F. Aim of this study
II. Materials and methods
17. Small interfering RNAs (siRNA)
The expression of target proteins, Sox9 and L-PGDS were knocked down by transiently transfection of mouse specific small interfering RNAs (siRNA; Genolution Pharmaceuticals, Seoul, Korea) as in Table 3. For transfections, the medium was replaced with Opti-MEM (Invitrogen) and astrocytes were treated with 10 nM siRNA and RNAiMAX transfection reagent, according to the manufacturer’s instructions (Invitrogen) for 5 days.
Knockdown of targets was confirmed by qPCR, RT-PCR and Western blot.
[Table 3] siRNA sequence
Primer Sense
Sox9 siRNA #1 5’- UUG UUA UAG UAA CAU AAA UAA UAU U-3’
Sox9 siRNA #2 5’- GGG GAA UAA ACA GAU AAC AUA GAU U-3’
L-PGDS siRNA #1 5’ GGGAGAAGAAAGCUGUAUUGUAUUU 3’
L-PGDS siRNA #2 5’ GGAGAAGAAAGCUGUAUUGUAUAUU 3’
25 18. Prostaglandin D2 (PGD2) ELISA
PGD2 expression level was measured by a commercial ELISA kits, according to the manufacturer’s instructions (Prostaglandind D2-MOX EIA kit, Cayman Chemical Company).
19. Inhibition of protein synthesis by cycloheximide
Cells were treated with 10 mg/ml cycloheximide (SIGMA-ALDRICH) for 1, 2 and 3 hours. After appropriate time intervals, cells were harvested and total proteins were prepared.
20. Inhibition of proteasomal degradation by MG132
Cells were treated with 10 mg/ml MG132 (SIGMA-ALDRICH) for 4 hours. After 4 hours, cells were harvested with lysis buffer containing 20 mM N-Ethylmaleimide (NEM;
SIGMA-ALDRICH) and total proteins were prepared.
21. Measurement of nitric oxide
The amount of nitrite formed from nitric oxide (NO) was measured by culture mediaum (50 mL) with an equal volume of Griess reagent (0.1% naphthylenthylene diamine, 1% sulfanilamide, 2.5% H3PO4), and then measuring optical density at 540 nm. (Ding, et al., 1988)
26 22. Statistical analysis
The statistical significance of differences between two groups was determined using unpaired two-tailed Student’s t tests.
27
III. RESULTS
PART A. DJ-1, (PARK7), plays critical roles in astrogliosis by regulating of the pSTAT3 signaling pathway for tissue repair after brain injury
1. Repair of brain injury was attenuated in DJ-1 KO mice
To examine whether PD-related genes may be involved in the regeneration of the injured brain, I examined time-dependent changes following brain injury in wild type and DJ-1 KO mice. Brain injury was produced by stereotaxic injection of ATP into the striatum since ATP, a component of damage associated molecule patterns (DAMPs), induces brain damage (Amadio, et al., 2002;Cavaliere, et al., 2001a;Cavaliere, et al., 2001b;Jeong, et al., 2010;Melani, et al., 2005). The damaged sites were chased using a 9.4T MRI scanner (Fig.
1A), reconstructed using Neurolucida 3D-modeling (Fig. 1B), and calculated the volume of damaged tissue (Fig. 1C). At 1 day after injection, the volume of the damaged tissue did not differ between WT and DJ-1 KO mice brain: 4.5+0.14 mm3 and 4.4±0.27 mm3 in WT and DJ-1 KO, respectively (Fig. 1C, D). Thereafter, the volume of the damaged sites rapidly decreased within 1 week in both WT and DJ-1 KO mice brain and then slowly for up to 29 days (Fig. 1C, D). Interestingly, however, the repair of damage was retarded in DJ-1 KO mice brain. The volume of damaged tissue in WT group reduced to 1.6±0.1 mm3 (65±3.28%
of damaged volume at 1d after ATP injection) at 8 d, 1.0±0.02 mm3 (78±1.18%) at 15 d, and 0.3±0.04 mm3 (93±1.16%) at 29 d (Fig. 1C, D). However, in KO group, the damaged
28
volumes reduced to 2.6±0.2 mm3 (42±6.38%) at 8 d, 2.1±0.13 mm3 (53±4.57%) at 15 d, and 0.5±0.01 mm3 (90±0.81%) at 29 d (Fig. 1C, D). These results showed that DJ-1 deficiency slowed the repair of the injured brain.
