• 검색 결과가 없습니다.

Anti-Inflammatory Effects of the Mixture of Sorbus commixta, Urtica dioica, Phyllostachys nigra, and Rhus semialata Gall Extracts on LPS-induced Inflammation in HaCaT Cells

N/A
N/A
Protected

Academic year: 2021

Share "Anti-Inflammatory Effects of the Mixture of Sorbus commixta, Urtica dioica, Phyllostachys nigra, and Rhus semialata Gall Extracts on LPS-induced Inflammation in HaCaT Cells"

Copied!
10
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

Vol. 40, No. 1, March 2014, 45-54 http://dx.doi.org/10.15230/SCSK.2014.40.1.45

각질형성세포에서 LPS로 유도된 염증반응에 대한 마가목, 쐐기풀, 죽여 및 오배자 혼합추출물의 항염 효과

이 경 은⋅남 진 주⋅김 선 미⋅김 한 곤⋅문 성 준⋅염 종 경

코스맥스(주) R&I Center

(2013년 9월 12일 접수, 2013년 9월 27일 수정, 2013년 10월 25일 채택)

Anti-Inflammatory Effects of the Mixture of Sorbus commixta, Urtica dioica, Phyllostachys nigra, and Rhus semialata Gall Extracts on LPS-induced Inflammation in HaCaT Cells

Kyung-Eun Lee, Jin-Ju Nam, Seon-Mi Kim, Han-Kon Kim, Seong-Joon Moon, and Jong-Kyung Youm

Cosmax R&I Center, Pangyo innovalley E 603, 255, Pangyo-ro, Bundang-gu, Seongnam-si, Gyeonggi-do, Korea (Received September 12, 2013; Revised September 27, 2013; Accepted October 25, 2013)

요 약: 각질형성세포주인 HaCaT세포에서 Lipopolysaccharide (LPS)로 유도하는 염증반응에는 tumor neu- rosis factor-α (TNF-α), interleukin-1α (IL-1α), interleukin-6 (IL-6), 및 interleukin-8 (IL-8) 와 같은 염증 유발 사이토카인(pro-inflammatory cytokines)이 증가되고, 또한 염증반응을 매개하는 in- ducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2) 및 prostaglandins E2 (PGE2)도 증 가된다. 본 연구에서는 이렇게 유도된 염증 반응에서 효과적으로 염증 관련인자를 조절할 수 있는 천연물을 발굴 하고자 하였다. 그 결과, 마가목, 쐐기풀, 죽여 및 오배자 혼합 추출물이 IL-1α, TNF-α, IL-6 및 IL-8의 발현을 억제하고 COX-2, iNOS 및 PGE2의 발현도 억제함을 확인하였다. 아울러 IQ chamber

을 이용하여 피부에 첩포할 때 sodium lauryl sulfate (SLS)로 유발한 피부자극에서 이들 혼합물이 효과적으로 그 자극을 억제함을 확인하였다. 따라서 본 연구 결과로부터 마가목, 쐐기풀, 죽여 및 오배자의 혼합물이 피부자극완화용 화장품 소재로서 민감성 피부 등을 위한 제품에 유용하게 사용될 수 있음을 확인하였다.

Abstract: Lipopolysaccharide (LPS)-induced inflammatory responses in the HaCaT keratinocyte cell line produce proin-

flammatory cytokines, such as interleukin-1α(IL-1α), tumor neurosis factor-α (TNF-α), interleukin-6 (IL-6), and in- terleukin-8 (IL-8) and also increase the expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and prostaglandins E2 (PGE2). In this study, we developed new natural ingredients for cosmetics that inhibit the pro-in- flammatory responses induced by LPS in HaCaT cells. The mixture of Sorbus commixta (SC), Urtica dioica (UD),

Phyllostachys nigra (PN), and Rhus semialata gall (RS) extracts blocked the increase of TNF-α IL-1α IL-6, and IL-8.

The increase of COX-2, iNOS, and PGE2 were also blocked by it. Finally, the mixture inhibited skin irritation induced by sodium lauryl sulfate (SLS), when applied on skin through IQ chamber

. In conclusion, these results show that the mixture of SC, UD, PN, and RS can be used as a primary ingredient to alleviate skin irritation when cosmeceutical products are developed for sensitive skin.

