A Case of Type Ia Glycogen Storage Disease Diagnosed in the Military Hospital 군 병원에서 확진된 Ia형 당원병 1예

전체 글

(1)

군 병원에서 확진된 Ia형 당원병 1예

이태웅·이상열1,2·김주영3·김구환4·유한욱4,5·우정택1,2·김병호6

인천기독병원 내과, 경희대학교 의과대학 내분비대사내과1, 경희대학교 내분비연구소2, 동수원병원 내과3,

서울아산병원 의학유전학 클리닉4, 울산대학교 의과대학 소아과5, 경희대학교 의과대학 소화기내과6

Received: 8 July 2010, Accepted: 2 September 2010 Corresponding author: Sang Youl Rhee

Department of Endocrinology and Metabolism, Kyung Hee University School of Medicine, 1 Hoegi-dong, Dongdaemun-gu, Seoul 130-702, Korea

Tel: +82-2-958-8200, Fax: +82-2-968-1848, E-mail: bard95@hanmail.net

A Case of Type Ia Glycogen Storage Disease Diagnosed in the Military Hospital

Tae Woong Lee, Sang Youl Rhee1,2, Joo Young Kim3, Gu-Hwan Kim4, Han-Wook Yoo4,5, Jeong-Taek Woo1,2, Byung Ho Kim6 Department of Internal Medicine, Incheon Christian Hospital, Incheon; Department of Endocrinology and Metabolism1, Kyung Hee University School of Medicine, Seoul; Research Institute of Endocrinology2, Kyung Hee University, Seoul; Department of Internal Medicine3, Dongsuwon Hospital, Suwon; Medical Genetics Clinic and Laboratory4, Asan Medical Center, Seoul; Department of Pediatrics5, University of Ulsan College of Medicine, Seoul; Department of Gastroenterology and Hepatology6, Kyung Hee University School of Medicine, Seoul, Korea

We report here on a case of genetically confirmed type Ia glycogen storage disease (GSD) that was diagnosed in the military hospi- tal. A twenty-year old soldier was admitted to the hospital with abdominal fullness. He had a past medical history of hepatomegaly that was firstly recognized at six months after birth, and he had been followed-up at an outpatient clinic with the presumptive diag- nosis of type III GSD. He also had a history of growth hormone therapy because of growth retardation. However, he arbitrarily refused medical observation from 14 years of age. On the physical examination, the height of the patient was 163.1 cm and significant hepa- tomegaly was observed. Significantly abnormal liver-associated paramters were observed on the laboratory findings and multiple hepatic adenomas were observed on the CT exam and MRI scan. To determine the proper treatment, we tried to confirm the exact type of GSD in the patient. By mutational analysis, we found the c.648G>T homozygote splicing mutation in the G6PC gene and the patient was confirmed as having the type Ia GSD. (Endocrinol Metab 26:84-88, 2011)

Key Words: Glycogen storage disease, Chromosomal disorders, Hepatomegaly, Adenoma, Liver cell

서 론

당원병(glycogen storage disease)은포도당 대사과정에관계되 는효소의기능이상으로간, 신장, 근육등의장기내글리코겐의축

적을특징으로하는상염색체열성대사질환이다[1,2]. von Gierke

에의해처음기술된이래그발견순서에따라약 11개아형이알려 져있으며, 이중 G6PC 유전자돌연변이와관련된 Ia형(von Gierke disease)이가장많은것으로알려져있다[3,4].

Ia형당원병과관련된 G6PC 유전자돌연변이는전세계적으로다

양한양상으로보고되어있다[3,5-7]. 그러나한국, 중국, 일본등동 아시아국가에서는 c.648G>T 동종접합자짜깁기돌연변이(homo- zygote slicing mutation)가가장흔한빈도로보고되고있어 Ia형당 원병의진단을위해말초혈액백혈구 DNA를이용한유전자돌연변

이검사가유용한것으로알려져있다[8-13].

