• 검색 결과가 없습니다.

저작자표시

N/A
N/A
Protected

Academic year: 2024

Share "저작자표시"

Copied!
41
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

저작자표시 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게

l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. l 이차적 저작물을 작성할 수 있습니다.

l 이 저작물을 영리 목적으로 이용할 수 있습니다. 다음과 같은 조건을 따라야 합니다:

l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건 을 명확하게 나타내어야 합니다.

l 저작권자로부터 별도의 허가를 받으면 이러한 조건들은 적용되지 않습니다.

저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다. 이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다.

Disclaimer

저작자표시. 귀하는 원저작자를 표시하여야 합니다.

(2)

의학석사 학위논문

췌장암에서의 상피세포의 간질세포 변이 관련 microRNA의 발현 양상

EMT-related microRNA expression pattern in pancreatic cancer

2013 년 2 월

서울대학교 대학원

임상의과학과

송 병 준

(3)

췌장암에서의 상피세포의 간질세포 변이 관련 microRNA의 발현 양상

EMT-related microRNA expression pattern in pancreatic cancer

지도교수 황 진 혁

이 논문을 의학석사 학위논문으로 제출함.

2012년 10월

서울대학교 대학원

임상의과학과

송 병 준

임상의과학의 의학석사 학위논문을 인준함.

2013년 2월

위 원 장 (인)

부위원장 (인)

위 원 (인)

(4)

학위논문 원문제공 서비스에 대한 동의서

본인의 학위논문에 대하여 서울대학교가 아래와 같이 학위논문 저작물을 제공하는 것에 동의합니다.

1. 동의사항

① 본인의 논문을 보존이나 인터넷 등을 통한 온라인 서비스 목적으로 복제할 경우 저작물의 내용을 변경하지 않는 범위 내에서의 복제를 허용합니다.

② 본인의 논문을 디지털화하여 인터넷 등 정보통신망을 통한 논문의 일부 또는 전부의 복제․배포 및 전송 시 무료로 제공하는 것에 동의합니다.

2. 개인(저작자)의 의무

본 논문의 저작권을 타인에게 양도하거나 또는 출판을 허락하는 등 동의 내용을 변경하고자 할 때는 소속대학(원)에 공개의 유보 또는 해지를 즉시 통보하겠습니다.

3. 서울대학교의 의무

①서울대학교는 본 논문을 외부에 제공할 경우 저작권

보호장치(DRM)를 사용하여야 합니다.

②서울대학교는 본 논문에 대한 공개의 유보나 해지 신청 시 즉시 처리해야 합니다.

논문제목: 췌장암에서의 상피세포의 간질세포 변이 관련 microRNA 의 발현 양상

학위구분: 석사 □․박사 □ 학 과: 임상의과학과 학 번: 2011-21993 연 락 처:

저 작 자: 송 병 준 (인) 제출일: 2013 년 2 월

서울대학교총장 귀하

(5)

i

국문 초록

췌장암에서의 상피세포의 간질세포 변이 관련 microRNA의 발현 양상

배경 및 목적: 췌장암은 예후가 매우 불량한 암으로 현재까지 수술에 의 한 완전 절제만이 장기 생존을 기대할 수 있는 유일한 방법이다.

microRNA (miRNA)는 췌장암에서 다양한 mRNA의 번역을 조절함으로 써 생체 내에서 다양한 기능을 하는 것이 알려져 있으며. EMT (epithelial-mesenchymal transition)가 여러 암에서 전이와 관련이 있 고 이의 작용에 miRNA가 영향을 주는 것으로 보고되었다. 본 연구에서 는 췌장암에서 miRNA의 발현양상을 살피고 역할을 알아보고자 하였다.

방법: 췌장암으로 진단된 환자 중 조직이 활용 가능하고 근치적 목적의 수술을 시행한 84명의 환자에서 miRNA를 분석하기 위해 RNA를 추출 하고. RT PCR을 활용하여 miR-200 family (200a, 200b, 200c, 141), miR-205의 발현을 불멸화 정상 췌장조직 췌장 세포(HPDE)와 비교하여 정량적으로 측정하였다. 또한 실험 결과를 바탕으로 miRNA의 발현양상

(6)

ii

과 췌장암 환자의 임상 데이터를 비교 분석 하였다.

결과: 환자들은 진단 이후 사망하거나 중도 절단할 때까지 추적 관찰 하 였다(1999-2011). 추적 관찰한 환자들의 평균 생존 기간은 평균 25 개 월이었다. R0 절제는 총 71명의 환자(84.5%)에서 이루어졌고 대부분의 환자가 II기였고 IIA가 37명, IIB 가 45명이었다. 17명의 환자(20.2%)에 서 수술 후 gemcitabine을 이용한 보조 항암 화학요법이 시행되었다.

miR-200a/200b/200c/141/205는 췌장암 조직에서 정상 세포인 HPDE 세포주에 비해 발현이 각각 266.9 ± 57.3 배/18.5 ± 2.2 배/0.7 ± 0.1 배/27.2 ± 6.6 배/0.1 ± 0.1 배로 발현되었다. 이 중에서 miR-200c가 높게 발현된 군에서 Kaplan-Meier 분석에서 생존기간이 유의하게 단축 되었고(평균 35개월 vs. 19 개월, p = 0.013), 다변량 분석에서 1.66 배 (HR; 95% CI, 2.1-33; p = 0.044) 높은 사망률을 보였다.