Keywords: anti-inflammation, skin irritation, pro-inflammatory cytokine, iNOS, PGE2

1)

† 주 저자 (e-mail: [email protected])

(2)

1. 서 론

피부의 중요한 기능 중 하나는 외부 환경으로부터 신체를 보호하고, 내부 체액의 소실을 막는 장벽기능 을 제공하는 것이다. 또한, 자외선, 독성 물질, 미생물 또는 물리적 자극 등의 외부 유해인자들에 대한 장벽 기능도 수행하고 있다. 이러한 피부장벽 기능이 피부 내외부의 다양한 자극에 의해 손상되면 피부가 건조 해지거나 가려움 및 염증반응을 일으키게 된다[1-5].

흔히 사용하는 화장품이나 세정제 등은 유화제 또는 계면활성제, 알코올, 보존제, 향 등으로 인해 피부자극 을 유발할 수 있고, 최근에는 파라벤 프리 처방에 사 용하는 대체원료 등이 자극을 유발하는 경우가 많다.

이러한 피부 자극은 각질형성세포(keratinocyte)의 구 조적인 변화와 함께 interleukin-1α (IL-1α), tumor neurosis factor-α (TNF-α), interleukin-6 (IL-6), inter- leukin-8 (IL-8)와 같은 염증 유발 사이토카인(pro-in- flammatory cytokines)의 분비를 유도하고, 심한 경우에 는 피부염으로 악화될 수 있다[6,7]. 특히 IL-1α와 TNF-α는 초기 자극에 대한 중요한 염증 유발인자로 서 분비되고, 이어 IL-6과 IL-8의 발현을 유도하여 자 극으로 인한 일련의 염증반응을 유도한다[8-10].

한편, inducible nitric oxide synthase (iNOS)와 cyclo- oxygenase-2 (COX-2)는 각각 nitric oxide (NO) 및 pros- taglandin E2 (PGE2)를 생성하여 염증반응을 일으킨다.

iNOS에 의해 생성된 NO는 조직 손상, 유전자 변이 등 의 염증을 유발하고, 염증반응 부위에서 발견되는 COX-2는 염증 유발 사이토카인, 세포성장인자, 암세 포촉진인자, 활성산소종(reactive oxygen species, ROS) 등에 의하여 일시적으로 발현되어 염증 매개물질인 PGE2를 형성시킨다[11-14]. 따라서 이러한 염증 매개 물질들은 in vitro에서의 피부자극 연구에서 중요 bio- marker로 사용되고 있다. Lipopolysaccharide (LPS)는 그람 음성세균(gram-negative bacteria)의 세포 외막에 존 재하는 내독소로써 대식세포(macrophage)로부터 TNF- α, IL-6, IL-1과 같은 염증 유발 사이토카인과, 염증성 매개물질인 NO를 만드는 iNOS의 발현을 유도한다 [15,16]. 또한, 표피에서 LPS 자극은 대식세포와 단핵 세포의 진입을 유도하여 염증성 매개체인 PGE2의 발 현을 촉진한다[17,18].

보다 안전한 화장품을 개발하기 위한 노력은 지속

적으로 이루어져 왔다. 이를 위해 피부자극과 염증 발 생을 억제하는 천연물 유래의 소재는 화장품 소재로 서 많은 이점을 제공한다. 따라서, 피부 자극에 따른 초기 염증 유발 인자를 타겟으로 새로운 자극 완화 소 재를 개발함으로써 보다 안전한 화장품을 개발할 수 있을 것으로 기대된다. 이에 본 연구에서는 피부자극 으로 인해 증가되는 대표적인 염증 유발 사이토카인 및 그 외 염증 매개 효소의 발현을 억제시킴으로써 결 과적으로 자극완화에 효능 있는 천연 소재를 발굴하 고자 하였다. 이를 위해 문헌조사를 통해 확보한 약 60여 종의 항염 소재에 대하여 3-[4,5-dimethylthiazol- 2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay를 통 한 독성 평가, 2,2-diphenyl-1-picrylhydrazyl (DPPH) 라 디컬 소거 효과, NO 생성 억제 효과, IL-1α, TNF-α, IL-6, 및 IL-8의 염증 유발 사이토카인 생성 억제 효과 등을 통해 최종적으로 4가지 원료를 선정하였고, 이들 원료에 대한 혼합물을 조합하여, 이의 항염증 효능을 확인하였다. 또한, 최종적으로 선정된 혼합물에 대한 피부자극 완화시험을 실시하였다.

2. 재료 및 실험

2.1. 식물재료 및 시료 추출물의 제조

마가목(Sorbus commixta, SC)의 수피, 쐐기풀(Urtica dioica, UD)의 잎, 죽여(Phyllostachys nigra, PN) 및 붉 나무의 충영인 오배자(Rhus semialata gall, RS)의 개별 원료 분말을 각각 100 g씩 취하여 각각 별개의 용기에 넣고, 추출용매로서 70% 에탄올 수용액 1 L에 침적하 24 h 동안 실온에 방치하여 추출액을 얻었다. 얻어 진 추출액을 여과지를 이용하여 여과를 한 다음, 여액 을 회전식 증발 건조기로 감압 농축하여 각각의 농축 추출물을 얻었다.

