• 검색 결과가 없습니다.

Characterization of an Alkaline Family I.4 Lipase from Bacillus sp. W130-35 Isolated from a Tidal Mud Flat with Broad Substrate Specificity jmb

N/A
N/A
Protected

Academic year: 2022

Share "Characterization of an Alkaline Family I.4 Lipase from Bacillus sp. W130-35 Isolated from a Tidal Mud Flat with Broad Substrate Specificity jmb"

Copied!
10
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

jmb

Review

Characterization of an Alkaline Family I.4 Lipase from Bacillus sp. W130- 35 Isolated from a Tidal Mud Flat with Broad Substrate Specificity

Hee Jung Kim1, Won Kyeong Jung2, Hyun Woo Lee1, Wanki Yoo3, T. Doohun Kim3 , and Hoon Kim1,2*

1Department of Pharmacy, Sunchon National University, Suncheon 57922, Republic of Korea

2Research Institute of Life Pharmaceutical Sciences, Sunchon National University, Suncheon 57922, Republic of Korea

3Department of Chemistry, Sookmyung Women's University, Seoul 04312, Republic of Korea

Introduction

Lipases (E.C. 3.1.1.3) hydrolyze ester bonds in long-chain fatty acids containing more than 10 carbons, whereas esterases (E.C. 3.1.1.1) hydrolyze ester bonds of short-chain fatty acids containing fewer than 10 carbons. Lipases and esterases are widely used to synthesize and produce biopolymers, biodiesels, chiral building blocks, pharmaceuticals, flavor compounds, and agrochemicals, as well as to modify the resolutions of racemic mixtures [6].

Originally, bacterial lipolytic enzymes were grouped into eight families; however, this taxonomy was eventually expanded to include 15 families when new lipolytic enzymes were discovered [2, 4]. The largest of these, family I, is further divided into seven subfamilies (I.1–I.7), and subfamily I.4 includes the lipase LipA from Bacillus subtilis as the first member [6]. LipA has been characterized in relation to its gene, preliminary enzymatic properties, and crystal structure [5, 16, 22]. Since LipA’s discovery, moreover, several lipases belonging to family I.4 have been reported

from Bacillus pumilus [1, 10, 23, 32], Bacillus licheniformis [19], Bacillus megaterium [24], and Bacillus sp. [8, 25]; these findings have been published with information on each lipase’s enzymatic properties, although many genes of family I.4 lipase members have recently been reported as annotations in genome sequencing [7, 14]. Meanwhile, studies on the microorganisms described above show they are found in soils, hot springs, and rivers. Only B. pumilus ArcL5 is native to the Arctic Ocean [32].

In the present study, we have isolated a lipolytic Bacillus sp. W130-35 from a tidal mud flat, cloned a lipase gene, and examined the biochemical properties of lipase Lip7-3, a member of the lipolytic family I.4.

Materials and Methods

Chemicals

X-Gal and IPTG were purchased from Bioneer (Daejeon, Korea).

p-Nitrophenyl (pNP) esters (except for pNP-caproate; Tokyo Chemical Industry Co., Tokyo, Japan), (R)- and (S)-methyl-3- Received: July 31, 2015

Revised: August 26, 2015 Accepted: September 8, 2015

First published online September 15, 2015

*Corresponding author Phone: +82-61-750-3751;

Fax: +82-61-750-3708;

E-mail: [email protected]

pISSN 1017-7825, eISSN 1738-8872 Copyright© 2015 by

The Korean Society for Microbiology and Biotechnology

A gene encoding lipolytic enzyme, lip7-3, was isolated from Bacillus sp. W130-35 isolated from a tidal mud flat. The gene encoded a protein of 215 amino acids with a signal peptide composed of 34 amino acid residues. Lip7-3 belonged to the family I.4 lipase and showed its maximal activity at pH 9.0 and 60°C. Its activity increased in the presence of 30% methanol and, remarkably, increased as well to 154.6% in the presence of Ca2+. Lip7-3 preferred p- nitrophenyl octanoate (C8) as a substrate and exhibited broad specificity for short- to long- chain fatty acid esters. Additionally, Lip7-3 showed a low degree of enantioselectivity for an S-enantiomer (e.g., (S)-methyl-3-hydroxy-2-methylpropionate). It efficiently hydrolyzed glyceryl tributyrate, but did not hydrolyze glyceryl trioleate, fish oil, or olive oil. Its substrate specificity and activation by the solvent might offer a merit to the biotechnological enzyme applications like transesterification in the production of biodiesel.

Keywords: Bacillus sp. W130-35, broad substrate specificity, family I.4 lipase, methanol activation, tidal mud flat

(2)

hydroxy-2-methylpropionate, glyceryl tributyrate, glyceryl trioctanoate, glyceryl trioleate, olive oil, fish oil, and other chemicals were from Sigma-Aldrich (St. Louis, MO, USA).

