• 검색 결과가 없습니다.

The Effects of Somatid on the Cytotoxicity of Cancer Cells and Human Papillomavirus Type 16 E6 and E7 Oncogenes

N/A
N/A
Protected

Academic year: 2021

Share "The Effects of Somatid on the Cytotoxicity of Cancer Cells and Human Papillomavirus Type 16 E6 and E7 Oncogenes"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

약학회 지 제 44 권 제 4 호 340~346(2000) Yakhak Hoeji Vol. 44, No. 4

세 포 득 성 자 궁 경 부 암 바 이 러 스 ( H P V 1 6 t y p e ) 유 발 인 자 E 6 E 7 작 용 에 미 처 는 효 과

정 윽 • 조 영 식 • 조 정 원 • 이 경 애 ■ 심 정 현 • 조 민 철 • 이 홍 수 • 염 영 일 • 김 상 범 * • 박 순 희 ** • 윤 도 영 *

생명공학연구소, *SB 식품외 학연구소, 식품의약품 안전청 생물학평가부 바이러스 제제과 (Received March 31, 2000)

The Effects of Somatid on the Human Papillomavirus Type

Cytotoxicity of Cancer Cells and

2

16 E6 and E7 Oncogenes

Ok Joung, Young-Sik Cho, Cheong-Weon Cho, Kyung-Ae Lee, Jung-Hyun Shim, Min-Chul Cho, Hong-Soo Lee, Young-IL Yeom, Sang-Bom Kim*,

Sue Nie Park** and Do-Young Yoor/

Cellular Biology Lab, Korea Res. Institute of Bioscience and Biotechnology, Taejon 305-600, Korea

*SB Research Institute, ShinYoung Dong 176-4, JongRo Gu, Seoul 110-010, Korea

**Department of Viral Products, KFDA #5, Nokbun-dong, Eunpyung-gu, Seoul 122-704, Korea

Abstract — Cervical cancer is one of the leading causes of female death from cancer worldwide with about 500,000 deaths per year. A strong association between certain human papilloma viruses (HPV types 16 and 18) and cervical cancer has been well known. An extract of natural products, named as Somatid, has been used to investigate whether this agent has the ability of inhibiting the oncogenes E6 and E7 of HPV type 16. This Somatid inhibited the proliferation of human cervical cancer cell lines (C-33A, SiHa, CaSki) and HaCaT keratinocytes in a dose response manner. In vitro binding assay and ELISA showed that Somatid inhibited the in vitro biding of E6 and E6AP which are essential for the binding and degradation of the tumor suppressor p53. In addition, Somatid inhibited the in vitro binding of E7 and Rb which is essential tumor suppressor for the control of cell cycle. The levels of mRNA for E6 and E7 were also decreased by Somatid. Our data suggested that Somatid inhibited the oncogenecity of E6 and E7 of HPV 16 type, thus can be used as a putative anti-HPV agent for the treatment of cervical carcinomas caused by HPV

Keywords □ In vitro binding assay, Enzyme-linked Immunosorbent Assay (ELISA), E6 oncogene.

천연물에는 인체에유익한 여러 물질들이 산재하고 있다. 에를 돌면 백반(카리명반: 황산알머늄카륨 KjSO • Al2(S04)3(24H20>은 - 홍반이 있는데 동의보감에는무득하며 창과창상을주치하는 의익용 뿐만 아니라, 염색, 안료, 정수제, 식품첨가물 등에 효과를기술하고 있다/) 연구에서는 대추, 감초, 복승아써, 백반, 맥반석, 규조토 등과 같은 여러가지

* 논문에관한문의는저자에게로 (전화) 82-42-860-4218 (팩스) 82-42-860-4593

천연물질돌의 흔합추출물(이하 Somatid, 일명, 생기액) 이용, 매년 여성의 사망 원인 중에서 1, 2위로 알려진 자궁경부암바이러스^씬 파필로마h M 러스 유발인자 E6 E7작용기전에 머처는효과룰 연구 하였다.