결론: miR-200c는 췌장암 환자에서 예후에 독립적인 인자로 작용하나 기존의 보고와 달리 높게 발현되는 경우 나쁜 예후를 보였다. miR-200c 는 향후 췌장암의 진단과 치료의 목표로서 의미가 있을 것으로 판단되며 향후 췌장암에서 miR-200c의 역할에 대한 추가적인 연구가 필요할 것 으로 생각한다.

(7)

iii

주요어: 췌장암, miRNA, EMT, miRNA-200c 학번: 2011-21993

(8)

iv

목 차

초록……… i

목차……… iv

LIST OF TABLES……… v

LIST OF FIGURES………vi

본문……… 1 서론………1

2 대상 및 방법………4

3 결과………8

4 고찰……….11

참고문헌……….14

영문 초록………30

(9)

v

List of Tables

Table 1………19

Table 2………20

Table 3………21

Table 4………22

Table 5………23

Table 6………24

Table 7………25

Table 8………26

Table 9………27

(10)

vi

List of Figures

Figure 1………28

Figure 2………29

(11)

1

서론

췌장암은 예후가 극히 불량한 암종으로 진단 후 5년 생존율이 5%

내외인 치명적인 질환이다.1, 2 또한 현재까지 수술에 의한 완전 절제만이 장기 생존을 기대할 수 있는 유일한 방법이지만, 수술을 받은 환자라도 대부분 재발을 하여 임파절 전이가 없는 환자의 경우에도 5년 생존율이 25-30% 정도 밖에 되지 않을 정도로 예후가 매우 나쁜 것으로 알려져 있다.3, 4

microRNA(miRNA)는 1993년 Caenorhabditis elegans(꼬마선충)에서 발견된 후 초파리 및 사람 등에서도 발견되었고 이후로 현재까지 700종 이상의 miRNA가 인간세포에 존재

하고 있음이 밝혀졌다.5, 6 miRNA는 그 크기가 21-25개의 염기인 작은 noncoding RNA 분자이며, 주로 표적 유전자의 3’-UTR 결합부위에 상보적인 염기서열을 가지면서 그 표적유전자의 단백합성을 억제하거나 촉진시키는 기능을 보유한 것으로 알려져 있다. miRNA는 인간의 전체 유전자의 약 30% 이상을 조절하는데 관여하는 것으로 알려져 있으며 생체 내에서 다양한 mRNA의 번역을 조절함으로써 세포분화, 성장 및 증식 등에 관여하고 특히 여러 암종에서 비정상적인 증가 및 감소를 보이면서 중요한 발암기전으로 작용함이 밝혀졌다. 이후 현재까지 miRNA를 이용한 연구가 전세계적으로 활발하게 진행되고 있다.7-12

췌장암에서도 정상 췌장에 비해 miR-21, miR-221/222, miR-181a/b/c 등을 포함한 21 개의 miRNA 의 발현이 증가되어 있어 췌장암에서

(12)

2

miRNA 가 중요한 역할을 담당할 것으로 알려져 있으며 많은 연구가 진행 중이다.13

일반적으로 암의 전이에 있어 암세포는 원발 부위에서 떨어져 나와 기질로 침습을 한 후에 혈관이나 림프관을 통하여 순환하게 된다. 이후 혈관내피세포에 부착하여 새로운 부위에 침습하고 성장하게 된다.

이러한 암의 전이 과정은 EMT (epithelial-mesenchymal transition) 및 MET (mesenchymal-epithelial transition)와 밀접한 관련이 있는 것으로 보이고, 특히 EMT가 암의 전이에 중요한 역할을 하는 것으로 알려져 있다.14, 15 상피세포에 transforming growth factor (TGF)-β로 자극을 주면 EMT가 유도되고 암줄기세포(cancer stem cells, CSCs)와 비슷한 표현형을 보이게 된다. 이러한 연구 결과를 바탕으로 EMT가 암줄기세포의 생성과 작용에도 관여함을 알 수 있다.16 또한, EMT는 항암제에 대한 내성에도 관계가 있어 난소암, 유방암 외에도 대장암, 간암, 췌장암 등의 주요 소화기 암종에서도 EMT가 항암제에 대한 내성을 유도하여 환자의 예후와 밀접한 관련이 있음이 보고되었다.17-20 따라서 EMT는 종양의 발생과 진행 및 전이에 있어 중요한 관련성이 있고, 항암제에 대한 내성과 암줄기세포의 특성을 획득하는 과정에도 역시 중요한 역할을 할 것으로 생각한다. 이러한 EMT 과정에 miRNA가 관여하는 것으로 알려져 있으며 miR-200 family와 miR-205가 E- cadherin전사의 억제 인자인 ZEB1과 ZEB2 (SIP1)를 표적으로 하여 전이 과정을 조절하는 것으로 보고되었다.21

본 연구에서는 췌장암으로 수술을 시행 받은 환자의 췌장암 조직을 이용하여 EMT와 관련된 것으로 알려진 miR-200 family(miR-

(13)

3

200a/200b/200c/141), miR-205의 발현양상을 살피고 이를 실제 임상 데이터와 비교하여 miRNA의 역할을 알아보고자 하였다.