Isolation of Lipolytic Bacteria from Mud Flat and Sea Water The mud flat with sea water was sampled on 12 July 2013 at Woomyoung Village, near Suncheon Bay, South Korea. Serial dilutions of the sample were made with 0.85% NaCl, and after briefly centrifuging them, the resulting supernatants were spread onto artificial seawater (ASW) agar plates containing a 6.1 g Tris base (pH 7.2) and 12.3 g MgSO4, 0.74 g KCl, 0.13 g (NH4)2HPO4, 17.5 g NaCl, 0.14 g CaCl2, and 15 g agar per liter of supplement, as well as 0.3% bacto-peptone and 0.02% yeast extract [11]. After incubating the samples at 30°C for 24 h, colonies were tooth- picked onto ASW agar plates containing 1% glyceryl trioctanoate.

Positive colonies were primarily selected and grouped according to their halo sizes, colorations, and shapes. Then, the positive colony with the largest hydrolysis zone on the second plates was finally selected for further study. The isolated strain Bacillus sp.

W130-35 was deposited into the Korean Collection for Type Cultures (KCTC) as KCTC 33720.

Analysis of 16S rRNA Gene

Extraction and purification of the bacterium’s genomic DNA was carried out, and the 16S rRNA gene was amplified using PCR with a primer set, 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR product was cloned using the pGEM T-Easy vector system (Promega, Madison, WI, USA) and sequenced by SolGent Co. Ltd. (Daejeon, Korea).

Sequence similarities were determined by pairwise 16S rRNA gene sequence comparisons with NCBI (http://www.ncbi.nlm.nih.gov) and EzTaxon-e servers (http://eztaxon-e.ezbiocloud.net/) [12].

Cloning of a Lipolytic-Enzyme Gene

The bacterium’s chromosomal DNA was partially digested with Sau3AI and electrophoresed on a 0.7% (w/v) agarose gel. Fragments of 3-5 kb from the DNA digest were eluted from the gel, ligated to BamHI-digested pUC19, and introduced into Escherichia coli DH5α (Yeastern Biotech. Co., Taipei, Taiwan). E. coli transformants were primarily grown on LB agar plates supplemented with ampicillin (50 µg/ml), X-Gal, and IPTG for about 24 h at 37°C. The subsequent transformants were then tooth-picked onto LB agar plates containing 1% glyceryl trioctanoate and allowed to grow for about 24 h at 37°C, and the resulting colonies were selected according to hydrolysis zone. Recombinant plasmids of the clones were isolated and analyzed.

Sequence Analysis of the Gene and Construction of a Phylogenetic Tree

The nucleotide sequence of the plasmid in an esterase/lipase- positive clone was determined by SolGent (Daejeon, Korea). The conserved region of the enzyme was analyzed by BLASTP of NCBI (http://www.ncbi.nlm.nih.gov), and the signal peptide was

predicted using SignalP 4.1 in CBS (http://www.cbs.dtu.dk/services/

SignalP/) [21]. The molecular mass and pI of the encoded protein were analyzed using the ExPASy site (http://www.expasy.ch/

tools/protparam.html). To construct a phylogenetic tree, an evolutionary history was inferred using the neighbor-joining method [26]. Multiple alignments of amino acid sequences were performed using Clustal W [31] and analyzed with GeneDoc 2.7 [18]. Evolutionary analyses were conducted using the MEGA6 program [30].

Purification of the Enzyme

The crude enzyme preparation and purification of the enzyme were performed as previously described, except that a few slight modifications were made to the process [13, 27]. In summary, the transformants were grown in LB broth containing ampicillin for 12 h at 37°C, harvested, dispersed, and sonicated in 0.1 M of Tris- HCl (pH 7.5) buffer. After centrifugation, the crude extract was loaded onto a Sephadex G-50 column (2.6 × 75 cm) and proteins were eluted with the buffer at 16 ml/h. Following this, the active pool was dialyzed against a 20 mM Tris-HCl (pH 8.0) buffer. The enzyme was purified using HiTrap Q HP (5 ml; GE Healthcare, Uppsala, Sweden) column chromatography. Enzyme activity was visualized by activity staining after SDS-PAGE as previously described with only slight modifications [9]: the enzyme was heated in a boiling-water bath for 1 min and separated by SDS- PAGE; the gel was washed three times with 50 mM of Tris-HCl (pH 8.0) without isopropanol, and it was placed onto an agar strip containing 1% glyceryl trioctanoate and incubated for 2 h at 40°C.

During the purification process, the amount of protein was determined by the method of Lowry et al. [17], and SDS-PAGE was carried out using a 15% polyacrylamide gel [15].