2.2. 세포배양

Cell lines service (Eppelheim, Germany)로부터 human keratinocyte cell line인 HaCaT를 구입하였다. 세포는 penicillin (100 units/mL) / streptomycin (100 µg/mL)과 10% FBS가 함유된 Dulbecco’s Modified Eagle Medium (DMEM, Thermo, USA) 배지를 사용하여 37 ℃, 5%

CO

2

incubator에서 배양하였으며, 2 - 3일 간격으로 계 대 배양을 시행하였다.

(3)

Gene Direction Sequence (5’-3’) Size (bp) TNF-α Forward

Reverse

AGCCCATGTTGTAGCAAACC

GGAAGACCCCTCCCAGATAG 335 IL-6 Forward

Reverse

TACCCCCAGGAGAAGATTCC

TTTTCTGCCAGTGCCTCTTT 175 IL-8 Forward

Reverse

CCAACACAGAAATTATTGTAAAGC TGAATTCTCAGCCCTCTTCAA 113 IL-1α Forward

Reverse

TGGCTCATTTTCCCTCAAAAGTTG AGAAATCGTGAAATCCGAAGTCAAG 171 COX-2 Forward

Reverse

TGAGCATCTACGGTTTGCTG

TGCTTGTCTGGAACAACTGC 158 iNOS Forward

Reverse

CATGCTACTGGAGGTGGGTG

CATTGATCTCCGTGACAGCC 197 β-actin Forward

Reverse

GGCCATCTCTTGCTCGAAGT

GAGACCTTCAACACCCCAGC 312 Table 1. Primers Used for Real-Time PCR

Symbol Grade Clinical observation

+ 1 Slight erythema, either spotty or diffuse ++ 2 Moderate uniform erythema

+++ 3 Intense erythema with edema

++++ 4 Intense erythema with edema & vesicles

Table 2. Criterion about the Response after Human Skin

Irritation Test

2.3. MTT 분석을 이용한 세포 생존율 측정

마가목, 쐐기풀, 죽여, 오배자 추출물의 HaCaT cell 에 대한 독성 평가를 위해 MTT assay를 수행하였다.

HaCaT 세포는 96 well plate에 2 × 10

4

cells/well 농도 로 분주하고 24 h 후에 혈청제거(serum free) 배지로 교환한 후, 각각의 추출물을 1, 10, 50, 100 µg/mL 처 리하여 24 h 동안 배양하였다. 이후에 0.5 µg/mL 농도 MTT (Sigma, USA) 용액 20 µL을 각각의 well에 첨 가하고 4 h 결정화한 후 dimethyl sulfoxide (DMSO, sigma, USA)에 용해하여 540 nm에서 흡광도를 측정하 였다.

2.4. RNA 분리 및 real-time PCR

HaCaT 세포를 5 × 10

5

으로 6 well plate에 분주하고 24 h 배양한 후 LPS 0.5 µg/mL과 각 시료를 처리하고 4 h 동안 배양하였다. Total RNA를 추출하기 위해 각 well에 RNA iso (TAKARA, Japan) 1 mL을 첨가하고 얼음 위에서 5 min을 방치하여 세포를 용해시키고 chloroform 200 µL을 첨가하여 14,000 rpm에서 15 min 동안 원심분리하였다. 상층액을 취하여 새로운 tube에 옮기고 같은 양의 isopropanol을 첨가한 후 14,000 rpm 에서 10 min 동안 원심분리하여 RNA를 분리하였다.

99% ethanol로 7,500 rpm에서 원심분리하여 세척한 후 1회 더 세척하고 공기 중에서 건조시킨 후 diethylpyr- ocarbonate (DEPC) water에 녹였다. Nanodrop 2000 (Thermo, USA)를 이용해 RNA를 정량하였고, total RNA 2 µg을 DEPC와 함께 70 ℃에서 5 min 동안 가열 시킨 후 oligo (dT)를 포함한 Reverse Transcription Premix (ELPIS-Biotech, Korea)에 넣고 최종 부피가 20 µL가 되도록 하였다. 42 ℃에서 55 min, 70 ℃에서 15 min 동안 반응시켜 cDNA를 합성하여 polymerase chain reaction (PCR)에 사용하였다. 얻어진 cDNA로부 터 TNF-α, IL-6, IL-8, IL-1α, COX-2, iNOS, β-actin 을 증폭시키기 위해 DEPC로 5배 희석시킨 cDNA 2 µL를 primer 0.5 µL, DEPC water 7 µL, SYBR green Master Mix (Invitrogen Life Technology, USA) 10 µL와 함께 StepOne Plus Real-Time PCR system (Applied Biosystems, USA)을 이용하여 PCR을 실시하였다. 반 응 조건은 50 ℃ 2 min, 95 ℃ 10 min에서 반응 후 95

10 s와 60 ℃ 1 min을 40회 반복하여 증폭시켰다.