발생원인중에서는세포성 유전자(: c-myc, ras 등)네와 러스성 유전자들(: EBY HPy HBV 등)이 발견되었고 이돌유전자나유전자 번이들 그리고발생과의 관련성기작더1 관한많은연구 논문들이 발표되어 왔다.5 나서•가억제유전자(예

(2)

E6 E7 빌암유전자의 in vitro binding 미치는생기액의효과 341

:p53, pRB ) 그리고 세포주기조절인자(: cyclins, cyclin dependent kinases, p21, pl6 등)*^와유전 관련 세포의 신호전달기전 관련인자들(: protein tyrosine kinase dependent pathway등)®*이 발견되어 발생 기작에 대한분자수준에서의 해석들이 점차 구체적으로이루어지고있다. 한편 인체에발생하는 암의 15~20%가버이러스와연관되어 있는것으로 이미밝혀져 있어원인 버이러스를분리하거나분리된 바이러스의 DNA로부터단백질을만들어 내어 백신으 시용하거나 진단법에 이용하는 연구가이루어지고 있다. 이들에 관한 연구는중양버의러스에 의해 유도 되는암의 발암 기작을 연구할 있을 뿐만 아니라 아직까지 주요원인을 모르는 타종 암에 대하여도 많은정보를 제공할 있을 것이다. 일례로 SV40 이러스의 large T antigen HPV E6 단백질은 p53 단백질의 기능을 억제하고 있옴이 밝 혀 졌 는 데 정 상 적으로 p53나타내는 세포에 HPV E6 발현을유도 하면세포증식이 촉진되고 있옴이 밝혀졌다. ' p53 백질은대부분의 조직에서 유전자돌연변이에 의해 발현이 안되거나기능이 상실되어 있으며 암의 류에 따라 돌연번이의 형태도각기 다름이 알려졌다.

이와같이 p53돌연변이나 기능 상실은 발생과

밀접한 관련이 있을 것으로 생각되나 p53 tumor suppressor로서의 기능이 어떻게 이루어지는가에 대한 기작이상세히 밝혀져 었지않다. 또한 E7발암유전자 E2F결합하고 있는 R bS 인산화시켜 E2F

리되도록함은 E2F의한세포주기가활성화되어

상세포가암화되는데 중요한 역할을 한다/"> 연구 에서는천연물질들의 혼합주출물(Somatid)이자궁 부암바미러스인파필로마버식러스유발인자 E6

E7작용을억제하는 효과를 확인하고 버식러스,

암활성눙의 기작을 이해하기위하쉬 이들추출물의 자궁암세포주에 대한세포득성과암을일으키는바이 러스 발암■유견자 E6 E7 작용에 미처는 효과를 조사하였다.

재료 방법

S o m a tid (» 'S : 일명; 생기액) -공이풍부한 맥반 , 제오라의트, 규조토등을 1:1:1섞은 다옴, 깨끗 물로 세척하여 원석 등이 지니고 었는 결정수률

300°C 고열로 볶아 이상물질을 제거하고 많은

기를^ 한 다옴, 세척실온에서건조시킨 300 mesh 분말로하식 백반을 1% 첨가하였다. 껍질을 거한 복승아 (도인) 0.1%, 대추(산조인) 0.1%률 쇄한 다옴 감초10%와 같이 10(fC 20 분간 가열 얼음에 냉각하식 여과포로여과하였다. 여과 액에 앞서 제조한분말을 넣고죽상으로 반죽한 다옴 건조기에 넣어수분을증발시키고고형물질만남는 말로하여 놓았다. 물질을 3^11 걸쳐 끓여서 연미 또는담황색 상태의 엿과같은상태에서 다시 냉각 시킨주정(술)에 수장 시키고 건조시킨 고형물^ 석구(맷돌)로분쇄하여 분말로 열관에 뿌려 놓고융점의 온도 120°C~135°C까지 을린 여기에 분말을뿌려서 접착이 되도록하였다. 상태률 반복 하식 고형물을 만든다. 고형물을 냉각 시킨 건조(그늘 건조)시키고 증류수에 담귀 두어 생기액 (100 mg/m/)으로 이용하였다.

E6, E6AI? E7, Rb 발현 대장균주

E6 E6-AP 발현백터제조- 실험에서 시용되 E6 E6-AP pGEX pET 벡터에서 발현되 도록제조하였다. E6 HPV 함유자궁경부암세포로 부터 추출한 RNA로부터 5'-GCG GCC GCC ACC ATG TTT CAG GAC CAC AG-3'(sense) and 5'- CTG CGG CCG CGA TTA CAG CTG GGT TTT CTC T-3'(antisense)의 primer 사용하여 역전사 polymerase chain reaction(PCR)을 수행하여 증폭하 였다. PCR 산물을 pBluescript II KS(+)로 제조된T-