Enzyme Assay

Enzyme activity was determined by measuring the amount of p-nitrophenol generated from pNP-esters. Unless otherwise noted, each reaction was carried out for 1 min at 25°C with 1 mM of pNP- octanoate (caprylate) in 1 ml of 50 mM Tris-HCl (pH 8.0), and the absorbance at 400 nm of the reaction mixture was continuously measured using a spectrophotometer (Mecasys, Model Optizen, Korea). Enzyme activities were calculated, based on observed absorbance using molar-extinction coefficients for p-nitrophenol (16,400/M/cm at pH 8.0) [13]. One unit of enzyme activity was defined as the amount of enzyme that generated 1 µmol of p- nitrophenol in 1 min under these conditions.

Characterization of the Enzyme

The optimum temperature, thermostability, and pH for enzyme activity were determined as previously described [13]. In the pH experiments, reaction mixtures were reacted for 15 min and stopped through the addition of 3 ml of 1 M Na2CO3. Then, absorbance values of the mixtures were observed, and cation influence on enzyme activity in the presence of 5 mM of K+, Na+, Ca2+, Cu2+, Mn2+, Mg2+, and Zn2+ was determined. Substrate

(3)

specificity of the enzyme was determined using pNP-esters such as pNP-acetate (C2), pNP-butyrate (C4), pNP-caproate (C6), pNP- caprylate (octanoate) (C8), pNP-caprate (C10), pNP-laurate (C12), pNP-myristate (C14), and pNP-palmitate (C16) as substrates.

Its enantioselectivity was analyzed using a pH shift assay; Lip7- 3 was made to react with 300 mM (R)- or (S)-methyl-3-hydroxy-2- methylpropionate in 20 mM of Tris-HCl (pH 8.0) containing phenol red (2 g/l) in a 0.2 ml reaction mixture at 37°C for an appropriate time without stirring [3]. The absorbance spectra of the solutions were recorded at 350–600 nm. The R:S conversion ratio was calculated by comparing the absorbance at 560 nm.

Hydrolysis of glyceryl-esters (glyceryl butyrate and glyceryl trioleate) and oils (fish oil and olive oil) were analyzed with 1%

substrates using the assay system described above.

Nucleotide Sequence Accession Numbers

The nucleotide sequences of lip7-3 and 16S rRNA gene of the isolate Bacillus sp. W130-35 have been deposited to GenBank under accession numbers KR866145 and KF746892, respectively.

Results and Discussion Isolation of Bacillus sp. W130-35

A lipolytic bacterium, W130-35, was isolated from a tidal mud flat in the Suncheon Bay area, using glyceryl trioctanoate as a substrate. The isolate showed the largest hydrolysis zone on the glyceryl trioctanoate plate, when compared with the accompanying isolates W130-02, W130-08, and W130-15 (data not shown). The 16S rRNA gene sequence of isolate W130-35 exhibited the highest similarity (100%

with 99% query coverage) to Bacterium fjat-scb-3 (Accession No. HQ873709), the B. pumilus strain T246 (KC764989), and Bacillus safensis strain 3-5 (JX867749), and it was 99% similar to Bacillus sp. L103 (KJ944109) and Bacillus altitudinis strain RRD69 (KJ534473) in that order on the NCBI’s servers. The sequence was most closely matched (99.93%) to B. altitudinis 41KF2b (ASJC01000029) on the EzTaxon server. The isolate was named Bacillus sp. W130-35.

Cloning of a Gene Encoding Lipolytic Enzyme and Analysis of the Enzyme

A library with a 3–8 kb insert and a pUC19 vector were constructed using the shot-gun method, and a total of approximately 500 transformants were obtained. One positive clone, JK 7-3, was selected on the basis of its hydrolysis-zone formation on glyceryl trioctanoate agar plates. The DNA inserted into the recombinant plasmid was about 3.2 kb in length (data not shown). One ORF consisting of 648 bp was identified as a gene encoding a

lipase highly similar to that of known lipolytic enzymes, and it was named lip7-3.

The gene was predicted to encode a protein of 215 amino acid residues with a putative signal peptide of 34 amino acid residues. The molecular mass and theoretical pI of mature Lip7-3 were calculated to be 19,165 Da and 9.58, respectively.

Based on comparisons with the enzymes with reported properties, the amino acid sequence of Lip7-3 exhibited the highest similarity to lipases B26 of B. pumilus B26 (Accession No. AF232707) [10] at 99%, L21 of B. pumilus L21 (JX163856) [1] at 97%, and BpL5 of B. pumilus ArcL5 (KF939143) [32] at 94%, as well as to the lipase of B. licheniformis (AJ297356) [19] and the lipases BPE of B. pumilus DBRL-191 (AY494714) [23] and L5 of B. pumilus L5 (JX163855) [1] at 93%. This was followed by a 73% similarity to lipase LipAHH01 of Bacillus sp. HH-01 (AB539874) [8].