증폭하고자 하는 유전자들의 primer 염기서열은 Table

1과 같다.

2.5. Enzyme-linked immunosorbent assay (ELISA) HaCaT 세포를 2 × 10

5

으로 12 well plate에 분주하고 24 h 배양한 후 LPS 0.5 µg/mL를 전처리하고 3 h 뒤 시료를 처리하여 20 h 추가 배양하였다. 배지를 회수 하여 15,000 rpm 20 min간 원심분리하여 상등액을 취 한 후, prostaglandin E2 Immunoassay kit (R&Dsystems, USA)의 시료로 사용하였다. 각 실험군의 PGE2양은 ELISA를 이용하여 540 nm에서 측정하였으며, 표준 농 도 곡선은 PGE2 샘플을 단계적으로 희석하여 얻었다.

2.6. 피부 자극 시험

피시험자 총 31명이 시험 과정에 참여하였으며, 평 균연령은 32.4 ± 3.1세였다. 70% ethanol로 시험 부위

(4)

Figure 1. Inhibitory effects on pro-inflammatory cytokines mRNA expression in HaCaT cell. (a) IL-1α, (b) TNF-α, (c) IL-6,

and (d) IL-8 were evaluated by real-time PCR. HaCaT cells were treated with same concentration (10 µg/mL) of each extract and LPS (0.5 µg/mL) for 4 h. Values are relative to the control. *p < 0.05, **p < 0.01 indicate a significant difference from the LPS-treated control. SC: Sorbus commixta, UD: Urtica dioica, PN: Phyllostachys nigra, RS: Rhus semialata gall.

를 세척하고 건조시킨 후, IQ chamber

(Chemotechni- que Diagnostics, Sweden)를 이용하여 팔 전박 부위에 피부 첩포시험(Patch Test)을 실시하였다. 피부 첩포는 24 h 동안 진행하고, 첩포를 제거한 후에는 marking pen으로 시험부위를 표시하여 각각 30 min, 24 h에 시 험부위의 피부자극 여부를 판정하였다. 0.1%의 so- dium lauryl sulfate (SLS)와 함께 각 원료 1%를 20 µL 씩 IQ chamber

내에 적하시킨 후 동시에 첩포한 후 micropore tape으로 고정시켰다. 혼합물의 경우 최종 농도 1%가 되도록 세포 시험과 같은 비율로 첩포하였 다. 위 시험법은 Frosch & Kligman, CTFA guideline에 제시된 terminology에 의거하여 검사하였다[19,20]. 피 부 첩포시험 결과 판정표(Table 2)에 따라 자극유무를 판정하였고, 평균 피부반응도(Mean score)는 아래의 일반적인 계산공식에 따라 산정하였다. 본 실험은 기 관생명윤리위원회의 심의를 거쳐 규정에 맞게 시행 되었으며, 각각의 지원자들에게 알맞은 설명 후 서명

을 받고 진행되었다.

Mean Score

(MS) = (Score × No. of responders) × 100 4 (Maximum Score) × No. of total subjects × No. of evaluation

2.7. 통계처리

모든 통계분석은 t-test를 실시하여 평가하였다. 두 군 간의 차이에 의한 통계적 검정 후 p 값이 0.05 이하 인 경우를 통계적으로 의미있는 차이가 있다고 판단 하였다.

3. 결 과

3.1. 원료 선정 및 pro-inflammatory cytokine 발현 억 제 효과

문헌에서 확인된 약 60여 종의 항염소재에 대해 먼 저 keratinocyte에 대한 세포 독성시험, DPPH 라디컬

(5)

Name SC:UD:PN:RS

#1 1:1:1:1

#2 2:1:1:1

#3 1:2:1:1

#4 1:1:2:1

#5 1:1:1:2

* SC: Sorbus commixta, UD: Urtica dioica, PN: Phyllostachys nigra, RS: Rhus semialata gall

Table 3. Ratio of 4 Extracts Mixture

Figure 2. Anti-inflammatory effects on mixing ratio of 4

extracts in HaCaT cell. (a) IL-1α and (b) TNF-α were evaluated by real-time PCR. HaCaT cells were treated with final concentration (10 µg/mL) of each mixture and LPS (0.5 µg/mL) for 4 h. Values are relative to the control. *p

< 0.05, **p < 0.01 indicate a significant difference from the LPS-treated control.