저자들은최근 G6PC 유전자분석을통해군병원에서확진된 Ia

형당원병 1예를경험하여문헌고찰과함께이를보고하고자한다.

증 례

환자: 20세남자 주소: 복부팽만

현병력:군복무중이던환자는입대이후지속적인복부불편감 및복부팽만을경험하여이의원인감별을위한정밀검사및처치 를위해내원하였다.

과거력: 환자는생후 6개월경폐렴으로입원치료중확인된간종 대및간기능이상으로간생검시행하였으며당시임상경과와간생 검결과를바탕으로 III형당원병판단하에대학병원외래경과관 찰을시행하였다. 이후환자는성장장애로 12세부터약 2년간성장 호르몬치료를시행하였다. 하지만 14세이후외래방문을임의중단 하고내원당시특별한식이요법또는약물치료없이지내고있었다.

(2)

PT 13.1초로 international normalized ratio (INR) 0.98였다. 동맥혈 가스검사상 pH 7.352, PaO2 103.5 mmHg, PaCO2 36.9 mmHg, HCO3- 20.0 mmol/L, 산소포화도 97.5%였으며젖산(lactic acid)이 111.7 mg/dL로측정되었다. 생화학검사상수시혈장포도당 55 mg/

dL, 총빌리루빈 1.73 mg/dL, 직접빌리루빈 0.20 mg/dL, 단백질 9.1 g/dL, 알부민 5.1 g/dL, AST 139 IU/L, ALT 207 IU/L, alkaline phos- phatase 116 IU/L, γ-glutamyltranspeptidase 315 IU/L, 요산 14.3 mg/dL, 혈청요소질소 13 mg/dL, 크레아티닌 0.4 mg/dL, LD 446 IU/

L, CK 78 IU/L로측정되었다. 혈청지질검사상총콜레스테롤 502 mg/dL, 중성지방 1788 mg/dL, 고밀도지단백콜레스테롤 56 mg/dL, 저밀도지단백콜레스테롤 188 mg/dL로측정되었다.

영상 검사 결과: Computed tomography (CT) 및 magnetic reso-

nance imaging (MRI) 검사결과비장종대가없는현저한간종대와

함께간의양엽(lobe)에서동맥기에조영증강되는 다양한크기의

다발성간종괴가발견되었다(Fig. 2). 이는당원병에의한간선종의 전형적인소견이었다.

유전자 검사:이상의검사결과환자의복부팽만감은 당원병및 이에속발한다발성간선종에의한것으로판단되었다. 하지만환자

(Gentra, MN, USA)를 사용하여 genomic DNA를 분리하였으며 G6PC 유전자를구성하는각각의 exon에대한정방향과역방향의

시동체(primer)를사용하여중합효소연쇄반응을시행하였다. 그리

고 BigDye Terminatore V3.0 Cycle Sequencing Ready reaction kit 와 ABI 3131xl Genetic analyzer (Applied Biosystems, CA, USA)를 이용하여증폭된 DNA에대한염기서열분석을시행하였다[14] (Ta- ble 1). 검사결과, G6PC 유전자 exon 5의 c.648G>T 동종접합자짜 깁기 돌연변이(homozygote splicing mutation)를확인하였으며환 자는 Ia형당원병으로확진되었다(Fig. 3).

치료 및 경과:진단후환자는전역하였으며 Ia형당원병의치료를 위해조리되지않은옥수수전분(uncooked cornstarch) 등을사용 한엄격한식이요법을권고하였다. 아울러환자의다발성간선종은 악성종양으로발전할가능성이높은것으로판단되어지속적인경 과관찰이필요함을설명하였다.