29
Figure 1. DJ-1 deficiency causes a defect of repair after brain damage. Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 3 mice). (A) Damage areas were chased by 9.4T MRI at indicated time points after ATP injection. Yellow arrows showed damage areas. (B) ATP induced damage (red) were reconstructed by 3D-modeling of Neurolucida. (C) Damage volume was calculated (D) Repair ratio was quantified. Values are means ± SEMs of 3 mice (*P < 0.05).
30
2. DJ-1 deficiency causes a defect of astrogliosis
In response to injury, astrocytes are activated and increase the expression of several proteins required for the maintenance of brain homeostasis and reconstruction of damaged brain (Eddleston and Mucke, 1993;Eng and Ghirnikar, 1994;Pekny and Nilsson, 2005;Sofroniew, 2009) Therefore, I examined whether the retarded repair of damage in the DJ-1 KO group may have been related to the responses of astrocytes. For this, brain sections were obtained from WT and DJ-1 KO mice from 1 d to 29 d after ATP injection, and the response of astrocytes was analyzed with GFAP specific antibodies (Fig. 2). Interestingly, astrogliosis was delayed in the DJ-1 KO brain in all penumbral regions, right, left, and below the damaged core region (Fig. 2A). I detected that reactive astrocytes showed progression of typical of astrogliosis in the WT brain, however progression was slowed and showed insufficient morphological change in the DJ-1 KO brain from 3 d to 7 d after ATP injection.
31
Figure 2. DJ-1 deficiency causes a defect of GFAP+ astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 4-10 mice). Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections (*, damage core region). Penumbra regions were divided left (a), right (b) and bottom (c). Scale bars, 1 mm, 50 mm
32
In response to the ATP injection, astrogliosis was detectable in the penumbral region at 3 d after injection of ATP (Fig. 3A). Since astrogliosis was not yet detectable at 1 d (Fig. 2A, 3A), I measured the astrocyte response from 3 d. According to the MRI results, GFAP-negative areas (blue dotted lines) reduced between 3 d to 29 d in both WT and KO brain (Fig. 3A). The volume of damaged tissue at each time point was quantified by Neurolucida 3D-modeling based on the analysis of at least eight sections from each animal stained with GFAP antibodies (Fig. 3B). As with the MRI data, the damaged volumes of tissue reduced more rapidly in the WT than in KO brain (Fig. 3B, C). GFAP negative volumes at 7 d were about 30% of that at 3 d in the WT brain, but about 60% in DJ-1 KO brain. At 14 d, however, GFAP negative volumes were reduced to about 90% in both WT and DJ-1 KO brain (Fig. 3B, C). In Western blot analysis using brain lysates, GFAP expression in the WT brain increased 2-2.5 folds at 3 d, 7 d and 14 d after the ATP injection, while GFAP expression in the DJ-1 KO brain only slightly (less than 1.8-folds) increased at 3 d, 7 d, and 14 d after injury (Fig. 3D). In the intact WT and KO brain, GFAP expression was similar (Fig. 3D). The smaller increase in GFAP expression in Western blot compared with that in immunostaining may be due to the inclusion of damaged tissue in the brain lysates.
33
Figure 3. DJ-1 deficiency causes a defect of progression of astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 4-10 mice). Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections. Blue line showed endpoints of astrogliosis (B) Negative area of astrogliosis (red) were reconstructed by 3D-modeling of Neurolucida. Negative area was quantified (lower panel). (C) Protein samples were obtained to striatum at indicated time points after ATP injection and GFAP expression level was measured by Western blot with GFAP specific antibody (n = 3 mice). GFAP intensities were quantified (right panel).
GAPDH was used as a loading control. Values are means ± SEMs of 4-10 mice (A , B) and 3 mice (C) (*P < 0.05; ** P < 0.005). Scale bars, 1 mm, 200 mm (A)
34
Next, I further examined the morphology of astrocytes in the WT and KO brain (Fig.
4). After the ATP injection, reactive astrocytes showed heterogeneous morphological features (Ding, 2014;Shimada, et al., 2012), important for the progression and function of astrogliosis (Namekawa, et al., 2002;Nawashiro, et al., 2000;Nawashiro, et al., 1998;Otani, et al., 2006).
In addition, insufficient morphological change of reactive astrocytes was also observed in PD patients (Mirza, et al., 2000;Song, et al., 2009). Interestingly, the patterns of astrogliosis were different in between the WT and DJ-1 KO brain in all penumbral regions, right, left, and below the damaged core, particularly, at 3 d and 7 d after injury (Fig. 4A). Astrocytes in the penumbral region next to the damaged core (Penumbra 1, P1) had a polarized morphology with long processes extended toward the damage core, but the cells in the penumbra region next to P1 (Penumbra 2, P2) had a hypertrophic but non polarized morphology (Fig. 4A, B). Interestingly, astrocytes from the DJ-1 KO brain in both P1 and P2 showed less activated morphology compared with WT astrocytes: shorter processes, fewer hypertrophic cell bodies, and a smaller increase in GFAP intensity (Fig. 4A, B, C), although astrocyte morphology and GFAP expression were similar in the intact brain of both groups (Fig. 5). Sholl analysis also showed that all parameters, cell volume, and number and length of processe, were reduced in both P1 and P2 in the KO astrocytes, particularly at 3 d and 7 d (Fig. 4A, B, C).
