Organotypic cortical slice cultures - Materials and methods

F. Aim of this study

II. Materials and methods

8. Organotypic cortical slice cultures

7. Histological quantification

Photographs of the most damaged section were taken. Sholl analysis and morphological change of GFAP and nestin positive cells were investigated using Neurolucida (MBF bioscience, Williston, VT, USA). Marker protein intensities were analyzed using Image J software.

8. Organotypic cortical slice cultures

Cortical slices were prepared as previously described (Stoppini et al, 1991) with a modification. c57/BL6 mice at postnatal day 7 were anesthetized, and the skull was removed.

Cortical slices (400 mm thick) were prepared using a McIlwain tissue chopper (Mickle Laboratory Engineering, Goose Green, UK) in a slice culture medium (50% MEM containing, 25% Hanks’ balanced salt solution, 25% heat-inactivated horse serum, 6.5 mg/ml glucose, 1 mM L-glutamine, 10 U/ml penicillin-G, and 10 mg/ml streptomycin). Slices were cultured in culture inserts (Millipore, Bedford, MA, USA) in 6 well plates. Medium was changed every other day. At 7 day, ATP (50 mM) was added. Cell viability in slices was assayed using ethidium homodimer-1 (Etd-1, Molecular Probes, Eugene, OR, USA). To inhibit STAT3, slices were treated with 50 mM 5,15-diphenylporphyrin (DPP, Sigma).

１９ 9. Cell culture

Primary astrocytes cells were cultured from the fore brain of WT and DJ-1 KO c57/BL6 mouse. In briefly mouse skulls were rapidly removed and brain was placed in a culture dish with DMEM (Hyclone, Logan UT, USA) containing 10% FBS (Hyclone).

Maninges was removed and brain wasmechanincally dissociated with gentle pipetting in the media. Dissociated brain cells were seeded on 75 cm² T-flasks (0.5 hemisphere/flask), and were incubated in 37°C, 5% CO2 incubator for 2 ~ 3 weeks. After 2 ~ 3 weeks Primary astrocytes were removed with 0.1% trypsin and were seeded culture dish in DMEM containing 10% FBS.

BV2 cells were cultured in DMEM containing 5% FBS. For activation of BV2, cells were incubated with 5 ng/ml recombinant murine IFN- g (PeproTech, Rocky Hill, NJ, USA). For antagonization of PGD₂ receptor in BV2, cells were incubated with PGD2 receptors antagonist (CAY1047 and TM30089 for DP2; BWA868C for DP1, 10 mM each;

Cayman Chemical Company). For inhibition of AKT phosphorylation, cells were incubated with PI3K inhibitors (LY294002, 2, 4 mM; Wortmanin, 50, 100 nM; Biomol, Plymouth Meeting, PA, USA). DJ-1 KO MEF cells were cultured in DMEM containing 10% FBS.

10. Western blot analysis

Protein was isolated from homogenated slices or brains tissues and prepared cells with modified RIPA buffer (50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM Na3VO4, and 1 mM NaF) containing protease inhibitor cocktail and phosphatase inhibitor cocktail (GenDEPOT, Barkor, TX, USA). Isolated proteins were

２０

separated by SDS-PAGE and transferred to nitrocellulose membranes. Membranes were incubated with specific antibodies (Table 1) overnight at 4°C. After washing with PBS, membranes were incubated with peroxidase-conjugated secondary antibodies, and visualized with enhanced chemiluminescence system (Daeil Lab Inc., Seoul, Korea). Band intensities were normalized with actin or GAPDH using Image J.

[Table 1] Antibody

２１ 11. Immunoprecipitation

Prepared cells were washed twice with PBS and were isolated protein with immunoprecipitation lysis buffer (1% triton-X 100, 1 mM Na3VO4, 1 mM NaF, 150 mM NaCl, 1mM EDTA, 1mM EGTA, 50 mM HEPES, 0.5 mM DTT) containing protease inhibitor cocktail and phosphatase inhibitor cocktail (GenDEPOT). Isolated protein supernatants were incubated with specific antibody (Table 1) during 4 hour on 4°C spin rotor.