고 찰

당원병은포도당대사과정에관계되는효소의결핍으로간, 신장, 근육등의장기내글리코겐이축적되는상염색체열성선천성대사 이상질환이다[1,2]. 이중 Ia형당원병은포도당신생과글리코겐분 해의마지막 과정에관여하는효소인 glucose-6 phosphatase en- zyme (G6Pase)의 catalytic unit을부호화하는 G6PC 유전자의돌연 변이에의해발생하며전체당원병중가장많은빈도를차지하는

것으로알려져있다[2,6]. 외국의연구에의하면 Ia형당원병의발병

률은출생 10만명당 2.3명정도로알려져있으며당원병에대한자 세한역학연구가이루어져있지않은우리나라역시외국의경우

와유사한양상을보일것으로추정된다[15].

Ia형당원병의임상증상으로신생아기에저혈당과젖산혈증이관

Fig. 1. Physical examination findings of the patient. A. Relatively short stature (163.1 cm); B, C. Significant abdominal distension with hepatomegaly was ob- served.

A C

B

Table 1. Primers used for PCR amplification of exons in the G6PC gene

Sense Antisense

Exon 1 aagcctggaataactgcaag caacttctgatggacagacat Exon 2 cttcttgaaggtgtaggcttt aaagtacaaaggaatggctct Exon 3 ctgggtagatgatgcactgt atgtgaggaagaatacgtgg Exon 4 ctgagagcacctaagtttgc gattttgtcctgattagggag Exon 5 actcctccaaacccacctcta ttgcttcaaatagtagtcctcc Primers were designed with primer 3 cgi v.2.0 served from Whitehead Institute (http://frodo.wi.mit.deu/cgi-bin/primer3 www.cgi) using sequences from Gen- Bank accession number of NT_010755.15.

(3)

찰될수있으며비장종대없이관찰되는간종대, 복부팽만, 이상지 질혈증, 고요산혈증등을초래하며성장발육부전이일어나는것으 로알려져있다[1,16]. 이외만성합병증으로통풍, 빈혈, 단백뇨및 간선종등이발생할수있으며특히간선종은일부악성화되는것으

로알려져있다[1,16]. 우리나라에서도 Ia형당원병의증례보고가

다수존재하며그임상적특성은외국의연구들과유사한것으로

알려져있다[17,18]. 24명의비교적많은환자들이포함된한연구에

의하면대상자들의진단당시평균연령은약 6.9세로남아의비율 이높고(67%), 대상자의 30%에서가족력이확인되었다[14]. 진단당 시검사결과대상자들모두에게서고중성지방혈증과젖산혈증이

A B C

D E F

Fig. 2. Radiologic findings of the patient. In abdominal CT (A-C) and hepatic MRI (D-F) scans, significant hepatomegaly without splenomegaly was identified and multiple various sized mass lesions at both lobes of liver with arterial enhancing and delayed isodensity were observed.

Fig. 3. c.648G>T homozygote splicing mutation in G6PC gene identified in patient’s genomic DNA.

Partial seq. of G6PC gene

c.648G>T homozygote splicing mutation Normal

Patient

(4)

에정확한진단을위해어려움이있다. 최근분자생물학을이용한 진단기술의발전으로환자의말초혈액백혈구 DNA를이용한유전 자돌연변이분석이가능하게되어당원병의진단및병형감별을 좀더용이하게할수있게되었다[6].

전세계적으로보고된 Ia형당원병의유전자돌연변이는다양하

며인종에따라유의한차이를보이는것으로알려져있다[5-7]. 문

헌에의하면현재 당원병 Ia형환자에서 과오(missense), 무의미

(nonsense), 짜깁기(splicing), 삽입(insertion), 결손(deletion) 등다 양한양상을보이는약 92종의돌연변이가발견되었으며이중에서 도 p.Arg83Cys, c.648G>T, p.Gln347Stop, c.79del, p.Arg83His 등이 비교적그빈도가높은것으로알려져있다[3,6]. 특히한국, 중국, 일 본등동아시아여러국가의경우 c.648G>T의유전자돌연변이가 Ia

형당원병전체의 70-90%를차지하는것으로보고되고있어 Ia형

당원병이의심되는환자의진단을위해유전자돌연변이의우선적

검사가진단적가치가높을것으로생각된다[8-13]. 이러한 G6PC

전자돌연변이는체내 G6Pase 결핍을초래하여간의포도당신생을 억제시키고지속적인공복저혈당과글리코겐침착같은 Ia형당원 병의특징적임상증상을유발시키는것으로알려져있다[2].

