• 검색 결과가 없습니다.

FABP4 유전자 g.7516G>C SNP가 칡소와 흑소의 경제형질에 미치는 영향

N/A
N/A
Protected

Academic year: 2021

Share "FABP4 유전자 g.7516G>C SNP가 칡소와 흑소의 경제형질에 미치는 영향"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

www.earticle.net

FABP4 유전자 g.7516G>C SNP가 칡소와 흑소의 경제형질에 미치는 영향

이승규1․이영섭1․박새롬1․김훈1․최소영1․이지연1․김기범2․박종운2․최정우3․이학교4․이성진1*

강원대학교 동물생명과학대학1, 축산물품질평가원2, 캐나다 궬프대학교3, 한경대학교 생명공학과4

Effect of g.7516G>C SNP in FABP4 Gene with Carcass Traits in Korean Brindle Cattle and Black cattle

Seung-Kyoo Lee1, Young-Sub Lee1, Sairom Park1, Hun Kim1, So-Young Choi1, Ji-Yeon Lee1, Ki-Beom Kim2, Jong-Woon Park2, Jung-Woo Choi3, Hak-Kyo Lee4 and Sung-Jin Lee1*

1College of Animal Life Sciences, Kangwon National University,

2Korea Institute for Animal Products Quality Evaluation,

3Centre for Genetic Improvement of Livestock, Dept. of Animal & Poultry Science, University of Guelph, Ontario, Canada,

4Dept. of Biotechnology, Hankyong National University

ABSTRACT1)

The role of Fatty acid binding protein 4 (FABP4) gene is critical for lipid metabolism and for maintaining homeostasis in adipocytes. Association between Hanwoo carcass traits and FABP4 gene g.7516G>C SNP has been reported previously, however, its association and how does it influence Korean brindle and black cattle has not been demonstrated and established till date. For this purpose, the study was planned to analyze the SNP association (Single Nucleotide Polymorphism) (g.7516G>C) in FABP4 gene and gather genetic information on economic traits of Korean brindle cattle and black cattle. As per sequence of bovineFABP4 gene available (Genbank accession No. NC_007312.4), one pair of primers (5’-ATA TAG TCC ATA GGG TGG CAA AGA-3’

and 5’-AAC CTC TCT TTG AAT TCT CCA TTC T-3’) was designed to amplify a 452bp product of theFABP4 gene including the region of 7417–7868. The SNP, detected by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) methods using restriction enzymeMspA1I, was genotyped in 117 animals of brindle cattle and 24 animals of black cattle population. Statistical analysis revealed that theFABP4 genotype significantly (p<0.05) affect with carcass weight, but there was no significant association with any other economic traits was observed in brindle as well as in black cattle. In conclusion, these results suggested that SNP (g.7516G>C), located in FABP4 gene, could be used as important DNA marker of economic traits in Korean brindle cattle. Furthermore, we suggest that additional samples needs to further analysed to make related data exclusively authentic.

(Key words: Korean native cattle,FABP4, Carcass weight, SNP, RFLP)

* Corresponding author:Sung-Jin Lee, Dept. of Animal Biotechnology, College of Animal Life Science, Kangwon National University, Chuncheon 200-701, Korea.Tel: +82-33-250-8636, E-mail: [email protected]

This is an Open Access journal distributed under the teams of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses(by-nc/3.0) which permits unrestricted non-commercial use, and reproduction in any medium, provided the original work is properly cited.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(2)

www.earticle.net

Ⅰ. 서론

최근 소비자들이 웰빙식품에 대한 관심이 높아지면서 육 류의 소비 경향에 있어서도 양보다 질을 선호하는 경향이 강해져 우수한 육질의 고급육이 요구되어지고 있는 추세다. 또한 최근에 축산물 수입 개방으로 인한 값싼 수입 쇠고기 와의 경쟁력을 키우기 위해서는 한우의 도체 품질을 높이 는 것이 우선적으로 요구되는 실정이다. 따라서 한우의 고 급화를 위한 육질과 육량을 증가 시키는데 중점을 두고 유 전자 마커와 관련된 연구가 진행되고 있다.