35
Figure 4. DJ-1 deficiency causes a defect of morphology of GFAP+ reactive astrocytes.
(A) Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections (n = 4-10 mice). Core region were showed damage area and penumbra 1 (P1) and penumbra 2 (P2) were separated by morphology of GFAP+ reactive astrocytes. (B) Morphology of GFAP+ reactive astrocytes between WT and DJ-1 KO was measured by Neurolucida on each penumbra region. (C) Morphological features of GFAP+ reactive astrocytes were quantified by Sholl analysis. Values are means ± SEMs of 40-50 cells (*P < 0.05; **P<0.005). Scale bar, 1 mm, 50 mm (A).
36
Figure 5. Normal astrocytes are not different between WT and DJ-1 KO mouse brain.
(A) Brain sections were prepared and stained with GFAP antibody (n = 5 mice). (B) Normal cortical astrocytes were investigated by GFAP staining. (C) Normal striatal astrocytes were investigated by GFAP staining. (D) Protein samples were obtained from total brain and GFAP expression was analyzed by Western blot with GFAP specific antibody. GFAP intensities were quantified (lower panel). Actin was used as a loading control. Values are means ± SEMs of 3 mice (*P < 0.05; **P<0.005). Scale bars, 1 mm (A), 200 mm (B), 20 mm (B, inset), 500 mm (C), 20 mm (C, inset).
37
Next, I compared nestin expression in the WT and DJ-1 KO brain since nestin, a marker of reactive astrocytes, has been known to regulate the repair of injury in the brain (Duan, et al., 2015;Lin, et al., 1995;Sirko, et al., 2013;Wiese, et al., 2004), and repair-related processes of proliferation, migration, invasion of cells (Akiyama, et al., 2013;Narita, et al., 2014;Zhao, et al., 2014), and angiogenesis (Matsuda, et al., 2013). After nestin staining, I found that nestin expression dramatically increased in P1 but not in P2 at 3 d and 7 d after ATP injection (Fig 6A, 7A) and nestin expressing cells were GFAP positive reactive astrocytes after ATP injection (Fig 6B). As expected, nestin expression was delayed and reduced in the striatum of the DJ-1 KO brain (Fig 7A, Fig 8A, B) although nestin was barely expressed in both the intact striatum of either group (Fig 7A). Sholl analysis of nestin-positive cells confirmed that morphological parameters such as cell volume, number of process branches, and length of processes, were reduced in the DJ-1 KO brain (Fig 8C, D).
At 3 d and 7 d, the morphological features of reactive astrocytes in the DJ-1 KO striatum showed a 30-50% reduction in all parameters. Taken together, these data showed that DJ-1 deficiency causes abnormal responses of in the astrocytes of the injured brain, which led me to examine the expression of functional markers of astrocytes.
38
Figure 6. Nestin locate in GFAP+ reactive astrocytes on penumbra from only damage near site after brain injury. (A) Brain sections were prepared and stained with nestin antibody. Nestin+ reactive astrecytes were located on penumbra ‘1’ region of GFAP+
astrocytes at 3 d after ATP injection (B) Nestin+ reactive astrocytes were localized with GFAP+ reactive astrocytes. Scale bars, 100 mm (A), 20 mm (B).
39
Figure 7. DJ-1 deficiency causes a defect of nestin+ astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse. Brain sections were prepared at the indicated times after ATP injection and stained with nestin antibody.
Photographs of the most damaged sections were obtained (*, damage core region). Penumbra regions were divided left (a), right (b) and bottom (c). Scale bars, 1 mm, 50 mm
40
Figure 8. DJ-1 deficiency causes a defect of morphology of nestin+ reactive astrocytes.
(A) Brain sections were prepared at the indicated times after ATP injection and stained with nestin antibody. Photographs of the most damaged sections were obtained. Core region was damage area. P1 and P2 region were separated by features of reactive astrocytes (B) Sections obtained at 3 d were double-labeled with nestin and GFAP antibodies (C) Morphology of nestin+ reactive astrocytes between WT and DJ-1 KO was measured by Neurolucida on penumbra region at indicated time points. (D) Features of reactive astrocytes were quantified by Sholl analysis of Neurolucida. Values are means ± SEMs of 40–50 cells (*P < 0.05; **P
<0.005). Scale bars, 1 mm, 50 mm (A), 10 mm (B).