Comparisons of amino acid sequences of Lip7-3 with those of several other I.4 lipolytic family enzymes revealed that Lip7-3 contains a conserved region comprising pentapeptide AXSXG, as described Arpigny and Jaeger [2], instead of the typical pentapeptide GXSXG (Fig. 1). The largest of the eight lipolytic families, family I, was initially divided into six subfamilies and has since been expanded to consist of seven subfamilies [2, 6]. Lip7-3 is 72% similar to LipA of B. subtilis 168 (M74010), a reference enzyme for family I.4. The amino acid residues Ser77 (in the pentapeptide AXSXG), Asp133, and His156 in the mature enzyme are known to form a catalytic triad in the hydrolases, such as lipolytic enzymes [20, 22]. The number of amino acid residues of mature Lip7-3 was 181, the same as the number of residues for other I.4 family lipases except LipAHH01 [8], LipA of B. megaterium [24], and LipA of Bacillus sp. BP-6 [25]. In the present analysis of I.4 family enzymes, conserved HNPVV and GLNGGG motifs were found at the N- and C- termini, respectively, and long conserved motifs containing the pentapeptides AXSXG and ALPGTDPNQKILYTS were also found at the enzyme’s center region (Fig. 1). Although similarity values for mature I.4 lipase-family proteins are very high, similarities in signal peptide sequences are low (Fig. 1). Lip7-3 clusters within the phylogenetic tree of the I.4 bacterial lipolytic enzyme family and locates at a part of three branches (Fig. 2).

Purification of Lip7-3

Lip7-3 was purified in the present study using Sephadex G-50 and HiTrap Q HP chromatography. Chromatographies with High-Q or CHT-II resins were not effective in the

(4)

Fig. 1. Alignment of the amino acid sequences of Lip7-3 (KR866145) and related lipolytic enzymes: B26 from B. pumilus (AF232707), L5 from B. pumilus L5 (JX163855), BpL5 from B. pumilus ArcL5 (KF939143), BPE from B. pumilus DBRL-191 (AY494714), L21 from B. pumilus L21 (JX163856), a lipase from B. licheniformis (AJ297356), LipAHH01 from Bacillus sp. HH-01 (AB539874), LipA from B. subtilis 168 (M74010), LipA from B. megaterium 370 (AJ430831), and LipA from Bacillus sp. BP-6 (AJ430985).

Consensus sequences are shown with uppercase or lowercase letters, or numbers: 1, D/N; 2, E/Q; 3, S/T; 4, K/R; 5, F/Y/W; 6, L/I/V/M. The symbol represents the predicted cleavage site of the signal peptide. The conserved motifs are boxed in red. The region containing the AXSXG sequence is shown in a blue box. Amino acid residues forming a catalytic triad are shown by the symbol .

(5)

purification steps (data not shown). The purified Lip7-3 appeared as a single band on an SDS-PAGE gel, and the corresponding protein appeared as a clear band on an agar

strip containing glyceryl trioctanoate (Fig. 3). The molecular mass of the protein was estimated at about 17 kDa (Fig. 3), making it slightly smaller than expected. Family I.4 lipases are the smallest of proteins, with molecular masses of 19–

20 kDa [2]. The specific activity of the purified Lip7-3 was 98.2 U/mg protein (Table 1).

Effects of Temperature, pH, Cations, and Solvents on Lip7-3 Activity

Lip7-3 was optimally active at 60°C, and its activity decreased sharply at 70°C (Fig. 4A). The optimum temperature for the enzyme activity was the highest of all the family I.4 lipases but similar to that of the B. licheniformis lipase, 55°C [19]. Optimum temperatures for most of family I.4 lipases were between 30°C and 45°C; the optimum temperature for BpL5 was below this range at 20°C [32]. Moreover, although only a few amino acid residues change in most mature forms of family I.4 lipases, significant differences were observed in the present study when Lip7-3 was subjected to its optimum temperature. Meanwhile, when it was pre-incubated at 40°C and 50°C without a substrate, its half-lives were 38.9 and 10.6 min, respectively (Fig. 4B).

These results suggest that the substrate stabilizes and protects the enzyme from heat inactivation during the Fig. 2. Phylogenetic tree showing the evolutionary relatedness and levels of homology of Lip7-3 and closely related lipolytic enzymes.

The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Eleven amino acid sequences were analyzed. Evolutionary analyses were conducted in MEGA6 [30].

Fig. 3. SDS-PAGE of the purified Lip7-3.

M, molecular weight markers; lane 1, pooled from Sephadex G-50 chromatography; 2, pooled from HiTrap Q HP chromatography; AS, a band after SDS-PAGE and activity staining on an agar strip containing glyceryl trioctanoate.