국내 쇠고기의 도체 품질 중 육질을 결정짓는 도체 특성 으로는 육색, 지방색, 근내지방도 및 조직감 등으로 결정지 어 진다. 대체적으로 육질은 살코기 사이에 지방이 어느 정 도 함유되어 있는지를 나타내는 근내 지방도가 높아짐에 따라 소비자들이 섭취 했을 때 다즙성 및 풍미 등이 좋다고 알려져 있다. 따라서 한우의 고급육 생산을 위해 근내 지방 도 함량을 높이는 유전자 마커를 이용하여 고기의 육질을 향상시키는 것을 중점으로 연구되어 지고 있다(신기현 등, 2009).

Fatty Acid Binding Protein 4(FABP4) 유전자는 지방조직 에서 발현되며, Peroxisome Proliferator-Activated Receptors (PPAR)와 상호작용을 하여 Hormone-Sensitive Lipase (HSL)과 결합한다고 알려져 있으며 세포내 지질대사와 항 상성에 있어서 중요한 유전자로 알려져 있다(Damcott 등, 2004). 이러한 FABP4 유전자는 호르몬감수성 지방질가수분 해효소와 직접적인 상호작용으로 붙게 되어 지질의 가수분 해작용과 세포내 지방산을 수송한다고 보고되어 있다(Shen , 1999). 또한 쥐에서 FABP4유전자는 비만과 관련된 후보 유전자로 알려져 있다(Ogino 등, 2003). 특히 백색 지방세 포에서 분비되는 16 kDa 단백질인 렙틴은 음식물 섭취의 조절, 에너지 소비, 몸 전체의 에너지 균형과 연관되어 있기 때문에 FABP4 유전자가 지방세포의 항상성과 지질대사에 있어서 매우 중요한 유전자임을 알려주고 있다(Jiang과 Gibson 등, 1999). Michal 등(2006)의 연구에 따르면 Wagyu x Limousin F2 교잡우에서 FABP4 유전자변이는 육질향상 과 관련된 근내 지방도와 피하지방 두께에서 유의적인 연 관성이 있는 것으로 밝혀졌다. 또한 한우 거세우와 FABP4 유전자의 g.7516G>C SNP이 도체중(p<0.01), 근내지방도 (p<0.001) 그리고 배최장근 단면적(p<0.001)의 세 가지 경제 형질과 관련된 도체형질에서 유의적인 연관성이 있는 것으 로 나타났다(Lee 등, 2012). 따라서 본 연구에서는 지방세포 와 관련된 FABP4 유전자를 대상으로 칡소 및 흑소에서 육

질향상 및 양적형질에 있어서 효과가 있는지 알아보기 위 해 유전자형 분석과 PCR-RFLP(Polymerase chain reaction- Restricted Fragment Length Polymorphism) 방법을 통해 SNP(Single Nucleotide Polymorphism)을 확인하고 분석하 여 도체형질과의 연관성을 통계적으로 분석하였고, 이 연구 를 통하여 칡소와 흑소의 육우 선발에 있어서 중요한 DNA marker로써 활용될 수 있는지 밝혀내고자 하였다.

Ⅱ. 재료 및 방법

1. 공시재료, 도체형질자료 및 DNA 추출

본 연구에 사용된 공시재료는 축산물품질평가원에서 2010년 09월부터 2012년 03월까지 도축된 117두의 칡소와 한반도 내륙에서 사육한 24두의 흑소의 조직시료를 사용하였 . 도축하고 등급판정을 받은 고기시료는 MS(microsatellite) marker를 이용한 DNA 동일성 검정법을 통해 개체가 확인 되었다. 또한 경제형질 비교 분석을 위한 경제형질 관련 도 체형질로는 도체중(carcass weight; CW), 배최장근 단면적 (longissimus muscle area; LMA), 등지방두께(backfat thickness; BF), 근내지방도(marbling score; MS)등 4가지 항목에 대한 자료를 이용하였으며 각 개체에 대한 도체정 보는 축산물품질평가원에서 판정한 결과를 활용하였다.