소거능, NO 생성 억제 효과를 실시하였고, 세포 독성 이 없고, 항산화 효능 및 NO 생성을 억제하는 33종의 소재를 선별하였다(결과 생략). 이어 선별된 33종에 대하여 LPS로 유도한 IL-1α, TNF-α, IL-6, 및 IL-8 등 의 염증 유발 사이토카인의 발현에 대한 평가를 실시 하였다(결과 생략). 그 결과, Figure 1전에 나타낸 것과 같이 각 사이토카인에서 LPS 처리 시 증가하는 mRNA의 발현을 유의하게 억제시키는 마가목, 죽여, 쐐기풀, 오배자 추출물을 발굴하였다(p < 0.01). 이에 마가목, 쐐기풀, 죽여, 오배자 추출물을 피부자극완화 를 위한 항염소재로서 선정하여, 본 4종의 혼합물에 대한 항염 및 피부자극완화 효과에 대한 평가를 진행 하였다.

3.2. 혼합 비율에 따른 항염효과

4가지 원료의 혼합에 대한 최적 혼합 비율을 찾기 위해서 자극에 대한 초기 염증 유발 사이토카인인 IL- α와 TNF-α의 발현 억제 효과를 real-time PCR을 통 해 확인하였다. 최종 처리 농도는 10 µg/mL로 4가지 원료를 Table 3과 같은 비율로 혼합하여 시행하였고, LPS로 유발한 IL-1α와 TNF-α의 발현 정도를 확인한 결과, 마가목, 쐐기풀, 죽여, 오배자의 비율이 1:1:1:1 (#1)과 1:1:1:2(#5)인 경우에 LPS 단독 처리 군과 유의 한 차이를 보였고(p < 0.01), 그중 #5에서 가장 큰 저해 효과를 나타냈다(Figure 2).

3.3. 혼합물의 농도별 항염효과

다음으로 IL-1α와 TNF-α에 대한 항염 효과가 높 은 혼합 비율에 맞춰 혼합 추출물을 제조한 후, 염증 유발 사이토카인에 대한 농도에 따른 효과를 평가하

였다. 그 결과, LPS로 유발한 IL-1α, TNF-α, IL-6, IL-8 모두에서 본 혼합 비율에 따른 혼합물을 처리 시 농도 의존적으로 유의한 발현 억제 효과를 확인할 수 있었다(p < 0.01). 또한, IL-8, TNF-α, IL-1α, IL-6의 순으로 발현 억제 효과가 높게 나타났다(Figure 3).

3.4. 혼합물의 염증 유발 효소에 대한 발현 억제 효과 이어 염증 유발 효소인 COX-2와 iNOS에 대한 혼합 물의 영향을 평가하였다. 상기 혼합 비율에 따른 혼합 물을 1, 10 µg/mL의 농도로 LPS 0.5 µg/mL와 함께 각 질형성세포에 처리한 후 COX-2, iNOS의 발현정도를 real-time PCR를 이용하여 측정하였다. HaCaT 세포에 LPS를 처리하였을 때 COX-2와 iNOS의 mRNA 발현 양이 각각 3.15배, 2.05배 정도 증가하였고, 혼합물 처 리에 따라 농도 의존적으로 유의한 발현 억제 효과를

(6)

Figure 3. Anti-inflammatory effects of the mixture on pro-inflammatory cytokines mRNA expression in HaCaT cell. (a) IL-1α,

(b) TNF-α, (c) IL-6, and (d) IL-8 were evaluated by real-time PCR. HaCaT cells were treated with different concentration (1, 10 µg/mL) of the mixture and LPS (0.5 µg/mL) for 4 h. Values are relative to the control. *p < 0.05, **p < 0.01 indicate a significant difference from the LPS-treated control.

Figure 4. Inhibitory effects of mixture on (a) COX-2, (b) iNOS, and (c) PGE2 expression. (a) COX-2 and (b) iNOS were

evaluated by real-time PCR and (c) PGE2 were evaluated by ELISA. Values are relative to the control. *p < 0.05, **p < 0.01 indicate a significant difference from the LPS-treated control.

확인하였다(Figure 4a, b, p < 0.01).