vector*에 옮긴 E6 유전자를 다시 제한효소

Bam HISal 1으로 절단하고똑같은 효소로 절단한

PGEX4T-1 pET28a벡터로연결하였다. 또한 E6-AP 가운데 부분이 중복되는 2종류의 primer(5'-AGA TCTATGAAGCGAGCAGCTGCAAAGCATCTAAT A-3'과 5'-CTCTAGCCGGACAAGTGCATCATCTAT GAT-3', 5'-AGCGAGCTGACACTTCAGGAACTTTTG- GGA-3'과 5'-TTACAGCATGCCAAATCCTTTGGCAT- ACGT-3')를 사용하식 앞에서와 같은 방법으로 RT- PCR증폭하였다. 증폭된 산물은 cloning 벡터인 PCR®2.1-T0P0 연결하고 Bgl II Eco RI으로 단하고 Bam HIEco RI으로 절단한 pGEX4T-l

cloning하였다. Histidine결합된 E6-AP발현하기 위해 T0P0/E6-AP Bgl IIHind H E . 절단하고

pET28 Bam HI Hind III 절단하여 ligase

(3)

영식조정원이경애심정현조민철이홍수염영일김상범박순희윤도영

조 합 하 였 다.

E7 Rb 발현벡터제조 -E7 단 백 질 은 histidine 합 과 GST결 합 형 태 로 제 조 되 었 다. HPV 함 유 자 궁 경 부 암 세 포 인 CaSki RNA로 부 터 다 음 과 같 은 primer (5'-CAC CAT GGC ATG GCA TGG AGA TAC ACC T-3' 5'-TTA TGG TTT CTG AGA ACA- 3') 사 용 •하 여 RT-PCR 수 행 증 폭 하 였 다. 증 폭 산 물 을 T-vector* 연 결 하 고 다 시 Bam HI Sal I

으 로 절 단 하 여 E7유 전 자 를 얻 는 다. 이 률 같 은 제 한 효 소 로 절 단 한 PGEX4T-1 pET28a 각 각 연 걸 하 여

E7 발 현 시 켰 다. E7 결 합 하 는 데 이 용 되 는 Rb 단 백 질 은 Dr. Cho YJ(Korea Institute of Science and Technology, Seoul, Korea) 부 터 제 공 받 았 는 데 이 는

pET벡 터 에 서 제 조 되 었 으 며 용 해 성 과 안 정 성 을 증 가 시 키 기 위 한 pocket domain 포 함 한 아 미 노 산 373에 서

928 이 르 는 N-말 단 이 제 거 된 짧 은 단 백 질 이 다.

재조합단백질대량생산 bead부착 -pET/Rb, pGEX 발 현 벡 터 는 E. Cb/i(DH5a), pET28a 발 현 벡 터 는 E. Co//(DE3) transformation시 키 고 1 mM isoprophyl-P-D-thiogalactopyranoside(IPTG) 가 하 고

18X에 서 12 시 간 동 안 단 백 질 을 유 도 하 였 다. 숙 주 세 균 원 심 분 리 하 식 얻 었 고 pGEX pET/Rb 발 현 대 장 균 은 PBST(phosphate-buffered saline 0.5% Triton X-100, 0.5 mM phenylmethyl sulfonyl fluride(PMSF)

10 lag/m/ aprotinin 함 유 )에 pET28 발 현 대 장 균 은 용 해 완 충 용 액(50 mM NaH2PC>4, 150 mM NaCl, pH 8.0) 현 탁 시 키 고 초 음 파 파 쇄 를 실 시 하 였 다. 원 심 분 리 하 고 상 등 액 >?>을 취 하 식 결 합 반 응 에

용 하 였 다. GST/E6, GST/E7, GST/E6-APb PBS 충 용 액 으 로 미 리 평 형 화 시 킨 GSH bead 결 합 시 키 같 은 완 충 용 액 으 로 씻 어 주 었 다. 또 한 pET28a/E6, PET28/E7 PET28/E6-AP 경 우 Ni-NTA bead (Peptron Inc., Taejon, Korea) 결 합 시 키 고 20 mM imidazole 포 함 된 완 충 용 액 으 로 3 씻 어 낸 결 합

빈 움 을 실 시 하 였 다.

자궁경부암세포주의세포득성 - DMEM/10% FBS 유 지 시 킨 자 궁 경 부 암 세 포 주C-33A, CaSki, SiHa

keratinocyte세 포 HaCaT 96 well plate Ix io V well 넣 은 1 동 안 COj incubator 배 양 하 였 . 새 로 운 배 지 로 같 아 준 여 러 가 지 농 도 로 희 석 시 Somatid 처 리 한 20시 간 WST-l(Berin- ger Manheim, Germany) 10 pi 첨 가 하 여 1-3시 간

이 내 에 450nm에 서 흡 광 도 를 ELISA reader<Mole- cular Device, CA) 즉 정 하 였 다.