Genomic DNA는 제공받은 칡소 및 흑소의 조직시료 25 mg을 떼어낸 후 i-genomic CTB DNA Extraction Mini Kit(Intron Biotechnology, Korea)를 이용하여 DNA를 추출 및 정제하였다. 추출된 DNA는 PCR을 하기 위하여 분광광 도계로 260 nm~280 nm에서 흡광도를 측정을 하여 농도와 순도를 확인하였다.

2. PCR-RFLP를 통한 FABP4 유전자 SNP의 유전자형 분석

본 연구에서는 칡소와 흑소의 FABP4 유전자의 g.7516G>

C SNP과의 연관성분석을 위한 실험을 하기 위해 Michal (2006)의 논문에서 보고된 g.7516G>C SNP의 primer sequence를 GenBank(Accession No. NC_007312.4)에서 재 차 확인 한 후 PCR을 실시하였다(Table 1). DNA 증폭을 위한 PCR 기계는 GeneAmp® PCR System 9700(Applied Biosystems, USA)를 사용하였으며 Top DNA polymerase (Bioneer, Korea)를 사용하여 PCR을 실시하였다. PCR을 위

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(3)

www.earticle.net

Table 1. Sequence of the forward (F) and reverse (R) primers used for the amplification of FABP4gene regions

SNP Primer sequence Annealing Tm (℃) Location Size (bp)

g.7516G>C F: 5’- ATATAGTCCATAGGGTGGCAAAGA -3’

R: 5’- AACCTCTCTTTGAATTCTCCATTCT -3’ 56 7417 - 7868 452

한 첨가물 조건으로는 Genomic DNA 50 ng, primer 0.01 uM, 0.15 mM의 dNTP, 15 mM MgCl2/mL를 포함한 10X PCR buffer 1.5 ㎕, 그리고 Taq DNA polymerase 5 U을 넣 고 최종산물이 20 ㎕가 되게 조성하였다. 반응 조건으로는 최초 94℃에서 5분간 예비변성을 한 후 94℃에서 30초간 변 , 56℃에서 30초간 중합반응, 72℃에서 30초간 합성반응 50번 반복하였고 최종 72℃에서 10분간 합성 후 PCR을 종결하였다. 증폭된 산물들은 1.5% agarose gel에서 50 mv 전압으로 30분간 전기영동을 하여 증폭여부 및 크기를 확 인하였다.

기존 발표된(Michal 등, 2006) Wagyu x Limousin F2 종 에서 FABP4 유전자의 g.7516G>C SNP에 대한 다형성이 칡 소 및 흑소의 유전자에서도 나타나는지 확인하기 위하여 증폭산물을 제한효소로 절단하여 확인하였다. 제한효소 처 리를 위해 PCR증폭산물 10 ㎕, MspA1I(Promega, USA) 5 U, 10X Buffer 2 ㎕, Acetylated BSA 0.2 ㎕를 넣고 총량이 20 ㎕가 되도록 하였다. 만들어진 mixture는 37℃에서 총 3 시간동안 활성화 시켜 PCR증폭산물을 절단한 후 절단된 DNA 단편 확인을 위하여 1.5% agarose gel에서 100 V에서 2분간, 50 V에서 50분간 전기영동하여 절단된 DNA 절편 양상을 분석하여 유전자형 확인을 하였다.

3. 통계분석

경제형질과 관련된 성적에 대한 FABP4 유전자의 g.7516G>C SNP의 유전자형 분석에서 allele frequency는 Cervus Ver. 2.0 program(Marshall 등, 1998)을 이용하였고 통계분석은 SAS 9.2 Package(SAS Institute, Inc. Cary, NC, USA)를 이용하여 PROC GLM 방법으로 통계 분석하였으 , SNP 유전자형 효과의 유의성이 나타난 형질에 대해서 Duncan's multiple range test에 의한 유전자형별 유의 성 검정을 실시하였다. 통계분석에 이용한 모형은 다음과 같다.

Yij=µ+Gi+Maj+ℰij

여기서, Yij는 도체형질 관측치, µ는 형질의 전체평균, Gi

는 유전자형 효과, Maj는 측정 나이의 회귀변수, ℰij는 임의 오차를 나타낸다.

