (B) Southern blot analysis of RT-PCR products with internal probes. The bands were 431 bp: lane1; 1 kb marker, lane 2; lung, lane 3; brain.

Fig. 2. Western blot analysis of galectin-3 was done on 12

% SDS-PAGE. (A) with crude extracts, lane 1; control, lane 2; lung, lane 3; brain, lane 4; marker. (B) with affinity purifed proteins, lane 1; brain, lane 2; lung, lane 3; unbound lung protein, lane 4; marker.

(4)

ST[f translation RSk üË* ý ` "$ % e¹ Western blot analysis

¹ galectin-3 ^_O /k ªf®&. UV

^_Ok , ¯ YH³ galectin-3 ^þ ÿ í Q »®k , W 7Uç!

eQ, recombinanat galectin-3X ~ UV , ï galectin-3 30 kDa ¦ /y Ák ª f i %2&(Fig. 2A).

MG ý a3D öX Ê prion ^_ /

¢1H ¦8 / i[H

galectin-3? lactose \] Ok Q

asialofetuin affinity chromatography ¹z! U V galectin-3 S r®&. M \R S

D UVïX ~ UV ï ^þÿ í fõ1 ^_O Western blot analysis 8 ªf1 2&(Fig. 2B).

Galectin-3 ~, }, +C G H, G

I1c %!Z M Hû 78 &W

13 %H * Sª: 1c %* « , T&. Mr >3, '( galectin-3X c ¢ laminin binding protein prion proteinR \ ] prion ^_O / UHû ?û

q [24] ¤ ¹º galectin-3 rat UV

/k ®&. ¤ ¹º ¦ galectin-3 /k mRNAX ^_O ij »

®&. ¤ ¹º UV [1c % galectin-3 W : [c c# T1 2! ýK mRNA / ªfR /K

»k ¦8 a& £r? < RT-PCRk Q

mRNA /k ªf®3 Southern blot analysis i A » ©k ®&. Galectin-3

7, 9 primer (G3FR G3R)! cDNA »Å Æk T1 PCR Á hÇ ðH 430 bp Sr TD&. ¤ => \R galectin-3 mRNA

UV / Sr ~ UV u8 o H b ©! 1* ù Y \RX Ë,

& [8].

,È, UV , ^_Ok affinity chromatography

S, ¯ Western blot analysis iA, \R U V ^_Or ~ UV IND ^_O

D R Ë ðH band? /1 ªf 12&. galectin-3 /< u Hb

mvCwxy Western blot |T[f ©!

1* k Sr *, affinity Q, chromatographyX IJÇw[ ©k Qz!

i %!Z, s, galectin-3 +K!r NBk ò3 %Fk e3

%&.

Y galectin-3? g bèm mRNA splicing factor PQ,& ?û üÿ1c !

[14], galectin-3X V[! PQ g ÇO 7 8 ª¹: D ö? 2&. '( g pre-mRNA HO small nuclear RNA galectin-3X \]z

a31m galectin-3 mRNA splicing factor v

ª¹ 13 %& [27]. 9: ^! prion mRNA

\]* « ST prion ^_ (PrP^c) galectin-3 X \]m prion mRNA \] i %F< ý

\R& [7]. + BSE, W scrapie, e vCJD

R Ê< prion O ST[f PrP^c? scrapie form (PrP^c)! Yé1m O @A1H, X Ê

< ¢ e¹ üm galectin-3? prion disease

NHY ?ûk e3 %&.

,È, glioma astrocytoma galectin-3? /1 2& a3? %H ! [9, 26] ¤ => \R

? brain } , op3 UV 4 b è macrophage W! k

?ûr ½ i %*, MG, a3 -W

D ! -WC RS galectin-3

/ »? T< ý ` "#$ %H [16, 30] S T UVk ¶3 % &W, galectin- 3 / 7, m", => #! 8§ I

! o %&.

¤ ¹º Hb [f mv xy©!

