F. Aim of this study
II. Materials and methods
3. Animal MRI
c57/BL6 mouse were anesthetized by Isoflurane. Brain damage was measured by 9.4T MRI (BioSpec 94/30 US/R, BRUKER, USA) and Volume RF coil (Inner diameter 23 mm, BRUKER,USA) CNIR of Sungkyunkwan University. Using parameter was 2D T2 Turbo RARE sequence (TR/TE = 9000/33 ms; Resolution = 78 mM x 78 mM x 250 mM;
Slice thickess = 250 mM; RARE factor = 8; Average = 2; Scan time = 9 m36 s).
１６ 4. Stereotaxic surgery and drug injection
Male c57/BL6 mouse were anesthetized by injection of Tribromethanol (250 mg/kg, i.p) and positioned in a stereotaxic apparatus (David Kopf instruments, USA). ATP (400 nmole) in 0.8 ml sterile phosphate-buffered saline (PBS), unilaterally administered in to the striatum (AP, +0.2 mm; ML,-2.5 mm; DV,-3 mm from bregma), according to the atlas of The mouse brain in sterotaxic coordinates (Paxinos and Franklin, second edition). ATP was purchased from sigma (USA). All animals were injected using a Hamilton syringe equipped with a 30-gauge blunt needle to minimize mechanical damage attached to a syringe pump (KD Scientific, New Hope, PA). Drugs were infused at a rate of 0.2 ml/min. After injection, the needle was held in plasce for an additional 4 min before removal. We collected data from at least 3 animals for each time point (1 day~28 day) after injection. The contralateral sides were used as a control.
5. Tissue preparation
Mouse were anesthetized and transcardially perfused with saline solution containing 0.5% sodium nitrate and heparin (10 u/ml), followed by 4% paraformaldehyde in a 0.1 M phosphate buffer, pH 7.2, for tissue fixation. Brains were obtained and post-fixed overnight at 4°C in 4% paraformaldehyde. After 2 day, fixed brains were stored at 4°C in a 30% sucrose solution until they sank. Six separate series of 40-mm coronal brain sections were obtained using a cryostat (Leica CM3050S, Germany) and stored in anti-freeze stock solution (phosphate buffer pH 7.2 containing 30% glycerol, 30% ethylene glycol) at 4°C before use.
１７
For protein preparation, mouse was anesthetized and transcardially perfused with saline solution only for 2 min. Brains were removed and sliced with a Alto mouse brain slicer matrix (Stainless Steel Alto Coronal 1.0 mm Matrix (SA-2175), Roboz Surgical Instrument, USA) and a razor blade. A slice that included the needle injection spot was selected, and tissue blocks surrounding the needle tran were collected and stored at -70°C until use.
6. Immunohistochemistry
For 3,3’-diaminobenzidine (DAB) staining, every sixth serial section was selected, rinsed two times with PBS containing 0.2% Triton X-100 (PBST), treated with 3% H2O2 for 5 min and rinsed with PBST. Non-specific binding was blocked with 1% bovine serum albumen (BSA) in PBST. Tissue sections were incubated with antibodies (Table 1) during over night at room temperature. Sections were rinsed three times with PBST, incubated with biotinylated secondary antibodies (Vector Laboratories, USA), and visualized with avidin-biotin-peroxidase-DAB solution (0.05% DAB and 0.003% hydrogen peroxide in 0.1 M phosphate buffer) according to the manufacturer’s instructions. Sections were mounted on slides and examined under a bright field microscope (Olympus optical, BX51, Japan).
Images were captured using PictureFrame Application 2.3 software. Photographs of the most damaged section were presented in the results.
For immunofluorescence staining, sections were washed in PBST, treated with 1% BSA, and incubated with combinations of antibodies summarized in Table 1. For visualization, Alexa Fluor 488- or Alexa Fluor 555-conjugated secondary antibodies (1:600 dilution; Invitrogen) were used. Counterstaining with 4', 6-diamidino-2-phenylindol (DAPI; Vector Laboratories)
１８
was used to detect nuclei. Sections were analyzed under a confocal microscope (Carl Zeiss, Germany) with a water immersion objective. Images were captured using a confocal software (LSM Image Browser).
7. Histological quantification
Photographs of the most damaged section were taken. Sholl analysis and morphological change of GFAP and nestin positive cells were investigated using Neurolucida (MBF bioscience, Williston, VT, USA). Marker protein intensities were analyzed using Image J software.