현재 Ia형당원병의치료에있어 G6Pase 결핍을해결할수있는

근본적치료방법은존재하지않는다. 다만환자에게고탄수화물식 이를자주섭취하게하여저혈당과이에기인하는이차적인대사합

병증을방지하는것이치료의주된목표가된다[1]. 구체적인방법으

로자주먹이기, 경비위관을통해야간에지속적으로먹이기, 조리 되지않은옥수수전분먹이기등이있으며특히조리되지않은생 옥수수전분섭취는다른방법들에비해상대적장점이많아현재 일반적인대증치료로가장널리사용되고있다[1,14,19]. 하지만옥수 수전분복용이환자의생화학적지표와성장장애를개선하는데 비교적좋은효과가있는것은분명하지만간선종과신기능저하등 의만성합병증을근본적으로억제할수있는가에대해서는아직 논란의여지가있다[1,14].

상기환자는비교적오랜기간대학병원진료를시행하였음에도 정확한당원병아형의진단이이루어지지않았으며임의치료중단 후질병관리가제대로이루어지지못하여다발성간선종등심한 합병증이동반되어있었다. 또한합병증에도불구하고환자는징병 신체검사상정상판정을받아현역병으로복무하고있었다. 이러한 사실은해당질병에대한관련분야전문가들의인식이아직부족 하다는것을시사하며관련증례에대한경험이좀더널리공유되 어야할여지가있음을의미한다. 또한각종희귀난치질환선별에

으로전망된다.

요 약

저자들은유전자분석을통해군병원에서확진된 Ia형당원병 1 예를경험하여이를보고하고자한다.

군복무중인 20세남자환자가복부팽만을주소로내원하였다. 환자는생후 6개월경간기능이상및간비대를처음확인한후 III형 당원병추정하에경과관찰을시행하였으며성장장애로약 2년간 성장호르몬치료를시행한과거력이있었다. 하지만환자는 14세이 후임의로내원을중단하고특별한치료없이지내오고있었다. 신

체검사상환자는키 163.1cm 였으며현저한간종대가관찰되었다.

간기능검사결과상유의한이상이확인되었으며복부 CT 및 MRI 상다발성간선종이확인되었다. 환자의정확한치료방침을결정하 기위해당원병에대한병형확인을시도하였으며말초혈액백혈구 DNA를이용한유전자검사상 G6PC 유전자 c.648G>T 동종접합자 짜깁기돌연변이가확인되어 Ia형당원병으로확진되었다.

참고문헌

1. Rake JP, Visser G, Labrune P, Leonard JV, Ullrich K, Smit GP: Glycogen storage disease type I: diagnosis, management, clinical course and outcome.

Results of the European Study on Glycogen Storage Disease Type I (ESGSD I). Eur J Pediatr 161 (Suppl 1):S20-34, 2002

2. Lei KJ, Shelly LL, Pan CJ, Sidbury JB, Chou JY: Mutations in the glucose- 6-phosphatase gene that cause glycogen storage disease type 1a. Science 262:580-583, 1993

3. Matern D, Seydewitz HH, Bali D, Lang C, Chen YT: Glycogen storage disease type I: diagnosis and phenotype/genotype correlation. Eur J Pediatr 161 (Suppl 1):S10-19, 2002

4. Chou JY, Matern D, Mansfield BC, Chen YT: Type I glycogen storage dis- eases: disorders of the glucose-6-phosphatase complex. Curr Mol Med 2:

121-143, 2002

5. Moses SW: Historical highlights and unsolved problems in glycogen stor- age disease type 1. Eur J Pediatr 161 (Suppl 1):S2-9, 2002