Bead GST E6AP His E6 binding 미치 Somatid 영향 -GSH bead(Glutathione Sepha- rose™4B, Pharmacia Biotech, Sweden) I X PBS buffer 치 환 하 식 사 용 하 였 으 며, GST/E6AP(3.4 ng/

ml) 상 등 액 Im / GSH bead 3 0 0 결 합 시 켜 Bead GST/E6AP 사 용 하 였 다. Bead GST/

E6AP His E6 binding 반 응 액 을 1200 ^ 하 여 실 시 하 였 다. PBST 950 Bead GST/

E6AP 50 ^ His E6(8.2 g/m/) 상 등 액 200 |o/룰

넣 어 저 온 실 에 서 회 전 시 키 면 서 1시 간 동 안 결 합 시 켰 으 며, 6000 rpm에 서 3분 간 원 심 분 리 하 여 상 등 액 을 PBST 1.2 ml넣 고 다 시 저 온 설 에 서 5분 간

세 척 하 였 다. 세 척 단 계 는 3 반 복 하 였 다. 3번 의 척 단 계 가 끝 나 면 상 등 액 을 완 전 히 제 거 증 류 수 40

5X SDS sample buffer 10|j/ 넣 어 SDS- PAGE sample 제 조 하 였 다. Somatid(100 mg/m/)

1/6 희 석 하 식 첨 가 하 였 다. PBST 750 H/ Bead GST/ E6AP 50 |o/, His E6 상 등 액 200 \il,

Somatid 200 |j/(원 액 농 도 100 mg/m/) 넣 어 결 합 시 켰 으 며 결 합 과 정 과 SDS-PAGE sample 제 조 방 법 은

Yang 등 쩍 방 법 과 동 일 하 게 실 시 하 였 다. Sample

10 loading 하 여 25 mA 전 기 영 동

staining하 였 으 며, Western blot 15|j/ loading

gel PVDF mem- brane으 로 transfer HPV 16-E6(N-17) antibody (goat antibody, Santa Cruze Biotechnology, Santa Cruze, CA) 1 처 리 하 고 anti­

goat IgG(H+L)-alkaline phosphate(Sigma)틀 2 처 리 하 며 확 인 하 였 다.

Somatid 농도 구배에 의한 Bead GST E7 pET/Rb 결합에 머치는 영향 - Bead GST/E7 제 조 사 용 된 Bead GSH Yang %1 방 법 에 서 제 조 Bead사 용 하 였 으 며, GST/E7(13.9 상등

500 H/ GSH bead 500 / 결 합 시 켜 이률 Bead GST/E7으 로 사 용 하 였 다. Bead GST E7

pET/Rb binding Assay PBST 반 응 액 을 1200

10/ 하 쉬 Bead GST/E7 각 각 40 |o/, pET/Rb (6.9 (xg/m/) 100 |o/ 첨 가 하 였 으 며, Somatid(100 mg/

ml) 5 m/(0.42%), 10 n/(0.83%), 15 |i/(1.25%), 20

|i/(1.67%), 50 10/(4.17%)률첨 가 하 여 결 합 시 켰 는 데 합 과 정 과 SDS-PAGE sample 제 조 방 법 은 Yang 등차

(4)

E6 E7 발 암 자 의 in vitro binding 미처는생기액의효과 343

방법과동일하게설시하였다. 3번의 세척단계가 나면 상동액을 완전히 제거 증류수 50 |i/와 5X SDS sample buffer 12 |o/을 넣어 SDS-PAGE sample 제조하였다. Sample 10 |i/씩 loading 하여 25 mA 전기영동 staining하였으며, Western 15

|i/썩 loading하여 견기영동을 실시한 gel PVDF membrane(Millipore, Bedford, transfer?]:

monoclonal anti-Rb(Ab-6) antibody(Oncogene, Cambridge, MA) (1 1 하고 anti- mouse IgG(y-chain specific)-alkaline phosphate conju- gate(Sigma)를 2처리 하여 확인하였다.

E6, E6AP 결합을 이용한 ELISA 머치는 So­

matid영향 -E6AP Maxisorb 96-well plate 4

|xg/m/로 coating PBS/3% skimmed milk 2 시간 동안 blocking하였다. PBST 3 세척 pET28a/E6 pGEX/E6로부터 얻은 E6 상등액을 PBS 32희석한 것을 100 /welt넣어 1 시간 실온에서 번응시켰다. E6AP결합한 E6 goat anti- E6(N-17) antibody(Santa Cruz Biotechnology) hor­

seradish phosphatase-conjugated anti-goat IgG (Sigma)를계속 처리한 PBST 세척하고 기질용 [4 mg o-phenylenediamine, 5 |o/ 37% H2O2 per 10 m/ of 0.1 M Citrate buffer, pH 5,1] 100 |i/률 넣고반응시킨 2.5 N sulfuric add반응을정지시 490 nm에서 ELISA reader(Molecular Devices, Hercules, CA)로측정하였다.