또한, COX-2의 발현 억제와 함께 PGE2의 발현도 감소하는지 확인하기 위해 LPS 처리에 따른 PGE2 발 현량을 ELISA 방법으로 평가하였다. COX-2는 염증 매개물질인 PGE2 발현을 유도한다[14]. 그 결과 1, 10

µg/mL의 혼합물을 처리하였을 때 PGE2 발현양이 농 도 의존적인 감소를 보였다(Figure 4c).

3.5. 피부자극실험

끝으로 본 혼합물에 대한 피부자극 완화효과에 대

(7)

Figure 5. Skin irritation test of SC, UD, PN, RS extracts,

and those mixture by primary human skin irritation test. SC:

Sorbus commixta, UD: Urtica dioica, PN: Phyllostachys nigra, RS: Rhus semialata gall.

해 평가하였다. 이를 위해 피부 자극 물질로서 SLS를 처치하였고, 혼합물과 함께 IQ chamber

를 이용한 피 부 첩포 시험을 실시하였다. 그 결과, 각각의 단일 천 연물을 처리하였을 때 보다 4종의 혼합물을 처리하였 을 때 가장 높은 자극 완화 효과를 나타냈다. 따라서, 앞서 실험 결과와 함께 종합적으로 볼 때 본 연구에 따른 4종의 혼합물은 제품에 적용될 시 피부자극 완 화 효과를 줄 것으로 기대된다(Figure 5).

4. 결론 및 고찰

본 연구는 각질형성세포에 LPS를 처리 시 염증 유 발인자가 증가함을 확인하고, 동일 실험 조건에서 염 증 유발인자의 발현을 효과적으로 억제함으로써 외부 자극에 의해 유발되는 피부자극 및 피부염의 발생을 억제하거나 개선시키는 화장품 소재를 개발하고자 하 였다. 이를 위해 먼저 문헌적으로 항염 효과가 있는 것으로 보고된 약 60여 종의 천연물 소재를 확보한 후 세포독성 여부, DPPH 라디컬 소거능, NO 생성 억제 능, 염증 유발 사이토카인의 발현 억제능 등에 대한 평가를 실시하였고, 최종적으로 염증 유발 사이토카 인으로서 IL-1α, TNF-α, IL-6 및 IL-8에 대해 유의한 억제효능을 보인 마가목, 쐐기풀, 죽여 및 오배자 추 출물 등 4종의 효능 원료를 발굴하였다. 또한, 이들 천 연물을 조합한 혼합물에 대해서 염증 유발 사이토카 인의 발현이 유의하게 억제되고, 염증 반응을 유도하 COX-2, iNOS 및 PGE2의 발현도 유의하게 억제됨

을 확인하였다. 최종적으로는 피부 첩포 시험을 통해 SLS로 유도한 피부자극에서 피부자극 유발을 효과적 으로 억제함을 확인하였다.

표피의 가장 바깥층인 각질층(stratum corneum)은 외부 유해 물질의 침입을 막는 장벽으로서 중요한 기 능을 한다. 그러나 다양한 외부 유해물질이나 물리적 자극에 의해 각질층이 손상되거나, 자외선 등에 의해 피부 자극을 받게 되면, 각질형성세포(keratinocyte) 내 에서 염증 반응을 유도하는 사이토카인을 발현하여 분비하게 된다[21]. 이때 외부 자극에 대해 초기에 분 비되는 대표적인 염증 유발 사이토카인으로 IL-1α와 TNF-α가 있다. 이들 사이토카인은 다음 단계로서 IL-6 및 IL-8 등의 염증 유발 사이토카인의 분비를 유 도한다. 이렇게 분비된 각 사이토카인들은 면역세포 T-cell 및 B-cell의 분화를 유도하고, 혈관 확장을 유 도하는 PGE2의 발현을 증가시키며, 염증 반응을 매개 하는 여러 케모카인들의 발현을 유도한다[1]. 이에 본 연구에서는 피부 자극 시에 초기 염증 유발 사이토카 인인 IL-1α, TNF-α, IL-6 및 IL-8의 발현을 억제하는 데 초점을 두고, 이에 효과적인 천연물을 발굴하고자 하였고, 염증 유발의 초기 작용기전을 억제함으로써 피부자극 완화효과를 줄 수 있을 것으로 기대하였다.