(14)

4

대상 및 방법

1) 대상 환자

서울대학교병원과 분당서울대학교 병원에서 1999년부터 2011년까지 췌장암으로 진단되어 완치 목적으로 수술을 시행하였던 환자를 대상으로 하였다. 고식적인 목적으로 수술을 하였던 환자는 제외하였고 수술 후 30일 이내 사망한 환자 역시 수술로 인한 합병증으로 사망한 것으로 판단하여 분석에서 제외하였다. 그 결과 총 84명의 환자에서 분석을 시행하였다. 전체 생존 기간은 평균 25.0 ± 2.3개월(2-140개월)이었다.

2) 파라핀 조직에서 RNA의 분리

환자의 파라핀 조직을 절단 후에 총 핵산 분리 키트(Ambion, Austin, TX, USA)를 사용하여 RNA를 추출하였다.22-25 파라핀 블록을 10 μm 두께로 얇게 절단하여 100% xylene에 넣은 후 50℃에서 3분간 처리 후 100% 에탄올로 두 번 세척하여 완전히 말렸다. 이후 키트에 단백분해효소(protease)와 완충액을 넣고 50℃에서 30분간의 처리 과정을 시행하고 추출액(additive/ethanol mixture)을 넣어 혼합한 이후 필터 카틸리지(filter cartridge)에 넣고 700 μL 분리 키트 세척완충액 1번과 500 μL 세척완충액 2/3번을 이용하여 세척한 후 10,000 rpm에서

(15)

5

30초간 원심 분리하여 세척액을 모두 제거하였다. 이후 4 μL DNA분해효소, 50 μL의 RNase-free water와 6 μL 10X DNA분해효소 완충액을 필터에 넣고 30분간 25℃에서 보관 후 다시 세척하였다.

3) 불멸화 정상 세포주 배양 및 RNA 추출

췌장암에서의 miRNA 의 발현을 정상에서의 발현 양상과 비교하기 위하여 불멸화된 정상 췌장조직 세포주 (HPDE)를 이용하였다. HPDE는 5% 우태하혈청(Gibco-BRL)과 750 ng/mL puromycin을 포함한 low glucose DMEM(Gibco-BRL)와 medium M3 base(Incell Co., San Antonio, TX, USA)의 3:1 혼합액에서 배양하였다. 배양한 세포주를 Trypsin-EDTA를 이용하여 분리하였고, 이를 원심분리(300×g, 5 min)하여 모은 후 350 μL LRT 용액을 넣고 1분간 잘 혼합하여 세포를 분해하였다. 이후 350 μL 70% 에탄올을 넣고 mix한 후 제공된 RNeasy spin column에 옮겨 원심분리(10,000 rpm, 15 sec)를 시행하고 700 μL RW1 용액을 넣고 원심분리하였다. 마지막으로 500 μL RPE 용액을 넣고 다시 원심분리 한 후 30 μL RNase-free water로 RNA를 추출하였다.

4) Quantitative real-time PCR(qRT-PCR)

(16)

6

위의 방법으로 분리하여 정량한 5μg의 RNA는 reverse transcription premix(Maxime RT premix, 인트론, 서울, 한국)으로 42℃에서 50분간 반응 시킨 후 95℃에서 10분간 반응하여 cDNA를 합성하였다. 이후 합성한 cDNA를 miScript SYBR Green PCRkit(Qiagen, Valencia, CA, USA)를 이용하여 cDNA 3ng, SYBR Green master mix 10 μl, universal primer 1 μl 및 각 miRNA primer 1 μl를 혼합한 후, 전체 부피가 20 μl가 되도록 DEPC를 처리한 물로 적정하였다. 95℃에서 15분간 반응시킨 후, 94℃에서 15초, 55℃에서 30초, 70℃에서 30초를 45회 반복하여 반응시켰다. 분석은 7500 Real-time PCR System(Applied Biosystems, Foster, CA, USA)을 이용하여 PCR 결과를 Ct 값에 따른 miRNA양을 정량적으로 계산하여 분석하였다. 정량을 위한 내부 대조군(internal control)으로는 U6를 이용하였고. PCR 산물의 특이성을 확인하기 위하여 melting curve를 사용하였다. PCR 분석에 사용된 각 miRNA primer는 Table 1에 나타내었다.

5) 통계분석

기술 통계로 연속 변수의 평균, 표준평균오차 및 중앙값을 구하였고 비연속 변수의 빈도를 측정하였다. miRNA가 재발이나 전이에 미치는 영향을 알아보기 위하여 각각의 군을 나누어 Student’s t-test를 시행하였다. Pearson 상관관계 분석을 이용하여 각각의 miRNA와 진단

(17)

7

이후 전체 생존기간의 관계를 확인하였다. 생존기간과 수술 이후 재발까지의 무병생존기간은 Kaplan-Meier curve법을 통해 구하였으며 생존기간에 영향을 주는 예후 인자를 찾기 위한 단변량 분석의 비교는 log rank test를 통해 이루어졌다. 단변량 분석에서 p값이 0.1 이하인 인자는 cox proportional hazards model을 통해 다변량 분석을 하였으며 이를 통해 상대위험도를 산출하였다. p < 0.05의 경우에서 통계적 유의성이 있는 것으로 간주하였다.