8. Organotypic cortical slice cultures
Cortical slices were prepared as previously described (Stoppini et al, 1991) with a modification. c57/BL6 mice at postnatal day 7 were anesthetized, and the skull was removed.
Cortical slices (400 mm thick) were prepared using a McIlwain tissue chopper (Mickle Laboratory Engineering, Goose Green, UK) in a slice culture medium (50% MEM containing, 25% Hanks’ balanced salt solution, 25% heat-inactivated horse serum, 6.5 mg/ml glucose, 1 mM L-glutamine, 10 U/ml penicillin-G, and 10 mg/ml streptomycin). Slices were cultured in culture inserts (Millipore, Bedford, MA, USA) in 6 well plates. Medium was changed every other day. At 7 day, ATP (50 mM) was added. Cell viability in slices was assayed using ethidium homodimer-1 (Etd-1, Molecular Probes, Eugene, OR, USA). To inhibit STAT3, slices were treated with 50 mM 5,15-diphenylporphyrin (DPP, Sigma).
１９ 9. Cell culture
Primary astrocytes cells were cultured from the fore brain of WT and DJ-1 KO c57/BL6 mouse. In briefly mouse skulls were rapidly removed and brain was placed in a culture dish with DMEM (Hyclone, Logan UT, USA) containing 10% FBS (Hyclone).
Maninges was removed and brain wasmechanincally dissociated with gentle pipetting in the media. Dissociated brain cells were seeded on 75 cm2 T-flasks (0.5 hemisphere/flask), and were incubated in 37°C, 5% CO2 incubator for 2 ~ 3 weeks. After 2 ~ 3 weeks Primary astrocytes were removed with 0.1% trypsin and were seeded culture dish in DMEM containing 10% FBS.
BV2 cells were cultured in DMEM containing 5% FBS. For activation of BV2, cells were incubated with 5 ng/ml recombinant murine IFN- g (PeproTech, Rocky Hill, NJ, USA). For antagonization of PGD2 receptor in BV2, cells were incubated with PGD2 receptors antagonist (CAY1047 and TM30089 for DP2; BWA868C for DP1, 10 mM each;
Cayman Chemical Company). For inhibition of AKT phosphorylation, cells were incubated with PI3K inhibitors (LY294002, 2, 4 mM; Wortmanin, 50, 100 nM; Biomol, Plymouth Meeting, PA, USA). DJ-1 KO MEF cells were cultured in DMEM containing 10% FBS.
10. Western blot analysis
Protein was isolated from homogenated slices or brains tissues and prepared cells with modified RIPA buffer (50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM Na3VO4, and 1 mM NaF) containing protease inhibitor cocktail and phosphatase inhibitor cocktail (GenDEPOT, Barkor, TX, USA). Isolated proteins were
２０
separated by SDS-PAGE and transferred to nitrocellulose membranes. Membranes were incubated with specific antibodies (Table 1) overnight at 4°C. After washing with PBS, membranes were incubated with peroxidase-conjugated secondary antibodies, and visualized with enhanced chemiluminescence system (Daeil Lab Inc., Seoul, Korea). Band intensities were normalized with actin or GAPDH using Image J.
[Table 1] Antibody
２１ 11. Immunoprecipitation
Prepared cells were washed twice with PBS and were isolated protein with immunoprecipitation lysis buffer (1% triton-X 100, 1 mM Na3VO4, 1 mM NaF, 150 mM NaCl, 1mM EDTA, 1mM EGTA, 50 mM HEPES, 0.5 mM DTT) containing protease inhibitor cocktail and phosphatase inhibitor cocktail (GenDEPOT). Isolated protein supernatants were incubated with specific antibody (Table 1) during 4 hour on 4°C spin rotor.
After incubation, protein G agarose (Millipore, Bedford, MA, USA) was added with antibody incubated protein supernatants during 4 hour on 4°C spin rotor. Agarose beads were washed with PBS and proteins were isolated by boiling in 2x SDS-PAGE sample buffer.
Final protein sample was analyzed by Western blotting.