E7, Rb 결함을 이용한 ELISA 미처는 Somatid 영향 -6xHis E7 Maxisorb 96-well plate 4

|ig/m/로 coating PBS/3% skimmed milk 2 시간 동안 blocking하였다. PBST 3 세척 pET28a/Rh로부터 얻은 Rb 상동액을 PBS 8 석한 것을 100 ^/well넣어 1 시간실온에서 반응 시켰다. E7 결합한 Rb mouse anti-Rb antibody(Ab-6) (Oncogene) (0.1 |ig/m/) horseradish phosphatase-conjugated anti-mouse IgG(Sigma) 계속처러한 PBST세척하고기질용액 [4 mg 0-

phenylenediamine, 5 |i/ 37% H2O2 per 10 m/ of O.IM citrate buffer, pH 5.1] 100 |o/를 넣고반응시 2.5 N sulfuric acid 반응을 정지시킨 490nm 에서 ELISA reader(Molecular Devices, Her­

cules, CA)로측정하였다.

Som atid HFV E6, E7 oncogene

m RN A level 미치는 영향 -DMEM/10% FBS 유지시킨 HPV 16 genomei지니고 있는 자궁경부 세포주 CaSki 100 mm petri dish 5X10^10 ml넣은 1동안 CO2 incubator 배양하였다.

새로운 배지로 같아준 800 농도로 희석시킨

Somatid처리한 20시간후 total RNA 추출하여 RT-PCR 수행하였다. E6 primers; 5'GCG GCC GCC ACC ATG IT T CAG GAC CAC AG-3' (sense), 5'-CTG CGG CCG CGA TTA CAG CTG GGT TTT CTCT-3'(antisense), E7 primers; 5'- GCG GCC GCC ACC ATG GCA TGG CAT GGA GAT ACA CCT-3'(sense), 5'-AGG CGG CCG CGA TTA TGG TTT CTG AGA ACA-3'(antisense).

Reverse transcription-polymerase chain reaction (RT-PCR)은 RT-PCR kit(Stratagene)를 이용허며 행하였다. , cDNA 5(Hi/ 반응액 [5|0/ 10X first- strand buffer, 1 [i/ RNase block ribonuclease inhi- bitor(40U/|i/), 2\\l 100mM dNTPs, 11/ MMLV- RT(50U/(1), 5 |i/ RNA, 36 \xl증류수]을 3 7 X에서 1 시간 반응시켜 얻은 다옴, primer 함께 중합반옹을 계속시켜 (95X 1, 57X 1, 그리고 72 X에서 1 30 반응을 30 반복) PCR products 얻어 1% agarose gel확인하였다. 동량의 RNA사용여부 확인하기 위해, house keeping gene p-actin 측정하고자 P-actin primer 다옴과같이 사 §■하였다 : 5'-GTG GGG CGC CCC AGG CAC CA-3' (sense), 5'-CTC CTT AAT GTC ACG CAC GAT TTC-3'(antisense).

실험결과 고찰

자궁경부암세포주의 세포득성 - 자궁경부암 세포주 C-33A, CaSki, SiHa HaCaT keratinocytes So- matid 희석배율 1000 까지 처리한 결과 CaSki 세포주에서 800배부터 가장 민감한 세포득성을 보여 세포의 성정0] 급격하게 감소하는 것을 있었다. 자궁경부암 세포주중에서도 HPV 아닌 다른 원인 의해 세포화된 C-33A 경우 800 배에서도 세포득성이 나타나지 않았으나 500 이상의 농도에 서는 모든 세포주들의 성장이 거의 멈추어 졌다(Fig.

1). 이는 Somatid존재하는특이인자가 HPV virus genome지니고 있는 CaSki, SiHa HaCaT cell

(5)

D ilu tio n F a c to r

Fig. 1 - The cytotoxicity of Somatid on cervical carci­

nomas and HaCaT. Cells seeded at a density of 1 X 10크 on 96-welI were treated with either So­

matid extracts at the given dilution factors in a final volume of 100 |ii DME media and were then allowed to incubate for 24 hrs. The cytotoxicity of Somatid was determined by WST-1 reagent as described in Materials and Method, and expressed as relative percentage to untreated control.