6. Rake JP, ten Berge AM, Visser G, Verlind E, Niezen-Koning KE, Buys CH, Smit GP, Scheffer H: Glycogen storage disease type Ia: recent experience with mutation analysis, a summary of mutations reported in the literature and a newly developed diagnostic flow chart. Eur J Pediatr 159:322-330, 2000

7. Trioche P, Francoual J, Chalas J, Capel L, Lindenbaum A, Odievre M, La- brune P: Genetic heterogeneity of glycogen storage disease type Ia in France:

a study of 48 patients. Hum Mutat 16:444, 2000

(5)

8. Akanuma J, Nishigaki T, Fujii K, Matsubara Y, Inui K, Takahashi K, Kure S, Suzuki Y, Ohura T, Miyabayashi S, Ogawa E, Iinuma K, Okada S, Nari- sawa K: Glycogen storage disease type Ia: molecular diagnosis of 51 Japa- nese patients and characterization of splicing mutations by analysis of ec- topically transcribed mRNA from lymphoblastoid cells. Am J Med Genet 91:107-112, 2000

9. Chiang SC, Lee YM, Chang MH, Wang TR, Ko TM, Hwu WL: Glucose- 6-phosphatase gene mutations in Taiwan Chinese patients with glycogen storage disease type Ia. J Hum Genet 45:197-199, 2000

10. Goto M, Taki T, Sugie H, Miki Y, Kato H, Hayashi Y: A novel mutation in the glucose-6-phosphatase gene in Korean twins with glycogen storage disease type Ia. J Inherit Metab Dis 23:851-852, 2000

11. Kajihara S, Matsuhashi S, Yamamoto K, Kido K, Tsuji K, Tanae A, Fuji- yama S, Itoh T, Tanigawa K, Uchida M, Setoguchi Y, Motomura M, Mizuta T, Sakai T: Exon redefinition by a point mutation within exon 5 of the glucose-6-phosphatase gene is the major cause of glycogen storage dis- ease type 1a in Japan. Am J Hum Genet 57:549-555, 1995

12. Ki CS, Han SH, Kim HJ, Lee SG, Kim EJ, Kim JW, Choe YH, Seo JK, Chang YJ, Park JY: Mutation spectrum of the glucose-6-phosphatase gene and its implication in molecular diagnosis of Korean patients with glyco-

gen storage disease type Ia. Clin Genet 65:487-489, 2004

13. Lee HJ, Eun JR, Jang BI, Lee JH, Lee HW, Choi JH, Ki CS: A case of glycogen storage disease type Ia performed molecular genetic analysis. Ko- rean J Med 71:91-96, 2006

14. Choi J, Ko JM, Kim GH, Yoo HW: Clinical manifestation and effect of corn starch on height growth in Korean patients with glycogen storage disease type Ia. J Korean Soc Pediatr Endocrinol 12:35-40, 2007 15. Applegarth DA, Toone JR, Lowry RB: Incidence of inborn errors of me-

tabolism in British Columbia, 1969-1996. Pediatrics 105:e10, 2000 16. Talente GM, Coleman RA, Alter C, Baker L, Brown BI, Cannon RA,

Chen YT, Crigler JF Jr, Ferreira P, Haworth JC, Herman GE, Issenman RM, Keating JP, Linde R, Roe TF, Senior B, Wolfsdorf JI: Glycogen stor- age disease in adults. Ann Intern Med 120:218-226, 1994

17. Choi YI, Choi YI, Park JW, Chung YS, Kim HJ: A case of type ia glyco- gen storage disease. J Korean Soc Endocrinol 14:786-792, 1999 18. Ko JS, Yang HR, Kim JW, Seo JK: Clinical findings of genotypes in Ko-

rean patients with glycogen storage disease type Ia. Korean J Pediatr 48:

877-880, 2005

19. Chen YT, Cornblath M, Sidbury JB: Cornstarch therapy in type I glyco- gen-storage disease. N Engl J Med 310:171-175, 1984

수치

Updating...

참조

Updating...

관련 주제 :