1* ù UV galectin-3 /k galectin-3 S $ Western blotR RT-PCR ©!

ªf®&. RT-PCRk Q, UV galectin-3 mRNA / Sr ~ UV u8 8I 1 Srf ! ªf12&. UV , ^_Ok asialofetuin affinity chromatography S, ¯ Western blot analysis iA, \R ~ UV IND ^_O

D R , ðH galectin-3? /1 k ªf®&. G, ¤ => \R *¥)* 4

}UV /1* ! "#@ galectin- 3? UV /13 %& k a°3 %H

galectin-3? } prion \] ^_O 4

q => \R ** ! #!

(5)

prion O => %c galectin-3 v

%zk 3 %&.

1. Barondes, S. Bifunctional properties of lectins: Lectins redefined. Trends Biochem. Science. 1998, 13, 480-482.

2. Barondes, S. H., Cooper, D. N. W., Gitt, M. A. and Leffler, H. Galectins: Structure and function of a large family of animal lectins. J. Biol. Chem. 1994, 269, 20807-20810.

3. Brule, F. A. V. D., Fernandez, P. L., Bricu, C., Liu, F.-T, Jackers, P., Lambotte, R. and Castronovo, V.

Differential expression of galectin first trimester human embryogenesis. Dev. Dynamics. 1997, 209, 399-405.

4. Cherayil, B. J., Weiner, S. J. and Phillai, S. The Mac- 2 antigen is a galactose-specific lectin that binds IgE.

Proc. Natl. Acad. Sci. USA. 1990, 170, 1959-1972.

5. Cherayil, B. J., Chaitovitx, S., Wong, C. and Pillai, S. Molecular cloning of a humjan macrophage lectin specific for galactose. Proc. Natl. Acad. Sci. USA.

1990, 87, 7324-7328.

6. Chomczynski, P. and Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156-159.

7. Dagher, S. F., Wang, J. L. and Patterson, R. J.

Identification of galectin-3 as a factor on pre-mRNA splicing. J. Biol. Chem. 1995, 92, 1213-1217.

8. Flotte, T. J., Springer, T. A. and Thorbecke, G. J.

Dendritic cell and macrophage staining by monoclonal antibodies in tissue sections and epidermal sheets. Am.

J. Pathol. 1983, 111, 112-124.

9. Gordower, L., Decaestecker, C., Kacem, Y., Lemmers, A., Gusman, J., Burchert, M., Danguy, A., Gabius, H., Salmon, I., Kiss, R. and Camby, I. Galectin-3 and galectin-3-binding site expression in human adult astrocytic tumours and related angiogenesis. Neuropathol.

Appl. Neurobiol. 1999, 25, 319-330.

10. Ho, S. and Springer, T. A. Monoclonal antibody analysis of complex biological systems. Combination of cell hybridization and immunoadsorbents in a novel cascade procedure and its application to the macrophage cell surface. J. Biol. Chem. 1981, 256, 3833-3839.

11. Hsu, D. K., Zubery, R. I. and Liu, F.-T. Biochemiocal and biophysical characterization of human recombinant IgE binding protein, an S-type animal lectin. J. Biol.

Chem. 1992, 267, 14167-14174.

12. Huflejt, M. E., Jordan, E. T., Gitt, M. A., Barondes, S. H. and Leffler, H. Strikingly different localization of galectin-3 and galectin-4 in human colon adenocarcinoma T84 cells. Galectin-4 is localized at sites of cell adhesion. J. Biol. Chem. 1997, 272, 14294- 14303.

13. Kim, B. G. and Woo, H. J. Expression and characterization of the recombinant human galectin-3.

Korean J. Immunol. 1997, 37, 547-554.

14. Laing, J. G. and Wang, J. L. Idenrification of carbohydrate binding protein 35 in heterogenous nuclear ribonucleoprotein complex. Biochemistry. 1988, 27, 5329-5334.

15. Liu, F. T., Patterson, R. J. and Wang, J. L.

Intracellular functions of galectins. Biochim. Biophys.