(18)

8

결과

1) 환자의 임상상

총 84명의 환자에서 췌장암 진단 시 평균 연령은 62.6 ± 0.9세였다.

남성이 52명, 여성이 32명이었다. 79명(94%)의 환자가 adenocarcinoma였고 R0 resection은 71명(84.5%)에서 이루어졌다.

진단 당시 병기는 대부분 2기였으며 2A가 37명(44.0%) 2B가 45명(53.6%) 이었다. 수술 이후 보조 항암화학치료나 방사선치료를 시행한 경우는 각각 43예와 45예였다. Gemcitabine을 사용하여 보조 항암화학치료를 시행한 경우는 17명(20.2%) 였으며 추적 관찰 기간 중 70명에서 재발이 발견되었고, 25명이 국소 재발, 45명이 원격 전이에 의한 재발이었다. 평균 재발기간은 16.0 ± 2.2개월 이었다. 환자의 특성은 Table 2에 요약하였다.

2) 췌장암에서의 miR-200 family와 miR-205의 발현 양 상

환자의 검체에서 전술한 방법으로 qRT-PCR을 통하여 mir- 200a/200b/200c/141, miR-205의 발현을 조사하였다. HPDE에 비해서

(19)

9

miR-200a는 평균 266.9 ± 57.3 배, miR-200b는 18.5 ± 2.2 배, miR- 200c는 0.7 ± 0.1 배, miR-141은 27.2±6.6 배, miR-205는 0.1 ± 0.1 배로 발현 되었다(Table 3). 재발한 환자와 재발하지 않은 환자, 각각의 miRNA의 발현 양상은 통계적으로 유의한 차이가 없었고(Table 4), 국소 재발과 원격 전이군에서 역시 통계적으로 유의한 차이는 없었다(Table 5).

3) miR-200 family와 miR-205의 발현 양상과 예후 인자 및 생존 분석

miR-200a/200b/200c/141, miR-205의 발현과 생존 기간과의 상관관 계를 확인하였을 때 miR-200c(r = -0.22, p = 0.043)를 제외하고 다른 miRNA는 통계적으로 유의한 상관 관계를 보이지 않았다. 생존기간과 각각의 miRNA의 발현양상을 산점도로 그렸을 때 miR-200c 만이 비교 적 고른 분포를 보였다(Figure 1).

연구 결과를 바탕으로 환자 수와 miR-200c의 평균 값을 고려하여 miR-200c의 발현이 높게 발현되는 군(>0.65, 29명)과 낮게 발현되는 군(<0.65, 55명)으로 나누어 분석을 시행하였고 miR-200c가 낮게 발현되는 군이 유의하게 생존기간이 높음을 확인할 수 있었다(평균 35개월 vs. 19개월, p=0.013)(Figure 2A). 생존기간에 영향을 주는 예후 인자를 찾기 위한 단변량 분석을 시행하였고(Table 6), 이를 바탕으로

(20)

10

다변량 분석을 시행했을 때 miR-200c가 높게 발현되는 군에서 1.66배(HR; 95% CI, 2.1-33; p = 0.044) 높은 사망률을 보였고 다른 인자들은 통계적으로 유의하지 않았다(Table 7).

무병생존기간에 대하여 miR-200c의 발현 양상에 따라 생존곡선을 구하였으나 차이가 통계적으로 유의하지 않았다(평균 24개월 vs. 12개월, p = 0.061)(Figure 2B). 무병생존기간에 대해서도 단변량 분석을 시행하였고(Table 8), 이를 바탕으로 다변량 분석을 시행했을 때 통계적으로 유의한 인자는 없었다(Table 9).

(21)

11

고찰

RT-PCR을 이용하여 84명의 환자의 췌장암 조직과 불멸화 정상 세포주를 대조군으로 분석한 결과, 이들 환자에서 miR- 200a/200b/141이 상승되어 있음을 관찰하였고 miR-200c/205는 낮게 발현됨을 확인할 수 있었다.

췌장암의 발생에 EMT가 관여한다는 근거로는 정상 췌장에서는 Snail과 Slug가 발현되지 않으나 췌장암에서 각각 78%와 50%에서 발현된다는 것과 췌장암 세포주를 저산소로 자극하였을 때 Twist가 발현되고 SIP1은 진행성 췌장암에서 더 많이 발현되며, 췌장암 세포주에서 1형 콜라겐 자극 시 SIP1 발현이 증가한다는 연구 결과들을 들 수 있다.26, 27 또한 gemcitabine 저항을 보인 췌장암 세포주에서는 EMT 표지자 및 암줄기 세포 표현형이 동시 발현되고, Notch 신호를 억제하면 MET를 반영하는 vimentin, ZEB1, Slug, Snail, NF-κB의 발현 감소가 보고되었다.28, 29 miR-200 family (miR-200a/200b/200c/miR- 141)와 miR-205는 EMT를 유발하는 zinc finger E-box binding homeobox(ZEB1/ZEB2)를 억제함으로써 EMT를 억제하는 것으로 알려졌으며, 여러 암종에서 miR-200 family가 억제되어 있는 것이 보고되었다.21, 30 따라서 본 연구에서 실제 췌장암 환자의 조직에서 miR-200c/205의 발현의 억제를 확인한 것은 의미가 있을 것으로 생각한다.