After incubation, protein G agarose (Millipore, Bedford, MA, USA) was added with antibody incubated protein supernatants during 4 hour on 4°C spin rotor. Agarose beads were washed with PBS and proteins were isolated by boiling in 2x SDS-PAGE sample buffer.

Final protein sample was analyzed by Western blotting.

12. Quantitative real-time PCR (qPCR)

Total RNA was isolated from primary astrocytes by easy-BLUE reagent (iNtRON Biotechnology, Seoul, Korea). cDNA was synthesized using 1mg of total RNA and the cDNA synthesis kit (iNtRON) at the following temperatures : Denaturation with oligo d(T)₁₅ primers during 5 min 75°C, cDNA synthesis with AMV RT enzyme miture during 60 min 42 °C and Termination reaction during 5 min 70 °C. qPCR was done using 2x KAPA SYBR Fast Master Mix (Kapa Biosystem, Cape Town, South Africa) and was used by RG-6000 real-time amplification instrument (Corbett Research, Sydney, Australia). qPCR amplification using specific primer (Table 2). The cycle threshold (Ct) for the gene transcript was normalized to the average Ct for transcripts of the housekeeping gene, actin, amplified

２２

in each reaction. Relative quantitation of normalized transcript abundance was determined using the comparative Ct method (DDCt), as described by the manufacturer.

13. Reverse transcriptase PCR (RT-PCR)

primers during 5 min 75°C, cDNA synthesis with AMV RT enzyme miture during 60 min 42°C and Termination reaction during 5 min 70°C. RT-PCR was performed using specific primer (Table 2). The amplified products were separated by electrophoresis on a 1.5%

agarose gel and detected under UV light. Band intensities were analyzed using Image J.

[Table 2] Primer sequence

Primer Sense Anti-sense

TNF-a 5’-GTAGCCCACGTCGTAGCAAA 5’-CCCTTCTCCAGCTGGGAGAC HO-1 5’-TGCAGGTGATGCTGACAGAGG 5’-GGGATGAGCTAGTGCTGATCTGG L-PGDS 5’-GACACAGTGCAGCCCAACTTTC 5’-GGGCTACCACTGTCTTGCACATA Sox9 5’-GGACAACACATGCCTCTGCAA 5’-TCTCCAGCCACAGCAGTGAGTAA H-PGDS 5’-GCCAGTGCCACACACAGCTAA 5’-CGTCTTGCCCATGTCACCA

mPGES 5’-ACAGTGGTTTCAGCAGGGTGTC 5’-GTCCAGATTTGCAGCCAGGAG PGIS 5’-TGCGTACACGGCTGGACTTC 5’-CCTGCAGGTCTCTGTGCATCA Actin 5’-GCTCTGGCTCCTAGCACCAT 5’-GCCACCGATCCACACAGAGT

２３ 14. DNA constructs

Plasmid DNA for p3x FLAG-hDJ-1, hL166P, hE64D and hC106A plasmid was gifts from Prof. Park (Ajou University, Woncheon-dong Youngtong-gu Suwon, Kyunggi-do, Korea). HA-Ubi was gifts from Prof. Jou (Ajou University). pWPXL was a gift from Didier Trono (Addgene plasmid # 12257) and pWPXL-Sox9 was a gift from Bob Weinberg (Addgene plasmid # 36979).

15. Transfection

Cells were transiently transfected with plasmid DNA using jetPEI DNA transfection reagent (Polyplus Transfection, Boulevard Sébastien Brant, 67401 Illkirch Graffenstaden, FR), as explained by the manufacturer. Briefly, cells were incubated to DNA plasmid and jetPEI mixture for 4 hours. After 4 hour, media were replaced with fresh media. 3 days later, transfected cells were used for experiments.

Cortical slices plasmid DNA transfection was performed using a modified Zou &Crews method (Zou and Crews, 2010). Cortical slice culture tissues were transiently transfected with plasmid DNA using jetPEI DNA transfection reagent as explained by the manufacturer.

The transfection mixture was added to slice culture media and incubated in a total volume of 1.5 ml (0.5 ml on top of slices and 1 ml at bottom of the cultures) during 4 hours. After 4 hour, media were replaced with fresh media. 3 days later, transfected slice culture tissues were used for experiments.