성장을 억제하는 것으로 생각되며 특히 1 6 ty p e

C a S k i 대한 S o m a tid 민감한 성장억제 효과는

S iH a H a C a T차별성을두고 연구가이루어져

되러라 사료된다. H P V ty p e 16 1 8 E 6 /E 7

hum an genital K era tin ocytes 효율적인 im m or- ta liza tio n 밀접한 관련이 있다.^^^ F ig. 1에서 보듯

H P V 양성 세포주에 S o m a tid 효과가 가장

았기 때문에H P V 2개의 발암유전자인 E 6 E 7

세포 내의 단백질 E 6 -A P R b 결합

그돌외 발현 조절에 S o m a tid 미처는 영향을 조사

했다.

S o m a t id E 6A P E 6 b in d in g 미 처 는 - Som atidE 6A PE 6결합에 미치는 영향을 보기위해 in vitro binding E L I S A 수행한 결과

S om atidE 6A PE 6걸합을능도 의존적으로

제하는 것을 있었다(Fig. 2). Fig. 2 나타난

W e s te rn blot 결과(A ) S om atid 전체농도의

1 6 .7 % 첨가 하고 E 6A P E 6결합시켰을

의적으로 억제함을 나타낸다. B에서도 A 마찬가지 반응액 150 S om atid 2 5 |i/(약16.7% > 가하였을 현저한 억제효과틀나타내었다. E 6 단백 질은 C y s-X 2 -C y s -X 2 9 -C y s -X 2 -C y s zin c-fin g er 구조 가지고 있고, 구조의 유지는 단백질의 기능

(A)

(B)

PET28a/E6+ Somatid (25 u l) PET28a/E6+ Somatid ( I2 .5 u l)

PE T28*/E6+ Somatid (6.3 ul)

3 2 X p E T 2 8 a ^

___ I___ I___ I___ I___ I___ I.

0 .0 0 0 .2 0 0 .4 0 0 .6 0 0 .8 0 1 .0 0 1.20 1.40 1.60

OD

Fig. 2 - The effect of Somatid on the in vitro bindings of E6AP and E6 (A) and ELISA based on the binding of E6 and E6AP (B), To investigate the inhibitory effect of Somatid extracts, E6-AP immobilized on resins was incubated with E6 (lane 2) in the presence (lane 3) or absence of Somatid finally diluted 1:60. E6 bound to E6AP was determined by immunoblot assay using antibody which specifically recognized E6. Upper and lower panels represent Coomassie blue staining and immunoblotting, respectively, (lane 1, His Eb in put lane 4, Marker)

필수적이다. 최근에 구조로부터 결합된 Zn"별 방출하거나결합부■위룰불활성화 시킴으로써 E 6S 상으로하는새로운함암제를검색하는방법이 시도되 었다.16) E 7단백질도 E 6 같이 Z in c-fin g er 구조를 가지고 있어 Som atid Zinc-finger구 조 로■부터Zn 방출하거나구조률불힐성 수도있을것으로사료된

. 그러나 Som atid화학적 구조나작용은 아직

고된 없어억제효과의 기전은앞으로 연구해야 과제이다.

Somatid E7 Rb 결합에 머치는 영향 -

Som atidE 7RbS] 결합에 머처는영향을보기위해

in vitro binding E L IS A 수행한 결과 Som atid

E 7R b결합을농도 의존적으로억제하는것을 있었다(Fig. 3). Fig. 3 A 의하면 in vitro

binding에서는 Som atid1.2 5 % (15 |o/) 이상 첨가 였을확실한억제효과를나타내었고, BE L IS A 서는 in vitro binding처럼 확실한 억제효과를 나타낸 것은아니지만유의성 있는억제효과률있었다. 344 영식 . 조정원 . 이경애 . 심정현 . 조민철 . 이홍수 . 염영일 . 김싱범 . 벅순희 . 윤도영

0 0 0 0 0 0

2 0 6 6 4 2

AIX012A0

(6)

E6 E7 빌암두견자의 in vitro binding 미처는생기액의효파 345

(A)

^ IQ1KD 79KD

50.1KD

(B)

p E T /R b + S o m a tld ( 6 .3 u l) L

p E T /R b + S o m a tid (1 2 .5 u l)|

p E T /R b + S o m a tid (2 5 u l) p E T /R b + S o m a tid (5 0 u l)

0 .0 0 0 .2 0 0 .4 0 0 ,6 0 0 ,8 0 1 . 0 0 1 . 2 0 1 . 4 0 1 . 6 0 1 . 8 0 2 .0 0

OD

F ig. 3 - The effect of Somatid on the in vitro binding of G ST E7 and Rb (A), and E L IS A based on the binding of Rb and E7 (B). To investigate the inhibitory effect of Somatid extracts, E7 immo­

bilized on resins was incubated with Rb in the presence or absence of Somatid finally diluted to 1:60 in 1.2 ml of binding buffer. E7-bound Rb was determined by immunoblot assay using antibody which specifically recognized Rb. (A) Upper and lower panels represent Coomassie blue staining and immunoblotting, respectively.