(22)

12

본 연구 결과 miR-200c가 췌장암의 독립적인 예후 예측인자로 사용될 수 있음을 확인한 다른 연구들과 같이 miR-200c가 환자의 췌장암 조직에서 억제되어 있음을 확인하였으나31, 본 연구에서는 이전 연구 결과와 달리 miR-200c가 낮게 발현되는 군에서 생존율이 더 우수한 것으로 확인되었다. 이러한 상반된 결과는 miRNA가 발현되는 환경에 따라서 역할을 달리할 수 있다는 점과 miRNA의 작용에 있어 여러 가지 다양한 상호작용이 관련될 가능성을 시사한다. 실제로 같은 miRNA라도 인종이나 유전적 요인과 후성적 요인, 더 나아가 사회 경제적 지위나 환경에 따라 발현 양상이 달라질 수 있음이 알려져 있다32. 또한 자궁 근종으로 진단 받았던 환자의 자궁 근종 조직에서 같은 miRNA라도 발현이 인종에 따라 달라짐이 보고 되었다33. 이전의 연구 결과는 일본인만을 대상으로 한 연구로 한국인만을 대상으로 한 본 연구와 국가 및 민족적인 차이도 상반된 연구 결과의 원인으로 추정할 수 있다.

이번 연구에서 시행한 단변량분석 결과에서(Table 3, 5) R0 resection 여부가 무병생존기간(p = 0.024)에는 영향을 주지만 전체 생존기간(p = 0.539)에는 영향을 주지 못하며, 수술 이후 gemcitabine을 사용한 경우(p = 0.044)에 생존 기간이 유의하게 증가하는 것을 확인할 수 있었다. 이는 췌장암이 다른 암종과 달리 영상 검사 기술의 발전과 건강 검진의 증가로 진단 초기에 수술을 하는 환자가 증가하고 있지만 예후가 여전히 불량한 점과 관련이 있을 것으로 생각할 수 있다. 따라서 췌장암은 진단 당시에 이미 미소 전이가 되어 있는 환자가 많을 것으로

(23)

13

추측 가능하며 이에는 EMT가 관여할 것으로 생각한다. 또한 췌장암의 치료에 있어 항암 화학 치료의 역할을 시사하는 점이라 하겠다.

수술 후 보관하는 검체는 주로 파라핀으로 보관되며 이런 검체에서 RNA를 추출하면 RNA 자체의 변형과 분해가 문제점이 될 수 있고, 췌장 조직의 경우 췌장효소에 의한 RNA의 변질로 인하여 RNA 분석이 다른 조직보다 더 어려울 수 있다. 그러나 miRNA는 적은 수의 뉴클레오타이드로 이루어져 이러한 변형이 적을 것으로 예측 가능하며 본 연구에서도 대부분의 검체에서 miRNA의 검사가 가능하였다.34

본 연구의 제한점으로는 수술하였던 환자만을 대상으로 하였기 때문에 대부분 stage II의 환자만을 대상으로 하여 전체 췌장암 환자의 특징을 대표하기 어렵고, 환자의 임상 상에 대한 후향적인 분석으로 인한 오류 등을 생각할 수 있다. 이러한 이유 등으로 기존의 췌장암의 예후 예측 인자로 알려진 병기나 임파절 전이 여부 등이 통계적으로 의미가 없는 것으로 나왔을 가능성이 있다. 또한 환자 수가 상대적으로 적은 것도 단변량 분석에서 생존에 관계 있던 요인들이 다변량 분석에는 통계적 유의성을 잃게 된 원인으로 생각할 수 있다.

본 연구에서는 정상 췌장 세포에 비하여 췌장암 환자의 실제 췌장암 조직에서 miR-200a/200b/141은 증가하고 miR-200c/205는 감소하는 것을 확인하였고, miR-200c의 경우 기존 보고와 달리 발현이 많이 될수록 나쁜 예후와 관련이 있음을 확인하였다. 향후 miR-200c가 췌장암의 진행과 전이에 있어 어떤 과정으로 기여하는 지에 대한 추가 연구가 필요하다.

(24)

14

참고문헌

1. Li D, Xie K, Wolff R, et al. Pancreatic cancer. Lancet 2004;363:1049-57.

2. Yeo TP, Hruban RH, Leach SD, et al. Pancreatic cancer. Curr Probl Cancer 2002;26:176-275.

3. Maitra A, Kern SE, Hruban RH. Molecular pathogenesis of pancreatic cancer. Best Pract Res Clin Gastroenterol 2006;20:211-26.

4. Rosty C, Goggins M. Early detection of pancreatic carcinoma.

Hematol Oncol Clin North Am 2002;16:37-52.

5. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993;75:843-54.