16. Proximity ligation assay (PLA)

２４

Primary astrocytes were fixed with 4% paraformaldehyde, permeabilized with 0.1%

Triton X-100, and treated with 1% bovine serum albumen. Primary astrocytes were incubated with Sox9 and ubiquitin antibodies during over night at RT. After overnight, the sample was washed with PBS containing 0.1% Triton X-100(PBST) and was incubated with DNA probe-conjugated secondary antibodies (Olink Bioscience, Uppsala, Sweden) for 1 h at 37°C. The sample was washed and DNA probes were ligated for 30 min at 37°C, amplified for 2 h at 37°C, and examined under an Axiovert 200M microscope (Carl Zeiss).

17. Small interfering RNAs (siRNA)

The expression of target proteins, Sox9 and L-PGDS were knocked down by transiently transfection of mouse specific small interfering RNAs (siRNA; Genolution Pharmaceuticals, Seoul, Korea) as in Table 3. For transfections, the medium was replaced with Opti-MEM (Invitrogen) and astrocytes were treated with 10 nM siRNA and RNAiMAX transfection reagent, according to the manufacturer’s instructions (Invitrogen) for 5 days.

Knockdown of targets was confirmed by qPCR, RT-PCR and Western blot.

[Table 3] siRNA sequence

Primer Sense

Sox9 siRNA #1 5’- UUG UUA UAG UAA CAU AAA UAA UAU U-3’

Sox9 siRNA #2 5’- GGG GAA UAA ACA GAU AAC AUA GAU U-3’

L-PGDS siRNA #1 5’ GGGAGAAGAAAGCUGUAUUGUAUUU 3’

L-PGDS siRNA #2 5’ GGAGAAGAAAGCUGUAUUGUAUAUU 3’

２５ 18. Prostaglandin D₂ (PGD₂) ELISA

PGD2 expression level was measured by a commercial ELISA kits, according to the manufacturer’s instructions (Prostaglandind D₂-MOX EIA kit, Cayman Chemical Company).

19. Inhibition of protein synthesis by cycloheximide

Cells were treated with 10 mg/ml cycloheximide (SIGMA-ALDRICH) for 1, 2 and 3 hours. After appropriate time intervals, cells were harvested and total proteins were prepared.

20. Inhibition of proteasomal degradation by MG132

Cells were treated with 10 mg/ml MG132 (SIGMA-ALDRICH) for 4 hours. After 4 hours, cells were harvested with lysis buffer containing 20 mM N-Ethylmaleimide (NEM;

SIGMA-ALDRICH) and total proteins were prepared.

21. Measurement of nitric oxide

The amount of nitrite formed from nitric oxide (NO) was measured by culture mediaum (50 mL) with an equal volume of Griess reagent (0.1% naphthylenthylene diamine, 1% sulfanilamide, 2.5% H₃PO₄), and then measuring optical density at 540 nm. (Ding, et al., 1988)

２６ 22. Statistical analysis

The statistical significance of differences between two groups was determined using unpaired two-tailed Student’s t tests.

２７

III. RESULTS

PART A. DJ-1, (PARK7), plays critical roles in astrogliosis by regulating of the pSTAT3 signaling pathway for tissue repair after brain injury

1. Repair of brain injury was attenuated in DJ-1 KO mice

To examine whether PD-related genes may be involved in the regeneration of the injured brain, I examined time-dependent changes following brain injury in wild type and DJ-1 KO mice. Brain injury was produced by stereotaxic injection of ATP into the striatum since ATP, a component of damage associated molecule patterns (DAMPs), induces brain damage (Amadio, et al., 2002;Cavaliere, et al., 2001a;Cavaliere, et al., 2001b;Jeong, et al., 2010;Melani, et al., 2005). The damaged sites were chased using a 9.4T MRI scanner (Fig.