Ⅲ. 결과 및 고찰

Casas 등(2003)의 연구에 의하면 Bos indicus와 Bos taurus 교잡종 집단에서 소의 14번 염색체에서 마블링 등의 QTL과 유의적인 연관성을 나타냈다. 또한 Michal 등(2006) 의 연구에 따르면 Wagyu x Limousin F2 종에서 FABP4 관 SNP이 근내지방도(p<0.05)와 피하지방두께(p<0.05)에 있어서 유의적인 상관관계를 나타냈다. 최근에는 한우에서 FABP4 유전자의 g.7516G>C SNP과 연관성분석을 한 결과 도체중(p<0.01), 근내지방도(p<0.001) 그리고 배최장근 단면 (p<0.001)의 세 가지 경제형질 관련 도체형질과 유의적인 상관관계가 나타난 것으로 보고되었다(Lee 등, 2012). 본 연 구에서는 이전에 밝혀진 Michal 등(2006)이 발표한 FABP4 유전자에서 발견된 g.7516G>C SNP에 대한 정보를 기초로 칡소와 흑소에서 SNP을 확인하고 유전적 다형성과 경제형 질관련 도체특성간의 연관성을 통계 분석하였다.

FABP4 유전자의 g.7516G>C SNP를 분석하기 위해 실험 에 사용된 개체별 소의 도체형질 자료인 배최장근 단면적 (LMA), 도체중(CW), 등지방두께(BF), 근내지방도(MS)의 4 가지 항목에 대한 정보를 이용하여 FABP4 유전자의 SNP 과의 연관성을 분석하는데 참고하였다(Table 2). 유전자형 을 알아보기 위하여 PCR-RFLP 방법을 이용하여 각 절편으 로 절단하여 개체별 유전자형 차이를 확인하였다. 제한효소 MspA1I은 G>C 돌연변이가 일어나는 특정 서열을 인식하 게 되어 각각의 절편으로 잘라지게 되며, 절편의 길이는 CC genotype이 452 bp, CG Genotype이 452 bp, 352 bp, 100 bp로 나누어지며, GG genotype은 352 bp, 100 bp로 나 누어지게 된다(Fig. 1).

전기영동결과로 칡소와 흑소 FABP4 유전자의 SNP 유전 자형을 결정하여 유전자형 출현빈도를 분석하였다(Table 3). 같은 위치의 SNP을 연구한 Michal 등(2006)이 보고한 Wagyu x Limousin F2 종에서 유전자형 빈도는 CC genotype 에서 59.51%로 가장 높게 나타났으며 GG genotype에서 9.05%

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(4)

www.earticle.net

Table 2. Means, standard deviation (SD) and extreme values of phenotypic values measured on carcass traits in brindle and black cattle

Traits Breed Means SD Minimum Maximum

LMA (cm2) Brindle 80.26 13.13 42 113

Black 81.71 9.51 57 96

CW (kg) Brindle 360.11 67.5 213 576

Black 384.75 46.98 282 509

BF (mm) Brindle 9.62 4.79 3 29

Black 14.51 4.3 8 23

MS (No 1-9)1) Brindle 4.41 2.3 1 9

Black 4.67 2.28 1 9

1) Marbling score: 1-slight~9-moderately abundant.

Fig. 1. Agarose gel electrophoresis of MspA1I-PCR-RFLP. GG genotype shows two fragments (352 bp and 100 bp), CG genotype shows three fragments (452 bp, 352 bp and 100 bp), and CC genotype shows one fragment (452 bp).