41
3. Reduction of astrocyte derived GDNF expression and attenuated restoration of dopaminergic processes in the DJ-1 KO brain
Recently, growing evidences has demonstrated that astrogliosis has an important roles in regeneration and repair through the regulation of the supply of nutrients, angiongenesis, remyelination, neurotrophic factors and neurogenesis (do Carmo Cunha, et al., 2007;Liberto, et al., 2004;Triolo, et al., 2006;White, et al., 2008). Therefore, I examined whether astrocyte function was affected by the insufficient astrogliosis in DJ-1 KO injured mouse. Using Western blot with several functional markers, I found that GLAST, GLT1, AQP4 and VEGF were not affected by DJ-1 deficiency (Fig 9A, B).
However, I determined that DJ-1 KO induced insufficient astrogliosis led to a expression in WT and KO brain. Using GDNF staining, GDNF expression was detectable in astrocytes found in P1 and P2 in both WT and DJ-1 KO brain from 3 d to 7 d post-ATP injection, but less weakly in the DJ-1 KO brain (Fig 10A). I also found that GDNF expression in GFAP-positive reactive astrocytes was reduced in P1 and P2 in the striatum of DJ-1 KO mice after brain injury (Fig 10B). After ATP injection, I prepared brain lysates from the ATP-injected WT and DJ-1 KO striatum at 3 d and 7 d when dramatic changes in astrogliosis had been observed. Using Western blot, I found that GDNF expression level was
42
significantly decreased (by approx. 50%) in the DJ-1 KO striatum compared with WT striatum at 3 d and 7 d (Fig 10C). Taken together, these results indicate that astrocyte responses in the injured brain, astrogliosis, and GDNF expression are insufficient in the DJ-1 KO brain.
43
Figure 9. Several functional markers did not showed difference in WT and DJ-1 KO mouse after ATP injection. (A) Protein samples were obtained to striatum at indicated time points after ATP injection and GFAP and several functional markers expression level were measured by Western blot with specific antibodies. GAPDH was used as a loading control (A, B).
44
Figure 10. DJ-1 deficiency causes a defect of GDNF expression. (A) Brain sections were prepared at the indicated times after ATP injection and stained with GDNF antibody.
Photographs of the most damaged sections were obtained. GDNF expression was detected in reactive astrocytes (yellow arrow). (B) Sections obrained at 3 d were double-labeled with nestin and GFAP antibodies. (C) Protein samples were obtained to striatum at indicated time points after ATP injection and GDNF was measured by Western blot with specific antibodies.
GAPDH was used as a loading control. Data shown are representative of at least three independent experiments. Values are means ± SEMs of 3 mice (*P < 0.05; **P <0.005).
Scale bars, 50 mm, 20 mm (A), 50 mm (B).
45
I next examined the repair of dopaminergic processes in WT and DJ-1 KO brain. In immunostaining, tyrosine hydroxylase (TH)-positive dopaminergic processes progressively grew into the damaged sites in both WT and KO mice, but more slowly in KO mice compared with WT (Fig.11A). The volume of damaged tissue in WT and KO were reconstructed using Neurolucida 3D-modeling. Volumes of TH-negative tissue at 7, 14, and 29 d reduced to 50%, 80%, and 90% of the tissue volumes at 1 d after injury in WT but 30%, 60%, and 80% in KO mice (Fig. 11B, C). In Western blot analysis, TH expression decreased at 3 d, and then recovered at 7 d in both WT and KO, but TH levels at 3 d and 7 d were lower in KO mice (Fig. 11D). These results suggest that DJ-1 deficiency attenuates TH recovery in the injured brain.
46
Figure 11. Insufficient astrogliosis cause a defect of TH+ processes repair. (A) Brain sections were prepared at the indicated times after ATP injection and stained with TH antibody. Photographs of the most damaged sections were obtained. (B) TH negative area was measured by Neurolucida. (C) TH negative areas were quantified at indicated time points. (D) Protein samples were obtained to striatum at indicated time points after ATP injection and TH was measured by Western blot with specific antibodies. GAPDH was used as a loading control. Data shown are representative of at least three independent experiments.
Values are means ± SEMs of 3–5 mice (*P < 0.05; **P <0.005). Scale bars, 1 mm (A).