12. Quantitative real-time PCR (qPCR)
Total RNA was isolated from primary astrocytes by easy-BLUE reagent (iNtRON Biotechnology, Seoul, Korea). cDNA was synthesized using 1mg of total RNA and the cDNA synthesis kit (iNtRON) at the following temperatures : Denaturation with oligo d(T)15 primers during 5 min 75°C, cDNA synthesis with AMV RT enzyme miture during 60 min 42 °C and Termination reaction during 5 min 70 °C. qPCR was done using 2x KAPA SYBR Fast Master Mix (Kapa Biosystem, Cape Town, South Africa) and was used by RG-6000 real-time amplification instrument (Corbett Research, Sydney, Australia). qPCR amplification using specific primer (Table 2). The cycle threshold (Ct) for the gene transcript was normalized to the average Ct for transcripts of the housekeeping gene, actin, amplified
２２
in each reaction. Relative quantitation of normalized transcript abundance was determined using the comparative Ct method (DDCt), as described by the manufacturer.
13. Reverse transcriptase PCR (RT-PCR)
Total RNA was isolated from primary astrocytes by easy-BLUE reagent (iNtRON Biotechnology, Seoul, Korea). cDNA was synthesized using 1mg of total RNA and the cDNA synthesis kit (iNtRON) at the following temperatures : Denaturation with oligo d(T)15
primers during 5 min 75°C, cDNA synthesis with AMV RT enzyme miture during 60 min 42°C and Termination reaction during 5 min 70°C. RT-PCR was performed using specific primer (Table 2). The amplified products were separated by electrophoresis on a 1.5%
agarose gel and detected under UV light. Band intensities were analyzed using Image J.
[Table 2] Primer sequence
Primer Sense Anti-sense
TNF-a 5’-GTAGCCCACGTCGTAGCAAA 5’-CCCTTCTCCAGCTGGGAGAC HO-1 5’-TGCAGGTGATGCTGACAGAGG 5’-GGGATGAGCTAGTGCTGATCTGG L-PGDS 5’-GACACAGTGCAGCCCAACTTTC 5’-GGGCTACCACTGTCTTGCACATA Sox9 5’-GGACAACACATGCCTCTGCAA 5’-TCTCCAGCCACAGCAGTGAGTAA H-PGDS 5’-GCCAGTGCCACACACAGCTAA 5’-CGTCTTGCCCATGTCACCA
mPGES 5’-ACAGTGGTTTCAGCAGGGTGTC 5’-GTCCAGATTTGCAGCCAGGAG PGIS 5’-TGCGTACACGGCTGGACTTC 5’-CCTGCAGGTCTCTGTGCATCA Actin 5’-GCTCTGGCTCCTAGCACCAT 5’-GCCACCGATCCACACAGAGT
２３ 14. DNA constructs
Plasmid DNA for p3x FLAG-hDJ-1, hL166P, hE64D and hC106A plasmid was gifts from Prof. Park (Ajou University, Woncheon-dong Youngtong-gu Suwon, Kyunggi-do, Korea). HA-Ubi was gifts from Prof. Jou (Ajou University). pWPXL was a gift from Didier Trono (Addgene plasmid # 12257) and pWPXL-Sox9 was a gift from Bob Weinberg (Addgene plasmid # 36979).
15. Transfection
Cells were transiently transfected with plasmid DNA using jetPEI DNA transfection reagent (Polyplus Transfection, Boulevard Sébastien Brant, 67401 Illkirch Graffenstaden, FR), as explained by the manufacturer. Briefly, cells were incubated to DNA plasmid and jetPEI mixture for 4 hours. After 4 hour, media were replaced with fresh media. 3 days later, transfected cells were used for experiments.
Cortical slices plasmid DNA transfection was performed using a modified Zou &Crews method (Zou and Crews, 2010). Cortical slice culture tissues were transiently transfected with plasmid DNA using jetPEI DNA transfection reagent as explained by the manufacturer.
The transfection mixture was added to slice culture media and incubated in a total volume of 1.5 ml (0.5 ml on top of slices and 1 ml at bottom of the cultures) during 4 hours. After 4 hour, media were replaced with fresh media. 3 days later, transfected slice culture tissues were used for experiments.
16. Proximity ligation assay (PLA)
２４
Primary astrocytes were fixed with 4% paraformaldehyde, permeabilized with 0.1%
Triton X-100, and treated with 1% bovine serum albumen. Primary astrocytes were incubated with Sox9 and ubiquitin antibodies during over night at RT. After overnight, the sample was washed with PBS containing 0.1% Triton X-100(PBST) and was incubated with DNA probe-conjugated secondary antibodies (Olink Bioscience, Uppsala, Sweden) for 1 h at 37°C. The sample was washed and DNA probes were ligated for 30 min at 37°C, amplified for 2 h at 37°C, and examined under an Axiovert 200M microscope (Carl Zeiss).