Lane 1, Rb 1/10 input, lane 2 Rb, 200 \il; lane 3- 7, Rb 200 |i/ along w ith increasing doses of 5, 10, 15, 20 and 50 \jd of Somatid extracts; lane 4, Marker. (B) E 7 was coated on the 96 well plates and blocked with 3% milk-PBS. Then serial dilutions of Rb lysates were incubated for 1 hr.

A fter washing w ith PBST, anti-Rb antibody was added, followed by horseradish peroxidase conjugated to secondary antibody. The bound enzyme activity was detected by E L IS A reader after adding substrate.

S o m a t i d H P V o n c o g e n e E 6 , E 7 m R N A l e v e l 미 처 는 영 향 - S om atid E 6 , E 7 m R N A

미처는 영향을 보기위해 R T -P C R 수행한 걸과

Som atid H P V o n c o g e n e E 6 E 7 m R N A 저해하는 것을 있었다(Fig. 4). C a S k i C e lls 800배로 Som atid처리 하였을 m R N A le v e l

저해됨을 확인있었다.

결론적으로 Som atid E 6 E 7 전사를감소시

키고또한 E 6 -E 6A P E 7 -R b 결합반옹을 방해하늬

세포의불멸화에필요한세포내외 단백질의 번화를 제함으로써 H P V 양성인자궁경부암세포에 특이적으 득성을나타낼 있다.

E 9 E 3 3-actin

F ig. 4 - T he effect of Somatid on the expression level of H P V E 6 (A) and E7 (B) m R N A in cervical carcinoma CaSki cells. Cells at a confluence of 80% were treated w ith Somatid diluted 1:400. 18 hr after incubation, Total RNAs was extracted from CaSki cells after overnight incubation and their expression levels of E 6 and E7 were examined by RT-PCR using specific primers for E 6 and E7 as described in M aterials and Methods. 1. M arker (1 kb ladder), 2. untreated, 3.

Somatid)

자궁경부암은 매년 50만명 정도씩 사망하는 여성의 치명적인 사망 원인의 하나이다. 인두유중

바어러스(H P V ) 1 6 1 8형과 자궁경부암과의

밀한 관련성은 알려져 있다. 천연물혼합추출물 일명 생기액(S o m a tid ) H P V 1 6형의 E 6 , E 7 암유전자를 억제하는지 여부률 측정하였다.

S om atid자궁경부암세포주(C -3 3 A , S iH a, C a S k i)

H a C a T k e r a t in o c y t e s 분열은 농도 의존적으로 억제하였다- In vitro b in d in g a s s a y E L I S A(효 소면역측정법)에 의하면 S o m a tid 억제인자인

p 5 3 결합초! 분해시키는데 필수적인 E 6 E 6 A P

와의 결합도 억제할 뿐더러 암억제인자 R b E 7 결합을 억제하였다. R T - P C R 의하면 S o m a tid

의해 E 6 E 7 m R N A l e v e l 감소하였옴을

보여 주었다. 이들 결과에 외하면 S o m a tid H P V

1 6형의 E 6E 7 발암성을 억제함을 보여 주므로

H P V 의해 유도된 자궁경부암외 치료에 유효할

것으로 사료되어 자세한 in vitro in

IliiIIIIP IPSP

(7)

346 영식조정원이경애심정현조민철이홀수염영일김성범벅순희윤도■영

vivo 실 험 동 이 요 구 된 다.

감사의 말씀

연 구 는 과 기 부 외 분 자 의 과 학(98-J03-02-02-A - 0 3)과 국 제 공 동 과 제 (103-008)로 부 터 지 원 을 받 아 실 행 하 였 다.

1) 0#1=. : « § . 고문사, 서울 (1987).

2) Schef&ier, M ., Munger, K., Byrne, J.C. and Howley, R M . : T h e state of the p53 and retinoblastoma genes in human cervical carcinoma cell lines. Proc. Natl Acad. Sci., 8 8 , 5523 (1991).

3) Is fo r t, R. J., Cody, D. B., Lovell, G , and Doersen, C, J. : Analysis of oncogenes, tum or suppressor genes, autocrine growth-fector production, and differentiation state of human osteosarcoma cell lines. Mol Carcinog., 14, 170 (1905).