Table 1. Purification of Lip7-3.

Total protein (mg) Total activity (U) Specific activity (U/mg) Yield (%) Fold

Crude enzyme 142.9 276.0 1.9 100 1.0

Sephadex G-50 25.2 192.0 7.6 69.6 4.0

HiTrap Q HP 0.45 44.2 98.2 16.0 51.7

(6)

earliest reaction stages. Similarly, Lip7-3 exhibited maximum activity at pH 9.0 (Fig. 4C). This was similar to most of the family I.4 enzymes and alkaline lipolytic enzymes, except for neutral LipA from B. megaterium and LipA from Bacillus sp. BP-6 [24, 25].

Furthermore, divalent cations exerted significant influence on the activity of Lip7-3: 5 mM Cu2+ and Zn2+ reduced activity to 34.5% and 47.3% of its optimum level, respectively (Table 2), whereas remarkably, Ca2+ increased activity to 154.6% of the optimum level (Table 2). These results are similar to those for LipA from B. subtilis 168, whose activity was increased to 194% of its optimum level by the addition of 10 mM Ca2+ [16]. Most of family I.4 lipases, in contrast, are not activated by Ca2+, as summarized in Table 3.

Lip7-3 was tolerant of methanol and, moderately, of isopropanol but was sensitive to acetonitrile (Table 2): its activity increased to 132.8% of the optimum level in the presence of 30% methanol (Table 2), and although no increase in enzyme activity was observed when 30%

methanol was added, LipA from B. subtilis 168 and L5 from B. pumilus L5 have been shown to exhibit tolerance to the solvent. Compared with Lip7-3, however, LipA from B. subtilis 168 and L21 from B. pumilus L21 were very sensitive to 30% isopropanol [1, 16]. Although the exact mechanism for this cannot be explained, it might be speculated that solvents help stabilize the conformation of the active site of the solvent-tolerant lipases [29]. Such tolerance might therefore hint at biotechnological applications Fig. 4. Effects of temperature and pH on enzyme activity of

Lip7-3.

(A) Optimum temperature; (B) thermostability; and (C) optimum pH.

Enzyme activities were measured by a continuous method at each designated pH.

Table 2. Effects of cations and organic solvents on the activity of Lip7-3.

Relative activity (%)

Control (+ 1% isopropanol) 100.0

Cation (5 mM)

K+ 57.6 ± 1.8

Na+ 78.0 ± 3.8

Ca2+ 154.6 ± 9.4

Mg2+ 93.0 ± 1.9

Fe2+ 58.2 ± 5.5

Zn2+ 47.3 ± 4.7

Cu2+ 34.5 ± 2.7

Solvent

Isopropanol (5%) 75.7 ± 3.8

Isopropanol (30%) 80.3 ± 0.9

Methanol (5%) 91.1 ± 1.8

Methanol (30%) 132.8 ± 7.4

Acetonitrile (5%) 19.4 ± 0.9

Acetonitrile (30%) 14.6 ± 2.2

The specific activity corresponding to a relative activity of 100% was 98.2 U/mg protein.

(7)

for these enzymes, such as transesterification in the production of biodiesel.

Substrate Specificity of Lip7-3

Lip7-3 efficiently cleaved the ester bonds of pNP-esters in both short- and long-chain fatty acids, and its relative activities toward pNP-octanoate (C8), pNP-caproate (C6), pNP-caprate (C10), pNP-laurate (C12), and pNP-myristate (C14) were 100%, 96.4%, 96.1%, 92.4%, and 83.1%, respectively (Fig. 5). Moreover, Lip7-3 hydrolyzed pNP-palmitate (C16) and pNP-acetate (C2) at 53.5% and 81.5% of its optimum activity, respectively. It was observed that the preference for pNP-ester substrates was very broad, and it would be suggested it is a true lipase rather than an esterase. Its greatest preference, for pNP-ester substrate C8, was similar to the substrate preferences of other lipolytic I.4 enzymes, including L21 from B. pumilus L21, BpL5 from B. pumilus ArcL5, L5 from B. pumilus L5, LipAHH01 from Bacillus sp.

HH-01, and LipA from B. subtilis 168 (Table 3).

Even so, its preference was different from those of LipA from B. megaterium 370 and LipA from Bacillus sp. BP-6, which exhibit substrate preferences for C4 (Table 3). Lip7-3 also exhibited very broad specificity with regard to pNP-

esters from both short- and long-chain fatty acids, when compared with the lipases listed in Table 3. L5 from B. pumilus L5, L21 from B. pumilus L21, and BPE from B. pumilus DBRL-191 have been shown to exhibit relatively low activity levels when C2 and C4 are present [1, 23].