이를 위해 각 사이토카인 별로 발현 억제효과가 높았 던 천연물을 선택하여 최종적으로 마가목, 쐐기풀, 죽 여 및 오배자 추출물 등 총 4종의 천연물을 발굴하였 다. 이어 외부 자극 물질에 의한 염증 유발 과정의 개 시 인자인 IL-1α과 TNF-α[22,23]을 억제하는 최적 혼합 비율을 찾은 후 혼합물에 대한 각 사이토카인 별 로 발현 억제효과를 확인한 결과, 모든 사이토카인에 대해 매우 유의한 억제효과를 확인할 수 있었다. 또 한, 최적 조합에 따른 4종의 혼합물은 대표적인 염증 유발 효소인 COX-2, iNOS 및 PGE2에 대해서도 유의 한 억제효과를 보였다. 마지막으로 피부자극시험을 통해서 최적 조합에 따른 4종의 혼합물이 단일 천연 물보다 자극완화효과가 높음을 확인하였다.

따라서, 본 연구에서와 같이 초기 염증 유발 사이토 카인을 타겟으로 항염 및 자극완화 소재를 발굴하는 방법은 새로운 소재 개발을 위해 매우 유용한 방법에 하나로 제안될 수 있다고 생각된다. 아울러 본 연구로 개발된 마가목, 쐐기풀, 죽여 및 오배자의 혼합 추출물 은 피부염 유발을 억제하고, 민감성 피부 등을 위한 자

(8)

극완화용 화장품 소재로서 유용할 것으로 기대된다.

감 사

본 연구는 보건복지부 보건의료연구개발사업의 지 원에 의하여 이루어진 것임(과제 고유번호: A103017).

Reference

1. T. Welss, D. A. Basketter, and K. R. Schröder, In vitro skin irritation: facts and future. State of the art review of mechanisms and models, Toxicol. In Vitro,

18(3), 231 (2004).

2. A. M. Goldstein and W. Abramovits, Ceramides and the stratum corneum: structure, function, and new methods to promote repair, Int. J. Dermatol., 42(4), 256 (2003).

3. C. Lynde, Moisturizers for the treatment of in- flammatory skin conditions, J. Drugs Dermatol.,

7(11), 1038 (2008).

4. M. Yeom, S. H. Kim, B. Lee, J. J. Han, G. H.

Chung, H. D. Choi, H. Lee, and D. H. Hahm, Oral administration of glucosylceramide ameliorates in- flammatory dry-skin condition in chronic ox- azolone-induced irritant contact dermatitis in the mouse ear, J. Dermatol. Sci., 67(2), 101 (2012).

5. M. Denda, L. C. Wood, S. Emami, C. Calhoun, B.

E. Brown, and P. M. Elias, The epidermal hyper- plasia associated with repeated barrier disruption by acetone treatment or tape stripping cannot be attrib- uted to increased water loss, Arch. Dermatol. Res.,

288(5-6), 230 (1996).

6. H. Y. Thong and H. I. Maibach. Irritant dermatitis as a model of inflammation, Drug Discovery Today:

Disease Mechanisms, 5(2), 221 (2008).

7. J. L. Wilmer, F. G. Burleson, F. Kayama, J. Kanno, and M. I. Luster, Cytokine induction in human epi- dermal keratinocytes exposed to contact irritants and its relation to chemical-induced inflammation in mouse skin, J. Invest. Dermatol., 102(6), 915 (1994).

8. J. E. Sims, M. A. Gayle, J. L. Slack, M. R.

Alderson, T. A. Bird, J. G. Giri, F. Colotta, F. Re, A. Mantovani, K. Shanebeck, K. H. Grabstein, and S. K. Dower, Interleukin 1 signaling occurs ex- clusively via the type I receptor, Proc. Nat. Acad.

Sci. USA, 90(13), 6155 (1993).

9. R. M. Grossman, J. Krueger, D. Yourish, A.

Granelli-Piperno, D. P. Murphy, L. T. Mary, T. S.

Kupper, P. B. Sehgal, and A. B. Gottlieb, Interleukin 6 is expressed in high levels in psoriatic skin and stimulates proliferation of cultured keratinocytes, Proc. Natl. Acad. Sci., 86(16), 6367 (1989).

10. J. L. Wilmer and M. I. Luster, Chemical induction of interleukin-8, a proinflammatory chemokine, in human epidermal keratinocyte cultures and its rela- tion to cytogenetic toxicity, Cell Biol. Toxicol.,

11(1), 37 (1995).

11. C. H. Hong, S. K. Hur, O. J. Oh, S. S. Kim, K. A.

Nam, and S. K. Lee, Evaluation of natural products on inhibition of inducible cyclooxygenase (COX-2) and nitric oxide synthase (iNOS) in cultured mouse macrophage cells, J. Ethnopharmacol, 83(1-2), 153 (2002).