6. Ambros V. microRNAs: tiny regulators with great potential. Cell 2001;107:823-6.

7. Krutzfeldt J, Rajewsky N, Braich R, et al. Silencing of microRNAs in vivo with 'antagomirs'. Nature 2005;438:685-9.

8. Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature 2005;435:834-8.

9. Scherr M, Venturini L, Battmer K, et al. Lentivirus-mediated antagomir expression for specific inhibition of miRNA function.

(25)

15

Nucleic Acids Res 2007;35:e149.

10. He L, He X, Lowe SW, et al. microRNAs join the p53 network-- another piece in the tumour-suppression puzzle. Nat Rev Cancer 2007;7:819-22.

11. Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer 2006;6:857-66.

12. Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer 2006;6:259-69.

13. Bloomston M, Frankel WL, Petrocca F, et al. MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA 2007;297:1901-8.

14. Wells A, Yates C, Shepard CR. E-cadherin as an indicator of mesenchymal to epithelial reverting transitions during the metastatic seeding of disseminated carcinomas. Clin Exp Metastasis 2008;25:621-8.

15. Thompson EW, Williams ED. EMT and MET in carcinoma--clinical observations, regulatory pathways and new models. Clin Exp Metastasis 2008;25:591-2.

16. Mani SA, Guo W, Liao MJ, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008;133:704-15.

17. Kajiyama H, Shibata K, Terauchi M, et al. Chemoresistance to

(26)

16

paclitaxel induces epithelial-mesenchymal transition and enhances metastatic potential for epithelial ovarian carcinoma cells. Int J Oncol 2007;31:277-83.

18. Yang AD, Fan F, Camp ER, et al. Chronic oxaliplatin resistance induces epithelial-to-mesenchymal transition in colorectal cancer cell lines. Clin Cancer Res 2006;12:4147-53.

19. Hiscox S, Jiang WG, Obermeier K, et al. Tamoxifen resistance in MCF7 cells promotes EMT-like behaviour and involves modulation of beta-catenin phosphorylation. Int J Cancer 2006;118:290-301.

20. Hiscox S, Morgan L, Barrow D, et al. Tamoxifen resistance in breast cancer cells is accompanied by an enhanced motile and invasive phenotype: inhibition by gefitinib ('Iressa', ZD1839). Clin Exp Metastasis 2004;21:201-12.

21. Gregory PA, Bert AG, Paterson EL, et al. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol 2008;10:593-601.

22. Abrahamsen HN, Steiniche T, Nexo E, et al. Towards quantitative mRNA analysis in paraffin-embedded tissues using real-time reverse transcriptase-polymerase chain reaction: a methodological study on lymph nodes from melanoma patients. J Mol Diagn 2003;5:34-41.

23. Godfrey TE, Kim SH, Chavira M, et al. Quantitative mRNA expression analysis from formalin-fixed, paraffin-embedded tissues

(27)

17

using 5' nuclease quantitative reverse transcription-polymerase chain reaction. J Mol Diagn 2000;2:84-91.

24. Doleshal M, Magotra AA, Choudhury B, et al. Evaluation and validation of total RNA extraction methods for microRNA expression analyses in formalin-fixed, paraffin-embedded tissues. J Mol Diagn 2008;10:203-11.

25. Zhang X, Chen J, Radcliffe T, et al. An array-based analysis of microRNA expression comparing matched frozen and formalin-fixed paraffin-embedded human tissue samples. J Mol Diagn 2008;10:513- 9.

26. Hotz B, Arndt M, Dullat S, et al. Epithelial to mesenchymal transition: expression of the regulators snail, slug, and twist in pancreatic cancer. Clin Cancer Res 2007;13:4769-76.

27. Imamichi Y, Konig A, Gress T, et al. Collagen type I-induced Smad- interacting protein 1 expression downregulates E-cadherin in pancreatic cancer. Oncogene 2007;26:2381-5.

28. Shah AN, Summy JM, Zhang J, et al. Development and characterization of gemcitabine-resistant pancreatic tumor cells. Ann Surg Oncol 2007;14:3629-37.

29. Wang Z, Li Y, Kong D, et al. Acquisition of epithelial-mesenchymal transition phenotype of gemcitabine-resistant pancreatic cancer cells is linked with activation of the notch signaling pathway. Cancer Res

(28)

18

2009;69:2400-7.

30. Burk U, Schubert J, Wellner U, et al. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep 2008;9:582-9.

31. Yu J, Ohuchida K, Mizumoto K, et al. MicroRNA, hsa-miR-200c, is an independent prognostic factor in pancreatic cancer and its upregulation inhibits pancreatic cancer invasion but increases cell proliferation. Mol Cancer 2010;9:169.

32. Huang RS, Gamazon ER, Ziliak D, et al. Population differences in microRNA expression and biological implications. RNA Biol 2011;8:692-701.

33. Wang T, Zhang X, Obijuru L, et al. A micro-RNA signature associated with race, tumor size, and target gene activity in human uterine leiomyomas. Genes Chromosomes Cancer 2007;46:336-47.

34. Park YG, Lee KH, Lee JK, et al. [MicroRNA expression pattern in intraductal papillary mucinous neoplasm]. Korean J Gastroenterol 2011;58:190-200.