Table 3. Comparison of enzyme properties of Lip7-3 with other bacterial family I.4 lipolytic enzymes.a Enzyme Source Accession

number Identity

(%) AAbOptimum temp.

(°C)

Optimum pH

Preferred pNP estersc

Preferred

TGd Isopropanole

(30%) Methanole

(30%) Acetonitrilee (30%) Enantio-

selectivity Effect of Ca2+ Ref.

Lip7-3 Bacillus sp.

W130-35 KR866145 100 181 60 9.0 C8 C4 80.3 132.8 14.6 +/- + This

study

B26 B. pumilus AF232707 99 181 35 8.5 C3 - [10]

L21 B. pumilus

L21 JX163856 97 181 37 8.0 C8 ~10 ~75 ~12 - [1]

BpL5 B. pumilus

ArcL5 KF939143 94 181 20 9.0 C8 C8# [32]

BPE B. pumilus

DBRL-191 AY494714 93 181 37 9.0 C6 C4,C6 + [23]

L5 B. pumilus

L5 JX163855 93 181 37 8.0 C8 ~15 ~90 ~6 - [1]

Lipase B. licheniformis AJ297356 93 181 55 10.5 C6 - [19]

LipAHH01 Bacillus sp.

HH-01 AB539874 73 182 30 8-9 C8 C18:2f -g [8]

LipA B. subtilis

168 M74010 72 181 35 10 C8 C8 0 ~100 +? + [5, 16,

22]

LipA B. megaterium

370 AJ430831 69 182 45 7.0 C4 C4h -? [24]

LipA Bacillus sp.

BP-6 AJ430985 69 182 45 7.0 C4 C4h - [25]

aEnzymes are listed in order, based on their identity to Lip7-3 and availability of experimental data.

bAmino acid residues in mature enzyme; cp-nitrophenyl esters; dtriglycerides; erelative activities (%) at the concentration of solvents; ftested as a sole substrate for triglyceride; gactivated by Co2+; ?, not specified fully; hon screening plates; -, negative; +, positive. Blank, not available.

Fig. 5. Substrate specificity of Lip7-3 for p-nitrophenyl esters.

The specific activity corresponding to a relative activity of 100% was 98.2 U/mg Lip7-3 toward C8.

(8)

Meanwhile, the activity levels for LipAHH01 from Bacillus sp.

HH-01 and LipA from B. subtilis168 dropped to about 50%

of their optimum values (in the presence of C8) when they were introduced to C12 [8, 16].

Lip7-3 hydrolyzed the S-enantiomer, (S)-methyl-3- hydroxy-2-methylpropionate, slightly faster than it did the R-enantiomer (Fig. 6A). Its R:S conversion ratio was calculated to be 1:1.12 when compared with A560 after a 1 h reaction (Fig. 6B). It also exhibited slight enantioselectivity for the S-enantiomer of methyl-3-hydroxy-2-methylpropionate.

Of all the family I.4 enzymes, only two others have been reported to show enantioselectivity (Table 3): BPE from B. pumilus DBRL-191 affected the hydrolysis of racemic mixtures such as unsubstituted and substituted 1-(phenyl) ethanols, and LipA from B. subtilis168 hydrolyzed benzyl, naphthyl, and menthyl esters with a great deal of enantioselectivity [22, 23].

Additionally, Lip7-3 efficiently hydrolyzed glyceryl tributyrate but did not hydrolyze glyceryl trioleate, fish oil, or olive oil (Fig. 6C). It might be concluded, then, that Lip7- 3 prefers glyceryl esters composed of short-chain fatty acids, such as glyceryl butyrate, contrary to pNP-esters.

Many family I.4 enzymes, including B26 from B. pumilus B26, BPE from B. pumilus DBRL-191, LipA from B. megaterium 370, and LipA from Bacillus sp. BP-6, exhibited similar preferences (Table 3). Unlike Lip7-3 and other enzymes, however, LipAHH01 showed an exceptional amount of hydrolyzation when confronted with trilinolein (C18:2) [8].

Other studies have reported that small differences in one or several amino acid substitutions could cause enzyme properties to change drastically in terms of, for instance, their specific activities, substrate specificities, thermostabilities, solvent tolerances, calcium binding, and stereoselectivities [1, 22, 28, 32]. This has been asserted despite the fact that amino acid sequence identities account for more than 91%

of sequences, and three Bacillus lipases exhibited different pH optima [19]. Compared with enzymes to which it is more than 93% similar, Lip7-3 exhibits different properties at its optimum temperature, pH, and solvent tolerance, as well as in the presence of calcium ions (Table 3). Indeed, in the effects of calcium ions, Lip7-3 exhibits contrasting behavior to that of B26 from B. pumilus B26 and L21 from B. pumilus L21, both of which are highly (more than 97%) similar to Lip7-3; in fact, these results are more similar to Fig. 6. Analysis of enantioselectivity and lipid hydrolysis of Lip7-3 using pH shift assay.