17. Small interfering RNAs (siRNA)
The expression of target proteins, Sox9 and L-PGDS were knocked down by transiently transfection of mouse specific small interfering RNAs (siRNA; Genolution Pharmaceuticals, Seoul, Korea) as in Table 3. For transfections, the medium was replaced with Opti-MEM (Invitrogen) and astrocytes were treated with 10 nM siRNA and RNAiMAX transfection reagent, according to the manufacturer’s instructions (Invitrogen) for 5 days.
Knockdown of targets was confirmed by qPCR, RT-PCR and Western blot.
[Table 3] siRNA sequence
Primer Sense
Sox9 siRNA #1 5’- UUG UUA UAG UAA CAU AAA UAA UAU U-3’
Sox9 siRNA #2 5’- GGG GAA UAA ACA GAU AAC AUA GAU U-3’
L-PGDS siRNA #1 5’ GGGAGAAGAAAGCUGUAUUGUAUUU 3’
L-PGDS siRNA #2 5’ GGAGAAGAAAGCUGUAUUGUAUAUU 3’
２５ 18. Prostaglandin D2 (PGD2) ELISA
PGD2 expression level was measured by a commercial ELISA kits, according to the manufacturer’s instructions (Prostaglandind D2-MOX EIA kit, Cayman Chemical Company).
19. Inhibition of protein synthesis by cycloheximide
Cells were treated with 10 mg/ml cycloheximide (SIGMA-ALDRICH) for 1, 2 and 3 hours. After appropriate time intervals, cells were harvested and total proteins were prepared.
20. Inhibition of proteasomal degradation by MG132
Cells were treated with 10 mg/ml MG132 (SIGMA-ALDRICH) for 4 hours. After 4 hours, cells were harvested with lysis buffer containing 20 mM N-Ethylmaleimide (NEM;
SIGMA-ALDRICH) and total proteins were prepared.
21. Measurement of nitric oxide
The amount of nitrite formed from nitric oxide (NO) was measured by culture mediaum (50 mL) with an equal volume of Griess reagent (0.1% naphthylenthylene diamine, 1% sulfanilamide, 2.5% H3PO4), and then measuring optical density at 540 nm. (Ding, et al., 1988)
２６ 22. Statistical analysis
The statistical significance of differences between two groups was determined using unpaired two-tailed Student’s t tests.
２７
III. RESULTS
PART A. DJ-1, (PARK7), plays critical roles in astrogliosis by regulating of the pSTAT3 signaling pathway for tissue repair after brain injury
1. Repair of brain injury was attenuated in DJ-1 KO mice
To examine whether PD-related genes may be involved in the regeneration of the injured brain, I examined time-dependent changes following brain injury in wild type and DJ-1 KO mice. Brain injury was produced by stereotaxic injection of ATP into the striatum since ATP, a component of damage associated molecule patterns (DAMPs), induces brain damage (Amadio, et al., 2002;Cavaliere, et al., 2001a;Cavaliere, et al., 2001b;Jeong, et al., 2010;Melani, et al., 2005). The damaged sites were chased using a 9.4T MRI scanner (Fig.
1A), reconstructed using Neurolucida 3D-modeling (Fig. 1B), and calculated the volume of damaged tissue (Fig. 1C). At 1 day after injection, the volume of the damaged tissue did not differ between WT and DJ-1 KO mice brain: 4.5+0.14 mm3 and 4.4±0.27 mm3 in WT and DJ-1 KO, respectively (Fig. 1C, D). Thereafter, the volume of the damaged sites rapidly decreased within 1 week in both WT and DJ-1 KO mice brain and then slowly for up to 29 days (Fig. 1C, D). Interestingly, however, the repair of damage was retarded in DJ-1 KO mice brain. The volume of damaged tissue in WT group reduced to 1.6±0.1 mm3 (65±3.28%
of damaged volume at 1d after ATP injection) at 8 d, 1.0±0.02 mm3 (78±1.18%) at 15 d, and 0.3±0.04 mm3 (93±1.16%) at 29 d (Fig. 1C, D). However, in KO group, the damaged
２８
volumes reduced to 2.6±0.2 mm3 (42±6.38%) at 8 d, 2.1±0.13 mm3 (53±4.57%) at 15 d, and 0.5±0.01 mm3 (90±0.81%) at 29 d (Fig. 1C, D). These results showed that DJ-1 deficiency slowed the repair of the injured brain.