1A), reconstructed using Neurolucida 3D-modeling (Fig. 1B), and calculated the volume of damaged tissue (Fig. 1C). At 1 day after injection, the volume of the damaged tissue did not differ between WT and DJ-1 KO mice brain: 4.5+0.14 mm³ and 4.4±0.27 mm³ in WT and DJ-1 KO, respectively (Fig. 1C, D). Thereafter, the volume of the damaged sites rapidly decreased within 1 week in both WT and DJ-1 KO mice brain and then slowly for up to 29 days (Fig. 1C, D). Interestingly, however, the repair of damage was retarded in DJ-1 KO mice brain. The volume of damaged tissue in WT group reduced to 1.6±0.1 mm³ (65±3.28%

of damaged volume at 1d after ATP injection) at 8 d, 1.0±0.02 mm³ (78±1.18%) at 15 d, and 0.3±0.04 mm³ (93±1.16%) at 29 d (Fig. 1C, D). However, in KO group, the damaged

２８

volumes reduced to 2.6±0.2 mm³ (42±6.38%) at 8 d, 2.1±0.13 mm³ (53±4.57%) at 15 d, and 0.5±0.01 mm³ (90±0.81%) at 29 d (Fig. 1C, D). These results showed that DJ-1 deficiency slowed the repair of the injured brain.

２９

Figure 1. DJ-1 deficiency causes a defect of repair after brain damage. Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 3 mice). (A) Damage areas were chased by 9.4T MRI at indicated time points after ATP injection. Yellow arrows showed damage areas. (B) ATP induced damage (red) were reconstructed by 3D-modeling of Neurolucida. (C) Damage volume was calculated (D) Repair ratio was quantified. Values are means ± SEMs of 3 mice (*P < 0.05).

３０

2. DJ-1 deficiency causes a defect of astrogliosis

In response to injury, astrocytes are activated and increase the expression of several proteins required for the maintenance of brain homeostasis and reconstruction of damaged brain (Eddleston and Mucke, 1993;Eng and Ghirnikar, 1994;Pekny and Nilsson, 2005;Sofroniew, 2009) Therefore, I examined whether the retarded repair of damage in the DJ-1 KO group may have been related to the responses of astrocytes. For this, brain sections were obtained from WT and DJ-1 KO mice from 1 d to 29 d after ATP injection, and the response of astrocytes was analyzed with GFAP specific antibodies (Fig. 2). Interestingly, astrogliosis was delayed in the DJ-1 KO brain in all penumbral regions, right, left, and below the damaged core region (Fig. 2A). I detected that reactive astrocytes showed progression of typical of astrogliosis in the WT brain, however progression was slowed and showed insufficient morphological change in the DJ-1 KO brain from 3 d to 7 d after ATP injection.

３１

Figure 2. DJ-1 deficiency causes a defect of GFAP+ astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 4-10 mice). Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections (*, damage core region). Penumbra regions were divided left (a), right (b) and bottom (c). Scale bars, 1 mm, 50 mm

３２

In response to the ATP injection, astrogliosis was detectable in the penumbral region at 3 d after injection of ATP (Fig. 3A). Since astrogliosis was not yet detectable at 1 d (Fig. 2A, 3A), I measured the astrocyte response from 3 d. According to the MRI results, GFAP-negative areas (blue dotted lines) reduced between 3 d to 29 d in both WT and KO brain (Fig. 3A). The volume of damaged tissue at each time point was quantified by Neurolucida 3D-modeling based on the analysis of at least eight sections from each animal stained with GFAP antibodies (Fig. 3B). As with the MRI data, the damaged volumes of tissue reduced more rapidly in the WT than in KO brain (Fig. 3B, C). GFAP negative volumes at 7 d were about 30% of that at 3 d in the WT brain, but about 60% in DJ-1 KO brain. At 14 d, however, GFAP negative volumes were reduced to about 90% in both WT and DJ-1 KO brain (Fig. 3B, C). In Western blot analysis using brain lysates, GFAP expression in the WT brain increased 2-2.5 folds at 3 d, 7 d and 14 d after the ATP injection, while GFAP expression in the DJ-1 KO brain only slightly (less than 1.8-folds) increased at 3 d, 7 d, and 14 d after injury (Fig. 3D). In the intact WT and KO brain, GFAP expression was similar (Fig. 3D). The smaller increase in GFAP expression in Western blot compared with that in immunostaining may be due to the inclusion of damaged tissue in the brain lysates.