(A) Enantioselectivity analysis with (R)- or (S)-methyl-3-hydroxy-2-methylpropionate containing phenol red: 1, (R) substrate; 2, (R) substrate + enzyme; 3, (S) substrate; 4, (S) substrate + enzyme. (B) Absorbance spectra of the reaction mixtures in panel A. (C) Hydrolysis of glyceryl esters and oils.

(9)

the behavior of LipA from B. subtilis 168, which is only 72% similar to Lip7-3 (Table 3). This suggests that future research should compare as many enzymes in as many environments as possible, regardless of their similarities.

In the present study, we isolated the family I.4 lipase gene lip7-3 from bacteria found in a tidal mud flat. Lip7-3 was found to be an alkaline, thermophilic lipolytic enzyme whose activity increased in the presence of 30% methanol or Ca2+ ion. The enzyme preferred pNP-octanoate (C8) as a substrate and hydrolyzed glyceryl tributyrate efficiently and exhibited broad specificity for short- and long-chain fatty acid esters containing pNP, while also exhibiting a low degree of enantioselectivity. The properties might provide certain advantages if it is used in biotechnological enzyme applications.

Acknowledgments

This study was supported by the Suncheon Research Center for Natural Medicines, South Korea.

References

1. Akbulut N, Öztürk MT, Pijning T, Öztürk SI, Gümüel F.

2013. Improved activity and thermostability of Bacillus pumilus lipase by directed evolution. J. Biotechnol. 164: 123- 129.

2. Arpigny JL, Jaeger KE. 1999. Bacterial lipolytic enzymes:

classification and properties. Biochem. J. 343: 177-183.

3. Bae SY, Ryu BH, Jang E, Kim S, Kim TD. 2013.

Characterization and immobilization of a novel SGNH hydrolase (Est24) from Sinorhizobium meliloti. Appl. Microbiol.

Biotechnol. 97: 1637-1647.

4. Charbonneau DM, Beauregard M. 2013. Role of key salt bridges in thermostability of G. thermodenitrificans EstGtA2:

distinctive patterns within the new bacterial lipolytic enzyme family XV. PLoS One 8: e76675.

5. Dartois V, Baulard A, Schanck K, Colson C. 1992. Cloning, nucleotide sequence and expression in Escherichia coli of a lipase gene from Bacillus subtilis 168. Biochim. Biophys. Acta 1131: 253-260.

6. Jaeger KE, Eggert T. 2002. Lipases for biotechnology. Curr.

Opin. Biotechnol. 13: 390-397.

7. de Jong A, van Heel AJ, Montalban-Lopez M, Krawczyk AO, Berendsen EM, Wells-Bennik M, Kuipers OP. 2015.

Draft genome sequences of five spore-forming food isolates of Bacillus pumilus. Genome Announc. 3: e01539-14.

8. Kamijo T, Saito A, Ema S, Yoh I, Hayashi H, Nagata R, et al.

2011. Molecular and enzymatic characterization of a subfamily I.4 lipase from an edible oil-degrader Bacillus sp.

HH-01. Antonie Van Leeuwenhoek 99: 179-187.

9. Kim HJ, Jeong YS, Jung WK, Kim SK, Lee HW, Kahng HY, et al. 2015. Characterization of novel family IV esterase and family I.3 lipase from an oil-polluted mud flat metagenome.

Mol. Biotechnol. 57: 781-792.

10. Kim HK, Choi HJ, Kim MH, Sohn CB, Oh TK. 2002.

Expression and characterization of Ca2+-independent lipase from Bacillus pumilus B26. Biochim. Biophys. Acta 1583: 205-212.

11. Kim J, Hong SK. 2012. Isolation and characterization of an agarase-producing bacterial strain, Alteromonas sp. GNUM-1, from the West Sea, Korea. J. Microbiol. Biotechnol. 22: 1621-1628.

12. Kim OS, Cho YJ, Lee K, Yoon SH, Kim M, Na H, et al. 2012.

Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. Int. J. Syst. Evol. Microbiol. 62: 716-721.

13. Kim YH, Kwon EJ, Kim SK, Jeong YS, Kim J, Yun HD, Kim H. 2010. Molecular cloning and characterization of a novel family VIII alkaline esterase from a compost metagenomic library. Biochem. Biophys. Res. Commun. 393: 45-49.

14. Laborda PR, Fonseca FS, Angolini CF, Oliveira VM, Souza AP, Marsaioli AJ. 2014. Genome sequence of Bacillus safensis CFA06, isolated from biodegraded petroleum in Brazil.

Genome Announc. 2: e00642-14.

15. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:

680-685.

16. Lesuisse E, Schanck K, Colson C. 1993. Purification and preliminary characterization of the extracellular lipase of Bacillus subtilis 168, an extremely basic pH-tolerant enzyme.

Eur. J. Biochem. 216: 155-160.

17. Lowry OH, Rosenbrough NJ, Farr AL, Randall RJ. 1951.

Protein measurement with the folin phenol reagent. J. Biol.

Chem. 193: 265-275.

18. Nicholas KB, Nicholas Jr HB. 1997. GeneDoc: a tool for editing and annotating multiple sequence alignments.

Distributed by the authors.

19. Nthangeni MB, Patterton H, van Tonder A, Vergeer WP, Litthauer D. 2001. Over-expression and properties of a purified recombinant Bacillus licheniformis lipase: a comparative report on Bacillus lipases. Enzyme Microb.

Technol. 28: 705-712.

20. Ollis DL, Cheah E, Cygler M, Dijkstra B, Frolow F, Franken SM, et al. 1992. The alpha/beta hydrolase fold. Protein Eng.

5: 197-211.

21. Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011.

SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8: 785-786.

22. van Pouderoyen G, Eggert T, Jaeger KE, Dijkstra BW. 2001.

The crystal structure of Bacillus subtilis lipase: a minimal alpha/beta hydrolase fold enzyme. J. Mol. Biol. 309: 215-226.

23. Rasool S, Johri S, Riyaz-ul-Hassan S, Maqbool QU, Verma V, Koul S, et al. 2005. Molecular cloning of enantioselective ester hydrolase from Bacillus pumilus DBRL-191. FEMS Microbiol. Lett. 249: 113-120.

(10)

24. Ruiz C, Blanco A, Pastor FI, Diaz P. 2002. Analysis of Bacillus megaterium lipolytic system and cloning of LipA, a novel subfamily I.4 bacterial lipase. FEMS Microbiol. Lett.

217: 263-267.

25. Ruiz C, Javier Pastor FI, Diaz P. 2003. Isolation and characterization of Bacillus sp. BP-6 LipA, a ubiquitous lipase among mesophilic Bacillus species. Lett. Appl. Microbiol. 37:

354-359.

26. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol.

Evol. 4: 406-425.

27. Shin ES, Yang MJ, Jung KH, Kwon EJ, Jung JS, Park SK, et al.

2002. Influence of the transposition of the thermostabilizing domain of Clostridium thermocellum xylanase (XynX) on xylan binding and thermostabilization. Appl. Environ. Microbiol.

68: 3496-3501.

28. Simons JW, van Kampen MD, Ubarretxena-Belandia I, Cox RC, Alves dos Santos CM, Egmond MR, Verheij HM. 1999.

Identification of a calcium binding site in Staphylococcus

hyicus lipase: generation of calcium-independent variants.

Biochemistry 38: 2-10.

29. Sulong MR, Abdul Rahman RN, Salleh AB, Basri M. 2006. A novel organic solvent tolerant lipase from Bacillus sphaericus 205y: extracellular expression of a novel OST-lipase gene.

Protein Expr. Purif. 49: 190-195.

30. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013.

MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30: 2725-2759.

31. Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W:

improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res.

22: 4673-4680.

32. Wi AR, Jeon SJ, Kim S, Park HJ, Kim D, Han SJ, Yim JH, Kim HW. 2014. Characterization and a point mutational approach of a psychrophilic lipase from an arctic bacterium, Bacillus pumilus. Biotechnol. Lett. 36: 1295-1302.

참조

관련 문서

Four items out of ten, ‘I think the size of each room in VR was similar to the actual size of rooms,’ ‘I feel that the Virtual Model House was similar to the real model

In specific, better index could be calculated: attractive quality element was added to one-dimensional quality element, both of which affect the satisfaction when physical

bility of our experimental setup, because viscoelastic property of ppy during electrochemical deposition has been recently examined in the electrolyte solution by Muramatsu et

• 대부분의 치료법은 환자의 이명 청력 및 소리의 편안함에 대한 보 고를 토대로

• 이명의 치료에 대한 매커니즘과 디지털 음향 기술에 대한 상업적으로의 급속한 발전으로 인해 치료 옵션은 증가했 지만, 선택 가이드 라인은 거의 없음.. •

The deduced amino acid sequence of B.mori V-ATPase c subunit showed that this cDNA encoded a polypeptide of 155 amino acids with a predicted molecular mass of 15.8 kDa

Although partial NMR spectral data have been reported for some of the isolated compounds (2 −4), the complete 1 H- and 13 C- NMR spectral assignments of all the isolated

"Purification and Characterization of a Novel Malto-oligosaccharides Forming α-Amylase from Bacillus sp... Theories and