(29)

19

Table 1. miRNA primer sequences for quantitative real-time PCR analysis

miRNA Primer sequences miR-200a CGTAACACTGTCTGGTAACGATGT

GGTAATACTGCCTGGTAATGATGA CTGCCGGGTAATGATGGA GCTAACACTGTCTGGTAAAGATGG

CTTCATTCCACCGGAGTCTG

miR-200b

miR-200c miR-141 miR-205

U6 GGCAGCACATATACTAAAATTGGAA

(30)

20

Table 2. Clinicopathological characteristics of 84 patients with pancreatic cancer

Mean age 64 years (range, 44-83 years) Sex (Male/Female) 52 (61.9%)/32 (38.1%)

Histological diagnosis

Adenocarcinoma 79 (94.0%) Adenosquamous carcinoma 1 (1.2%) Mucoepidermoid carcinoma 1 (1.2%) Undifferenciated carcinoma 2 (2.4%) Anaplastic carcinoma 1 (1.2%)

R0 resection 71 (84.5%)

pT stage

pT1/T2 0 (0.0%)/2 (2.4%)

pT3/T4 81 (96.4%)/1 (1.2%) pN stage

pN0 36 (42.9%)

pN1 48 (57.1%)

AJCC stage

IA/IB 0 (0.0%)/ 1 (1.2%)

IIA/IIB 37 (44.0%)/ 45 (53.6%)

III/IV 1 (1.2%)/0 (0.0%)

Angiolymphatic invasion (positive) 39 (46.4%) Venous invasion (positive) 17 (20.2%) Perineural invasion (positive) 59 (70.2%)

Adjuvant chemotherapy/gemcitabine 43 (51.2%)/17 (20.2%) Post operative radiation therapy 45 (53.6%)

Local recurrence/distant metastasis 25 (29.8%) / 45 (53.6%)

(31)

21

Table 3. MiRNA expression levels in pancreatic cancer tissue comparing with immortalized pancreatic duct epithelial cell line

miRNA HPDE Mean ± SEM

miR-200a 1 266.9 ± 57.3

miR-200b 1 18.5 ± 2.2

miR-200c 1 0.7 ± 0.1

miR-141 1 27.2 ± 6.6

miR-205 1 0.1 ± 0.1

(32)

22

Table 4. Difference of miRNA expression levels associated with recurrence

miRNA

Patients with recurrence (n=70)

(mean ± SEM)

Patients without recurrence (n=14)

(mean ± SEM)

p-value

miR-200a 247.6 ± 62.4 363.2 ± 147.0 0.456 miR-200b 18.4 ± 2.5 19.0 ± 4.8 0.926 miR-200c 0.7 ± 0.1 0.8 ± 0.2 0.525 miR-141 29.8 ± 7.5 14.4 ± 11.1 0.384 miR-205 0.1 ± 0.1 0.1 ± 0.1 0.836

(33)

23

Table 5. Difference of miRNA expression levels associated with local/distant recurrence

miRNA

Patients with local recurrence (n = 25)

(mean ± SEM)

Patients with distant metastasis (n = 45)

(mean ± SEM)

p-value

miR-200a 264.2 ± 106.6 238.4 ± 77.8 0.845 miR-200b 16.0 ± 3.1 20.0 ± 3.6 0.474 miR-200c 0.8 ± 0.2 0.6 ± 0.1 0.364 miR-141 22.2 ± 10.8 34.0 ± 10.1 0.457 miR-205 0.3 ± 0.3 0.0 ± 0.0 0.299

(34)

24

Table 6. Univariate analysis of prognostic factors associated with overall survival

Characteristics Hazard ratio

95% confidence interval

p-value

Age(>60) 1.081 0.652-1.793 0.763

Sex(male) 1.286 0.794-2.085 0.307

Margin invasion(positive) 1.249 0.615-2.536 0.539 pN(positive) 0.955 0.593-1.539 0.850 Angiolymphatic invasion (positive) 1.314 0.819-2.108 0.258 Venous invasion(positive) 0.992 0.551-1.788 0.979 Perineural invasion (positive) 0.953 0.571-1.591 0.854 Recurrence 2.210 0.994-4.912 0.052 Post operative chemotherapy 0.866 0.540-1.390 0.552 Post operative gemcitabine 0.524 0.279-0.982 0.044 Post operative radiation therapy 1.036 0.645-1.664 0.883 High miR-200c (>0.65) 1.849 1.131-3.025 0.014

(35)

25

Table 7. Multivariate analysis of prognostic factors associated with overall survival

Characteristics Hazard ratio 95% confidence interval

p-value

Recurrence 1.780 0.790-4.010 0.164 Post operative gemcitabine 0.589 0.313-1.111 0.102 High miR-200c (>0.65) 1.664 1.013-2.734 0.044

(36)

26

Table 8. Univariate analysis of prognostic factors associated with disease free survival

Characteristics Hazard ratio

95% confidence interval

p-value

Age (>60) 1.119 0.677-1.850 0.660

Sex(male) 1.081 0.662-1.766 0.755

Margin invasion(positive) 2.255 1.112-4.573 0.024

pN(positive) 1.109 0.679-1.810 0.680 Angiolymphatic invasion (positive) 1.387 0.861-2.235 0.179