２９
Figure 1. DJ-1 deficiency causes a defect of repair after brain damage. Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 3 mice). (A) Damage areas were chased by 9.4T MRI at indicated time points after ATP injection. Yellow arrows showed damage areas. (B) ATP induced damage (red) were reconstructed by 3D-modeling of Neurolucida. (C) Damage volume was calculated (D) Repair ratio was quantified. Values are means ± SEMs of 3 mice (*P < 0.05).
３０
2. DJ-1 deficiency causes a defect of astrogliosis
In response to injury, astrocytes are activated and increase the expression of several proteins required for the maintenance of brain homeostasis and reconstruction of damaged brain (Eddleston and Mucke, 1993;Eng and Ghirnikar, 1994;Pekny and Nilsson, 2005;Sofroniew, 2009) Therefore, I examined whether the retarded repair of damage in the DJ-1 KO group may have been related to the responses of astrocytes. For this, brain sections were obtained from WT and DJ-1 KO mice from 1 d to 29 d after ATP injection, and the response of astrocytes was analyzed with GFAP specific antibodies (Fig. 2). Interestingly, astrogliosis was delayed in the DJ-1 KO brain in all penumbral regions, right, left, and below the damaged core region (Fig. 2A). I detected that reactive astrocytes showed progression of typical of astrogliosis in the WT brain, however progression was slowed and showed insufficient morphological change in the DJ-1 KO brain from 3 d to 7 d after ATP injection.
３１
Figure 2. DJ-1 deficiency causes a defect of GFAP+ astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 4-10 mice). Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections (*, damage core region). Penumbra regions were divided left (a), right (b) and bottom (c). Scale bars, 1 mm, 50 mm
３２
In response to the ATP injection, astrogliosis was detectable in the penumbral region at 3 d after injection of ATP (Fig. 3A). Since astrogliosis was not yet detectable at 1 d (Fig. 2A, 3A), I measured the astrocyte response from 3 d. According to the MRI results, GFAP-negative areas (blue dotted lines) reduced between 3 d to 29 d in both WT and KO brain (Fig. 3A). The volume of damaged tissue at each time point was quantified by Neurolucida 3D-modeling based on the analysis of at least eight sections from each animal stained with GFAP antibodies (Fig. 3B). As with the MRI data, the damaged volumes of tissue reduced more rapidly in the WT than in KO brain (Fig. 3B, C). GFAP negative volumes at 7 d were about 30% of that at 3 d in the WT brain, but about 60% in DJ-1 KO brain. At 14 d, however, GFAP negative volumes were reduced to about 90% in both WT and DJ-1 KO brain (Fig. 3B, C). In Western blot analysis using brain lysates, GFAP expression in the WT brain increased 2-2.5 folds at 3 d, 7 d and 14 d after the ATP injection, while GFAP expression in the DJ-1 KO brain only slightly (less than 1.8-folds) increased at 3 d, 7 d, and 14 d after injury (Fig. 3D). In the intact WT and KO brain, GFAP expression was similar (Fig. 3D). The smaller increase in GFAP expression in Western blot compared with that in immunostaining may be due to the inclusion of damaged tissue in the brain lysates.
３３
Figure 3. DJ-1 deficiency causes a defect of progression of astrogliosis. (A) Brain damage was induced by ATP (400 nmloe) injection in striatum in WT and DJ-1 KO mouse (n = 4-10 mice). Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections. Blue line showed endpoints of astrogliosis (B) Negative area of astrogliosis (red) were reconstructed by 3D-modeling of Neurolucida. Negative area was quantified (lower panel). (C) Protein samples were obtained to striatum at indicated time points after ATP injection and GFAP expression level was measured by Western blot with GFAP specific antibody (n = 3 mice). GFAP intensities were quantified (right panel).
GAPDH was used as a loading control. Values are means ± SEMs of 4-10 mice (A , B) and 3 mice (C) (*P < 0.05; ** P < 0.005). Scale bars, 1 mm, 200 mm (A)
３４
Next, I further examined the morphology of astrocytes in the WT and KO brain (Fig.
4). After the ATP injection, reactive astrocytes showed heterogeneous morphological features (Ding, 2014;Shimada, et al., 2012), important for the progression and function of astrogliosis (Namekawa, et al., 2002;Nawashiro, et al., 2000;Nawashiro, et al., 1998;Otani, et al., 2006).