12. J. L. Masferrer, B. S. Zweifel, P. T. Manning, S. D.

Hauser, K. M. Leahy, and W. G. Smith, Selective in- hibition of inducible cyclooxygenase 2 in vivo is an- tiinflammatory and nonulcerogenic, Proc. Natl. Acad.

Sci. USA, 91(8), 3228 (1994).

13. K. Seibert, Y. Zhang, K. Leahy, S. Hauser, J.

Masferrer, and W. Perkins, Pharmacological and bio- chemical demonstration of the role of cyclo- oxygenase 2 in inflammation and pain, Proc. Natl.

Acad. Sci. USA, 91(25), 12013 (1994).

14. Y. H Jean, W. F. Chen, C. Y. Duh, S. Y. Huang, C. H. Hsu, C. S. Lin, C. S. Sung, I. M. Chen, and Z. H Wen, Inducible nitric oxide synthase and cyclo- oxygenase-2 participate in anti-inflammatory and an- algesic effects of the natural marine compound lem- nalol from Formosan soft coral Lemnalia cervicorni, Eur. J. Pharmacol., 14(2-3), 323 (2008).

15. J. Pestka and H. R. Zhou, Toll-Like Receptor Priming Sensitizes Macrophages to Proinflammatory

(9)

Cytokine Gene Induction by Deoxynivalenol and Other Toxicants, Toxicol. Sci., 92(2), 445 (2006).

16. D. Sarkar, P. Saha, S. Gamre, S. Bhattacharjee, C.

Hariharan, S. Ganguly, R. Sen, G. Mandal, S.

Chattopadhyay, S. Majumdar, and M. Chatterjee, Anti-inflammatory effect of allylpyrocatechol in LPS-induced macrophages is mediated by sup- pression of iNOS and COX-2 via the NF-κB path- way, Int. Immunopharmacol., 8(9), 1264 (2008).

17. Y. I. Yang, H. C. Shin, S. H. Kim, W. Y. Park, K.

T. Lee, and J. H. Choi, 6,6′-Bieckol, isolated from marine alga Ecklonia cava, suppressed LPS-induced nitric oxide and PGE2 production and inflammatory cytokine expression in macrophages: The inhibition of NFκB, Int. Immunopharmacol., 12(3), 510 (2012).

18. J. L. Hankins, T. E. Fox, B. M. Barth, K. A. Unrath, and M. Kester, Exogenous ceramide-1-phosphate re- duces lipopolysaccharide (LPS)-mediated cytokine expression, J. Biol. Chem., 286(52), 44357 (2011).

19. E. Kim and H. Maibach, Changing paradigms in der- matology: science and art of diagnostic patch and contact urticaria testing, Clin. Dermatol., 21(5), 346 (2003).

20. A. S. Curry, S. D. Gettings, and G. N. McEwen, CTFA safety testing guidelines, Cosmetic, Toiletry, and Fragrance Association, Washington, D.C. (1991).

21. M. Steinhoff, T. Brzoska, and T. A Luger, Keratinocytes in epidermal immune responses, Curr.

Opin. Allergy Clin. Immunol., 1(5), 469 (2001).

22. A. Coquette, N. Berna, Y. Poumay, and M. R.

Pittelkow, The keratinocyte in cutaneous irritation and sensitization, In: Kydonieus, eds. A. F., Wille, and J. J, Biochemical Modulation of Skin Reactions, CRC Press, Boca Raton, Fl, 125 (2000).

23. E. Corsini, A. Bruccoleri, M. Marinovich, and C. L.

Galli, Endogenous interleukin-1 alpha associated with skin irritation induced by tributyltin, Toxicol.

Appl. Pharmacol., 138(2), 268 (1996).

(10)

수치

Figure 1. Inhibitory effects on pro-inflammatory cytokines mRNA expression in HaCaT cell
Table 3. Ratio of 4 Extracts Mixture
Figure 3. Anti-inflammatory effects of the mixture on pro-inflammatory cytokines mRNA expression in HaCaT cell
Figure 5. Skin irritation test of SC, UD, PN, RS extracts,  and those mixture by primary human skin irritation test

참조

관련 문서

괴화(槐花, Sophorae Flos)는 콩과에 속하는 회화나무 (Sophora japonica L.)의 꽃송이 혹은 꽃봉오리로서 신농본 초경(神農本草經)에 괴각(槐角)과 함께

Effect of tuna oil (TO) on western blot analysis of NF- κB p65, iNOS, and COX-2 protein expression on LPS-induced inflam- matory responses in RAW 264.7 cells, and (B-D) relative unit