３３

Figure 3. DJ-1 deficiency causes a defect of progression of astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 4-10 mice). Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections. Blue line showed endpoints of astrogliosis (B) Negative area of astrogliosis (red) were reconstructed by 3D-modeling of Neurolucida. Negative area was quantified (lower panel). (C) Protein samples were obtained to striatum at indicated time points after ATP injection and GFAP expression level was measured by Western blot with GFAP specific antibody (n = 3 mice). GFAP intensities were quantified (right panel).

GAPDH was used as a loading control. Values are means ± SEMs of 4-10 mice (A , B) and 3 mice (C) (*P < 0.05; ** P < 0.005). Scale bars, 1 mm, 200 mm (A)

３４

Next, I further examined the morphology of astrocytes in the WT and KO brain (Fig.

4). After the ATP injection, reactive astrocytes showed heterogeneous morphological features (Ding, 2014;Shimada, et al., 2012), important for the progression and function of astrogliosis (Namekawa, et al., 2002;Nawashiro, et al., 2000;Nawashiro, et al., 1998;Otani, et al., 2006).

In addition, insufficient morphological change of reactive astrocytes was also observed in PD patients (Mirza, et al., 2000;Song, et al., 2009). Interestingly, the patterns of astrogliosis were different in between the WT and DJ-1 KO brain in all penumbral regions, right, left, and below the damaged core, particularly, at 3 d and 7 d after injury (Fig. 4A). Astrocytes in the penumbral region next to the damaged core (Penumbra 1, P1) had a polarized morphology with long processes extended toward the damage core, but the cells in the penumbra region next to P1 (Penumbra 2, P2) had a hypertrophic but non polarized morphology (Fig. 4A, B). Interestingly, astrocytes from the DJ-1 KO brain in both P1 and P2 showed less activated morphology compared with WT astrocytes: shorter processes, fewer hypertrophic cell bodies, and a smaller increase in GFAP intensity (Fig. 4A, B, C), although astrocyte morphology and GFAP expression were similar in the intact brain of both groups (Fig. 5). Sholl analysis also showed that all parameters, cell volume, and number and length of processe, were reduced in both P1 and P2 in the KO astrocytes, particularly at 3 d and 7 d (Fig. 4A, B, C).

３５

Figure 4. DJ-1 deficiency causes a defect of morphology of GFAP+ reactive astrocytes.

(A) Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections (n = 4-10 mice). Core region were showed damage area and penumbra 1 (P1) and penumbra 2 (P2) were separated by morphology of GFAP+ reactive astrocytes. (B) Morphology of GFAP+ reactive astrocytes between WT and DJ-1 KO was measured by Neurolucida on each penumbra region. (C) Morphological features of GFAP+ reactive astrocytes were quantified by Sholl analysis. Values are means ± SEMs of 40-50 cells (*P < 0.05; **P<0.005). Scale bar, 1 mm, 50 mm (A).

３６

Figure 5. Normal astrocytes are not different between WT and DJ-1 KO mouse brain.

(A) Brain sections were prepared and stained with GFAP antibody (n = 5 mice). (B) Normal cortical astrocytes were investigated by GFAP staining. (C) Normal striatal astrocytes were investigated by GFAP staining. (D) Protein samples were obtained from total brain and GFAP expression was analyzed by Western blot with GFAP specific antibody. GFAP intensities were quantified (lower panel). Actin was used as a loading control. Values are means ± SEMs of 3 mice (*P < 0.05; **P<0.005). Scale bars, 1 mm (A), 200 mm (B), 20 mm (B, inset), 500 mm (C), 20 mm (C, inset).

３７

Next, I compared nestin expression in the WT and DJ-1 KO brain since nestin, a marker of reactive astrocytes, has been known to regulate the repair of injury in the brain (Duan, et al., 2015;Lin, et al., 1995;Sirko, et al., 2013;Wiese, et al., 2004), and repair-related processes of proliferation, migration, invasion of cells (Akiyama, et al., 2013;Narita, et al., 2014;Zhao, et al., 2014), and angiogenesis (Matsuda, et al., 2013). After nestin staining, I found that nestin expression dramatically increased in P1 but not in P2 at 3 d and 7 d after ATP injection (Fig 6A, 7A) and nestin expressing cells were GFAP positive reactive astrocytes after ATP injection (Fig 6B). As expected, nestin expression was delayed and reduced in the striatum of the DJ-1 KO brain (Fig 7A, Fig 8A, B) although nestin was barely expressed in both the intact striatum of either group (Fig 7A). Sholl analysis of nestin-positive cells confirmed that morphological parameters such as cell volume, number of process branches, and length of processes, were reduced in the DJ-1 KO brain (Fig 8C, D).