Acta. 2002, 1572, 263-273.

16. Lotz, M. M., Andrews, C. W. Jr., Korzelius, C. A., Lee, E. C., Steel, G. D. Jr., Clarke, A. and Mercurio, A. M. Decreased expression of Mac-2 (carbohydrate binding protein 35) and loss of its nuclear localization are associated with the neoplastic progression of colon carcinoma. Proc. Natl. Acad. Sci. USA. 1993, 90, 3466- 3470.

17. Nangia-Makker, P., Ochieng, J., Christman, J. K.

and Raz, A. Regulation of the expression of galactoside- binding lectin during human monocytic differentiation.

Cancer Res. 1993, 53, 5033-5037.

18. Ochieng, J., Platt, D., Tait, L., Hogan, V., Raz, T., Carmi, P. and Raz, A. Structure-function relationship of a recombinant human galactoside-binding protein.

Biochemistry. 1993, 32, 4455-4460.

19. Pesheva, P., Kuklinski, S., Biersack, H. J. and Probstmeier, R. Nerve growth factor-mediated expression of galectin-3 in mouse dorsal root ganglion neurons, Neurosci. Lett. 2000, 293, 37-40.

20. Rieger, R., Edenhofer, F., Lasmezas, C. I. and Weiss, S. The human 37-kDa laminin receptor precursor interacts with the prion protein in eukaryotic cells. Nat.

Med. 1997, 3, 1383-1398.

21. Rosenberg, I., Cherayil, B. J., Isselbacher, K. J. and Pillai, S. J. Mac-2-binding glycoproteins. J. Biol.

Chem. 1991, 266, 18731-18736.

22. Sato, S., Burdett, I. and hughes, R. C. Secretion of the baby hamster kidney 30kDa galactose-binding lectin from polarized and nonpolarized cells: a pathway independent of the endoplasmic reticulum-Golgi

(6)

complex. Exp. Cell Res. 1993, 207, 8-18.

23. Sato, S. and Hughes, R. C. Regulation of secretion and surface expression of Mac-2, a galactoside-binding protein of macrophages. J. Biol. Chem. 1994, 269, 4424-4430.

24. Scheffer, U., Okamoto, T., Forrest, J. M., Rytik, P.

G., Muller, W. E. and Schroder, H. C. Interaction of 68-kDa TAR RNA-binding protein and other cellular proteins with prion protein-RNA stem-loop. J.

Neurovirol. 1995, 1, 391-398.

25. Shmakov, A. N., Bode, J., Kilshaw, P. J. and Ghosh, S. Diverse patterns of expression of the 67-kD laminin receptor in human small intestinal mucosa: potential binding sites for prion proteins? J. Pathol. 2000, 191, 318-322.

26. Strik, H. M., Deininger, M. H., Frank, B., Schluesener, H. J. and Meyermann, R. Galectin-3:

cellular distribution and correlation with WHO-grade in human gliomas. J. Neurooncol. 2001, 53, 13-20.

27. Wang, L., Inohara, H., Pienta, K. J. and Raz, A.

Galectin-3 is a nuclear matrix protein which binds RNA. Biochem. Biophy. Res. Commun. 1995, 217, 292-303.

28. Woo, H.-J. Secretion of Macrophage Differentiation Antigen Mac-2. Kor. J. Immunol. 1993, 53, 61-68.

29. Woo, H.-J., Lotz, M. M., Jung, J. U. and Mercurio, A. M. Carbohydrate binding protein 35 (Mac-2), a laminin binding lectin, forms functional dimers using cystein. J. Biol. Chem. 1991, 265, 18419-18422.

30. Woo, H.-J., Shaw, L. M., Messier, J. M. and Mercurio, A. M. The major non-integrin laminin binding protein of macrophages is indentical to carbohydrate binding protein 35 (Mac-2). J. Biol.

Chem. 1990, 265, 7097-7104.

Expression of galectin-3 in rat brain

   

Expression of galectin-3 in rat brain