Venous invasion (positive) 0.976 0.539-1.767 0.937 Perineural invasion (positive) 0.945 0.560-1.594 0.831 Post operative chemotherapy 0.871 0.537-1.413 0.576 Post operative gemcitabine 0.582 0.321-1.054 0.074 Post operative radiation therapy 0.882 0.545-1.429 0.610 High miR-200c (>0.65) 1.610 0.973-2.664 0.061

(37)

27

Table 9. Multivariate analysis of prognostic factors associated with disease free survival

Characteristics Hazard ratio 95% confidence interval

p-value

Margin invasion (positive) 1.924 0.937-3.952 0.075 Post operative gemcitabine 0.652 0.355-1.198 0.168 High miR-200c (>0.65) 1.493 0.899-2.482 0.122

(38)

28

Fig. 1. Scatter plot of miRNA expression levels associated with survival duration

miR-200a miR-200b

miR-200c miR-141

miR-205

(39)

29

A

B

Fig. 2. Overall survival (p = 0.013) (A) and disease-free survival (p = 0.061) (B) according to miR-200c relative quantity.

(40)

30

Abstract

EMT-related microRNA expression pattern in pancreatic cancer

Background: Physiological function of microRNA (miRNA) is to regulate the stability and translation of mRNA. The aberrant miRNA expression is commonly observed in many cancers. Recently, miRNAs were reported to affect cancer biology by regulating epithelial to mesenchymal transition (EMT). Especially, the expression of miR-200 family (200a/200b/200c/141) and miR-205 have been shown to be associated with regulating EMT.

Methods: In the present study, we investigated miR-200 family and miR-205 expression in macro-dissected formalin-fixed paraffin- embedded tissue samples obtained from 84 patients who underwent radical resection for pancreatic cancer.

Results: Patients were followed from their date of diagnosis until death or censoring (1999-2011). Mean overall survival was 25.0 ± 2 month (2-140month). The R0 resection rate was obtained in 84.5%

(71) of patients. Total of 37 patients were stage IIA and 45 were stage IIB. Seventeen (11 %) patients were treated with gemcitabine postoperatively. On average, miR-200a/200b/200c/141 and miR-205

(41)

31

increased 266.9 ± 57.3/18.5 ± 2.2/0.7 ± 0.1/27.2 ± 6.6 folds and 0.1

± 0.1 folds in pancreatic cancer tissues compared with human pancreatic ductal epithelial (HPDE) cell. Especially results with conflicting previous studies were obtained. We also found that low miR-200c expression was associated with a longer overall survival (p = 0.013). The median survival time was 35 months in the low miR- 200c expression group, and 19 months and in the high miR-200c expression group. In multivariate survival analyses, we found that patients with high levels of miR-200c expression had significantly poor survival rates than those with low levels of miR-200c expression (p = 0.044).

Conclusions: These data indicate that miR-200c may play a role in the pancreatic cancer biology and may be a novel marker for the prognosis and potential therapeutic target of pancreatic cancer.

Further studies are needed.

Key words: pancreatic cancer, miRNA, EMT, miR-200c Student Number: 2011-21993

수치

Table  1.  miRNA  primer  sequences  for  quantitative  real-time  PCR  analysis
Table  2.  Clinicopathological  characteristics  of  84  patients  with  pancreatic cancer
Table  3.  MiRNA  expression  levels  in  pancreatic  cancer  tissue  comparing with immortalized pancreatic duct epithelial cell line
Table  4.  Difference  of  miRNA  expression  levels  associated  with  recurrence
+7

참조

관련 문서

Endoplasmic reticulum stress induces CAP2 expression promoting epithelial-mesenchymal transition in liver cancer cells. Sarah Yoon 1,2 , Boram Shin 1,2 , and Hyun

높은 체질량지수, 고령, 남성, 높은 중성지방, 낮은 고밀도 지단백이 대장 선종성용종의 독립적인 위험인자로서 대장 선종의 발생은 대사성 증후군과

또한,체계적이고 구체적인 것을 더 선호하는 것으로 나타났다.전공에 따라 선호 하는 학습유형에서는 영어를 전공한 학생들이 청각적 유형에 분포가 많은 반면,운

A growing body of evidence indicates that epithelial-mesenchymal transition (EMT) of human peritoneal mesothelial cells (HPMC) may play an important role in the development

Expression of osteonectin (ON) and epithelial-mesenchymal transition (EMT) markers (E-cadherin, N-cadherin, and vimentin) in the presence of recombinant sonic hedgehog (r-Shh)

The process of epithelial-mesenchymal transition (EMT) plays a critical role in embryogenesis and has been shown to be associated with invasion and metastasis of malignant cells and

Kaposi 육종의 경우 면역억제제의 감량투여만으로 치료한 2예의 경우 1예는 병변이 완전히 사라지고 약 13개월이 지난 현재까지 재발의 증거 없이 추적 중이나, 다른 1예의

일반적으로 활성제 이온에 의한 주 발광 파장과 세기는 자기 쌍극자 전이(magnetic dipole tran- sition)와 전기 쌍극자 전이(electric dipole transition) 의