4) Yang, X., Nakao, Y., Pater, M . M ., Tang, S. C. and Pater, A.: Expression of cellular genes in H P V 1 6 - immortalized and cigarette smoke condensate- transformed human endocervical cells. J. Cell Biochem., 6 6 , 309 (1977).

5) Yang, X., Sham, J. S., Ng, M . H ., Tsao, S. W , Zhang, D., S. W. L and Cao, L. : L M P l of epstein-barr virus induces proliferation of prim ary mouse embryonic fibroblasts and cooperatively transforms the cells w ith a p l 6-insensitive C D K 4 oncogene./. ViroL,74, 883 (2000).

6) Garbe, J., Wong, M ., Wigington, D,, Yaswen, R and Stampfer, M . R. : Yiral oncogenes accelerate conver­

sion to imm ortality of cultured conditionally immortal human mammary epithelial cells. Oncogene, 18, 2169 (1999).

7) Henkler, E E and Koshy, R. : Hepatitis B virus transcriptional activators: mechanisms and possible

role in oncogenesis. J. Viral Hepat.,3, 109 (1996).

8) Shackney, S. E. and Shankey, T. V : Cell cycle models for molecular biology and molecular oncology : exploring new dimensions. Cytometry,35, 97 (1999).

9) Reddy, K. B., Keshamouni, V G .and Chen, Y. Q. : T he level of tyrosine kinase activity regulates the expression of p 2 1 /W A F l in cancer cells. Int J. Oncol, 15, 301 (1999).

10) Tommasino, M . and Crawford, L. : Human papil­

lomavirus E 6 and E7: proteins which deregulate the cell cycle. Bioessays, 17, 509 (1995).

11) Woodworth, C. D., Cheng, S., Simpson, S., Hamacher, L., Chow, L. T , Broker; T. R. and DiPaolo, J. A, : Recombinant retroviruses encoding human papilloma­

virus type 18 E6 and E7 genes stimulate proliferation and delay differentiation of human keratinocytes early after infection. Oncogene, 7, 619 (1992).

12) Dyson, N., Howley, P M ., Munger, K. and Harlow, E.

: T he human papilloma virus-16 E 7 oncoprotein is able to bind to the retinoblastoma gene product.

Science, 24 3 , 934 (1989).

13) Marchuk, D., Drum m , M ., Saulino, A. and Collins, E S. : Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res., 19(5), 1154 (1990).

14) Cho, Y. S., Cho, C. W , Joung, 0 ., Lee, K. A., Park, S.

N . and Yoon, D . Y. : Development of screening systems for drugs against human papillomvirus- associated cervical cancer: based on E 6-E 6-AP binding. Antiviral Res., in press (2000).

15) Pei, X . F. : T he human papillomavirus E 6 /E 7 genes induce discordant changes in the expression of cell growth regulatory proteins. Carcinogenesis, 1 7 ,1 3 9 5 (1996).

16) Beerheide, W , Bernard, H . U., Tan, Y. J., Ganesan, A., Rice, W. G., and Ting, A. E. : Potential Drugs Against Cervical Cancer: Zinc-Ejecting Inhibitors of the Human Ipillomavirus Type 16 E 6 Oncoprotein.

J. N atl Cancer Institute, 91(14), 1211 (1999).

수치

Fig.  1  -  The  cytotoxicity  of  Somatid  on  cervical  carci­

참조

관련 문서

2재화 2요소 헥셔-올린 모형에서는 어느 한 경제에서 어느 한 요소의 양이 증가하면, 그 요소를 집약적으로 사용하는 산업의 생산량은 증가하고 다른

• Common polymorphism in MAO-A gene resulting in relatively low-activity enzyme, has been associated with increased risk for violent or antisocial behavior as well as for

웹 표준을 지원하는 플랫폼에서 큰 수정없이 실행 가능함 패키징을 통해 다양한 기기를 위한 앱을 작성할 수 있음 네이티브 앱과

_____ culture appears to be attractive (도시의) to the

이하선의 실질 속에서 하악경의 후내측에서 나와 하악지의 내측면을 따라 앞으로 간다. (귀밑샘 부위에서 갈라져 나와

If the volume of the system is increased at constant temperature, there should be no change in internal energy: since temperature remains constant, the kinetic

Continued to the entropy cycle and energy balance with entropy changes. Reversible cycle consisting of two isothermal branches, AB and CD, and two isentropic branches,

In view of the essential relevance of mission in history (and not only in the history of religion), on the one hand, and in theology (and not only in missiology),