At 3 d and 7 d, the morphological features of reactive astrocytes in the DJ-1 KO striatum showed a 30-50% reduction in all parameters. Taken together, these data showed that DJ-1 deficiency causes abnormal responses of in the astrocytes of the injured brain, which led me to examine the expression of functional markers of astrocytes.

３８

Figure 6. Nestin locate in GFAP+ reactive astrocytes on penumbra from only damage near site after brain injury. (A) Brain sections were prepared and stained with nestin antibody. Nestin+ reactive astrecytes were located on penumbra ‘1’ region of GFAP+

astrocytes at 3 d after ATP injection (B) Nestin+ reactive astrocytes were localized with GFAP+ reactive astrocytes. Scale bars, 100 mm (A), 20 mm (B).

３９

Figure 7. DJ-1 deficiency causes a defect of nestin+ astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse. Brain sections were prepared at the indicated times after ATP injection and stained with nestin antibody.

Photographs of the most damaged sections were obtained (*, damage core region). Penumbra regions were divided left (a), right (b) and bottom (c). Scale bars, 1 mm, 50 mm

４０

Figure 8. DJ-1 deficiency causes a defect of morphology of nestin+ reactive astrocytes.

(A) Brain sections were prepared at the indicated times after ATP injection and stained with nestin antibody. Photographs of the most damaged sections were obtained. Core region was damage area. P1 and P2 region were separated by features of reactive astrocytes (B) Sections obtained at 3 d were double-labeled with nestin and GFAP antibodies (C) Morphology of nestin+ reactive astrocytes between WT and DJ-1 KO was measured by Neurolucida on penumbra region at indicated time points. (D) Features of reactive astrocytes were quantified by Sholl analysis of Neurolucida. Values are means ± SEMs of 40–50 cells (*P < 0.05; **P

<0.005). Scale bars, 1 mm, 50 mm (A), 10 mm (B).

４１

3. Reduction of astrocyte derived GDNF expression and attenuated restoration of dopaminergic processes in the DJ-1 KO brain

Recently, growing evidences has demonstrated that astrogliosis has an important roles in regeneration and repair through the regulation of the supply of nutrients, angiongenesis, remyelination, neurotrophic factors and neurogenesis (do Carmo Cunha, et al., 2007;Liberto, et al., 2004;Triolo, et al., 2006;White, et al., 2008). Therefore, I examined whether astrocyte function was affected by the insufficient astrogliosis in DJ-1 KO injured mouse. Using Western blot with several functional markers, I found that GLAST, GLT1, AQP4 and VEGF were not affected by DJ-1 deficiency (Fig 9A, B).

However, I determined that DJ-1 KO induced insufficient astrogliosis led to a expression in WT and KO brain. Using GDNF staining, GDNF expression was detectable in astrocytes found in P1 and P2 in both WT and DJ-1 KO brain from 3 d to 7 d post-ATP injection, but less weakly in the DJ-1 KO brain (Fig 10A). I also found that GDNF expression in GFAP-positive reactive astrocytes was reduced in P1 and P2 in the striatum of DJ-1 KO mice after brain injury (Fig 10B). After ATP injection, I prepared brain lysates from the ATP-injected WT and DJ-1 KO striatum at 3 d and 7 d when dramatic changes in astrogliosis had been observed. Using Western blot, I found that GDNF expression level was

４２

significantly decreased (by approx. 50%) in the DJ-1 KO striatum compared with WT striatum at 3 d and 7 d (Fig 10C). Taken together, these results indicate that astrocyte responses in the injured brain, astrogliosis, and GDNF expression are insufficient in the DJ-1 KO brain.

４３

Figure 9. Several functional markers did not showed difference in WT and DJ-1 KO mouse after ATP injection. (A) Protein samples were obtained to striatum at indicated time

문서에서 Regulation of Astrocyte Functions by a Parkinson's Disease Gene, DJ-1 (페이지 32-0)