In addition, insufficient morphological change of reactive astrocytes was also observed in PD patients (Mirza, et al., 2000;Song, et al., 2009). Interestingly, the patterns of astrogliosis were different in between the WT and DJ-1 KO brain in all penumbral regions, right, left, and below the damaged core, particularly, at 3 d and 7 d after injury (Fig. 4A). Astrocytes in the penumbral region next to the damaged core (Penumbra 1, P1) had a polarized morphology with long processes extended toward the damage core, but the cells in the penumbra region next to P1 (Penumbra 2, P2) had a hypertrophic but non polarized morphology (Fig. 4A, B). Interestingly, astrocytes from the DJ-1 KO brain in both P1 and P2 showed less activated morphology compared with WT astrocytes: shorter processes, fewer hypertrophic cell bodies, and a smaller increase in GFAP intensity (Fig. 4A, B, C), although astrocyte morphology and GFAP expression were similar in the intact brain of both groups (Fig. 5). Sholl analysis also showed that all parameters, cell volume, and number and length of processe, were reduced in both P1 and P2 in the KO astrocytes, particularly at 3 d and 7 d (Fig. 4A, B, C).
３５
Figure 4. DJ-1 deficiency causes a defect of morphology of GFAP+ reactive astrocytes.
(A) Brain sections were prepared at the indicated times after ATP injection and stained with GFAP antibody. Photographs of the most damaged sections were obtained and were analyzed with serial sections (n = 4-10 mice). Core region were showed damage area and penumbra 1 (P1) and penumbra 2 (P2) were separated by morphology of GFAP+ reactive astrocytes. (B) Morphology of GFAP+ reactive astrocytes between WT and DJ-1 KO was measured by Neurolucida on each penumbra region. (C) Morphological features of GFAP+ reactive astrocytes were quantified by Sholl analysis. Values are means ± SEMs of 40-50 cells (*P < 0.05; **P<0.005). Scale bar, 1 mm, 50 mm (A).
３６
Figure 5. Normal astrocytes are not different between WT and DJ-1 KO mouse brain.
(A) Brain sections were prepared and stained with GFAP antibody (n = 5 mice). (B) Normal cortical astrocytes were investigated by GFAP staining. (C) Normal striatal astrocytes were investigated by GFAP staining. (D) Protein samples were obtained from total brain and GFAP expression was analyzed by Western blot with GFAP specific antibody. GFAP intensities were quantified (lower panel). Actin was used as a loading control. Values are means ± SEMs of 3 mice (*P < 0.05; **P<0.005). Scale bars, 1 mm (A), 200 mm (B), 20 mm (B, inset), 500 mm (C), 20 mm (C, inset).
３７
Next, I compared nestin expression in the WT and DJ-1 KO brain since nestin, a marker of reactive astrocytes, has been known to regulate the repair of injury in the brain (Duan, et al., 2015;Lin, et al., 1995;Sirko, et al., 2013;Wiese, et al., 2004), and repair-related processes of proliferation, migration, invasion of cells (Akiyama, et al., 2013;Narita, et al., 2014;Zhao, et al., 2014), and angiogenesis (Matsuda, et al., 2013). After nestin staining, I found that nestin expression dramatically increased in P1 but not in P2 at 3 d and 7 d after ATP injection (Fig 6A, 7A) and nestin expressing cells were GFAP positive reactive astrocytes after ATP injection (Fig 6B). As expected, nestin expression was delayed and reduced in the striatum of the DJ-1 KO brain (Fig 7A, Fig 8A, B) although nestin was barely expressed in both the intact striatum of either group (Fig 7A). Sholl analysis of nestin-positive cells confirmed that morphological parameters such as cell volume, number of process branches, and length of processes, were reduced in the DJ-1 KO brain (Fig 8C, D).
At 3 d and 7 d, the morphological features of reactive astrocytes in the DJ-1 KO striatum showed a 30-50% reduction in all parameters. Taken together, these data showed that DJ-1 deficiency causes abnormal responses of in the astrocytes of the injured brain, which led me to examine the expression of functional markers of astrocytes.
３８
Figure 6. Nestin locate in GFAP+ reactive astrocytes on penumbra from only damage near site after brain injury. (A) Brain sections were prepared and stained with nestin antibody. Nestin+ reactive astrecytes were located on penumbra ‘1’ region of GFAP+
Figure 6. Nestin locate in GFAP+ reactive astrocytes on penumbra from only damage near site after brain injury. (A) Brain sections were prepared and stained with nestin antibody. Nestin+ reactive astrecytes were located on penumbra ‘1’ region of GFAP+