47
4. DJ-1 rescued insufficient astrogliosis in DJ-1 KO brain slice cultures.
Next, I examined whether DJ-1 KO-induced insufficient astrogliosis was rescued by DJ-1 overexpression using cortical slice cultures. To mimic of the penumbral region, I used a slice culture system and tested ATP concentrations that induced astrogliosis but not cell death Fig 12A, B). At 7 d after culture when slicing damage was stabilized, slices were treated with 50 mM ATP for two more days. After treatment, I found that cell death was not induced in this condition in either WT or DJ-1 KO slice cultures (Fig 12C). However, both GFAP and nestin expression increased in the WT slices but barely in the DJ-1 KO slices, which was demonstrated with immunostaining (Fig 13A), and Western blot (Fig. 13B).
Next, I examined the effect of DJ-1 expression in DJ-1 KO slices on astrogliosis.
For this, DJ-1 KO slices were transfected with 3xFlag-DJ-1. I found that GFAP and nestin expression increased in both immunostaining and Western blot in response to ATP following DJ-1 transfection although levels of GFAP and nestin expression in the absence of ATP was not changed (Fig. 13C, D). These results suggest that alteration of DJ-1 level is a cause of insufficient astroglioisis.
48
Figure 12. Astrogliosis was induced by ATP in slice culture. (A) Slice culture tissues were incubated during 7 d after cortical slice. Various dosages ATP was treated on incubated slice tissues during 2 d and cell death was analyzed by EthD-1 staining. (B) Astrogliosis was induced by 50 mM ATP. (C) Cell death was analyzed by EthD-1 staining Values are means ± SEMs of three samples (*P < 0.05; **P <0.005). Data shown are representative of at least three independent experiments. Scale bars, 200 mm (A), 20 mm (B), 200 mm (C).
49
Figure 13. DJ-1 regulates astrogliosis in slice cultured tissues. (A) Slice cultured tissues were incubated during 7 day after cortical slice. 50 mM ATP was treated on cultured slice tissues and incubated during 2 day. After 2 day, tissues were stained with GFAP and nestin antibody. GFAP and nestin intensities were quantified by Image J (low panel). (B) GFAP expression was analyzed by Western blot (upper penal) and intensity was quantified by Image J (low penal). (C) 50 mM ATP was treated Flag tagged DJ-1 transfected slice tissues and incubated during 2day. After 2day, tissues were stained with GFAP and nestin antibody.
GFAP and nestin intensities were quantifined by Image J (low panel). (D) GFAP expression was analyzed by Western blot. Actin (B), GAPDH (D) was used as a loading control. Data shown are representative of at least three independent experiments. Values are means ± SEMs (*P < 0.05; **P <0.005). Scale bars, 20 mm (A), 20 mm (C).
50
5. STAT3 activation (tyrosine phosphorylation of STAT3, pSTAT3) was attenuated in DJ-1 KO slices.
The next, question that was raised was how DJ-1 deficiency causes insufficient astrogliosis in the injured brain. STAT3 is the best known regulator of astrogliosis (Damiani
& O'Callaghan, 2007; Herrmann et al, 2008). Based on this information, I examined the levels of pSTAT3 in WT and DJ-1 KO brain slices using Western blot. Levels of pSTAT3 increased at 3 and 6 h post-slicing in both WT and DJ-1 KO brain slices, but the levels were 50–60% lower in the DJ-1 KO brain slices (Fig 14A). Using 5, 15- diphenylporphyrin (DPP, 50 mM) which is an antagonist of STAT phosphorylation, I found that a reduction of pSTAT3 led to a block of GFAP expression in sliced tissue (Fig 14B). Furthermore, DJ-1 expression increased pSTAT3 levels (about 1.5-fold) in DJ-1 KO slices treated with ATP (Fig.
14C). These results suggest that DJ-1 deficiency causes insufficient astroglioisis through insufficient STAT3 activation.
51
Figure 14. DJ-1 deficiency causes a defect of STAT3 phosphorylation in slice culture. (A) Cortical slice tissues were prepared at the indicated times after direct slice cutting. pSTAT3, and GFAP expression was analyzed by Western blot. (B) After cortical slice, tissues were incubated with pSTAT3 inhibitor, 5,15-DPP (50 mM). GFAP expression was analyzed by Western blot. (C) 50 mM ATP was treated Flag tagged DJ-1 transfected slice tissues and incubated during 2 day. After 2 day, pSTAT3 expression was analyzed by Western blot.
GAPDH was used as a loading control (A-C). Data shown are representative of at least three independent experiments. Values are means ± SEMs of three samples (*P < 0.05; **P
<0.005).
52
PART B. DJ-1 exerts the anti-inflammatory effects of astrocytes through
PART B. DJ-1 exerts the anti-inflammatory effects of astrocytes through