Table 3. Allele and genotype frequencies for the SNP in FABP4 gene in brindle and black cattle

Breed No.of

animals

Genotype frequency (%) Allele frequency (%)

Total

CC CG GG C G

Brindle 117 59.83 37.61 2.56 78.63 21.37

100

Black 24 54.17 41.67 4.16 75 25

Total 141 57 39.64 3.36 76.82 23.19

로 가장 낮게 나타났다. 또한 Pannier 등(2010)이 보고한 9 품종의 소에서 유전자형 빈도를 분석한 결과 7 품종 (Limousin, Friesian, Simmental, Hereford, Belgian Blue, Blonde d’Aquitaine, Salers)의 소에서 CC genotype이 평균 66.5%로 가장 많았으며, CG genotype이 28.0%, GG genotype이 5.4%로 가장 낮게 나타났음을 알 수 있었다. 그 러나 나머지 2 개의 품종(Charolais, Angus)에서는 CG genotype이 가장 많은 58.3%를 나타냈으며, CC genotype 30.7%, GG genotype이 11.0%로 나타났다. 본 연구에서

는 칡소와 흑소의 CC genotype이 각각 59.83%, 54.17%로 가장 높으며 GG genotype이 각각 2.56%, 4.16%로 가장 낮 게 나타나 앞의 연구결과와 유사한 genotype frequency가 나타났음을 알 수 있었다.

칡소와 흑소 FABP4 유전자의 g.7516G>C SNP가 도체형 질에 영향을 주는지 알아보기 위하여 도축 자료와 PCR-RFLP방법으로 분석한 genotype 자료를 이용하여 SAS 9.2 Package(SAS Institute, Cary, NC, USA)로 통계분석을 하였다.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(5)

www.earticle.net

Table 4. Association of the bovine SNP in fatty acid binding protein 4 gene (g.7516G>C) with carcass traits in brindle cattle

Trait Genotype

P-value

CC CG GG

MS1) 4.79±0.25 3.77±0.38 4.67±0.67 0.070

BF (mm) 9.96±0.57 9.23±0.57 7.33±2.33 0.519

CW (kg) 347.49±7.17a 380.02±11.50b 362.67±14.81c 0.041

LMA (cm) 78.41±1.50 82.50±2.09 90.33±3.48 0.108

1) Marbling score: 1-slight~9-moderately abundant.

a,b,c Means within a row with no common superscript differ significantly (p<0.05).

Table 5. Association of the bovine SNP in fatty acid binding protein 4 gene (g.7516G>C) with carcass traits in black cattle

Trait Genotype

P-value

CC CG GG

MS1) 5.08±0.57 4.18±0.76 - 0.651

BF (mm) 13.69±1.19 15.45±1.30 - 0.627

CW (kg) 378.23±10.60 392.45±17.06 - 0.777

LMA (cm) 80.92±2.34 82.64±3.32 - 0.915

1) Marbling score: 1-slight~9-moderately abundant.

분석에 이용된 117두의 칡소에서 FABP4의 g.7516G>C SNP과 관련된 도체특성으로는 도체중(p=0.041)과 유의적인 상관관계가 있는 것으로 나타났다(Table 4). 분석된 칡소의 genotype과 도체중과의 연관분석 결과 CG genotype의 평 균치가 380.02 kg으로 CC genotype의 평균 347.49 kg과 GG genotype의 평균치 362.67 kg 보다 높은 평균치를 보였 (p<0.001).

그러나 흑소 집단에서 FABP4의 g.7516G>C SNP과 도체 특성의 연관성 분석을 한 결과 4개의 도체특성에서 유의적 인 상관관계 확인할 수 없었다(Table 5).

Michal 등(2006)의 연구는 232두 Wagyu x Limousin F2 종의 FABP4 g.7516G>C 실험에서 GG genotype의 근내지 방도에서 다른 유전자형의 근내지방도보다 더 높은 유의성 나타내었으며(p=0.0398), 피하지방두께에서 CC genotype이 0.378인치로 CG genotype의 0.428인치와 GG genotype의 0.418인치보다 낮은 유의성을 나타내었다 (p=0.0246). 또한 Lee 등(2012)의 연구에서 319두의 한우 거 세우와 도체특성의 연관성 분석을 한 결과 도체중과 배최 장근 단면적, 그리고 근내지방도에서 모두 CC 유전자형이 우월한 형질을 가지는 것으로 유의적인 연관성이 나타났다.

본 연구 결과로 미루어 볼 때 칡소에 있어서 FABP4 유전 자의 g.7516G>C SNP는 도체중에서 CG genotype이 우월 한 것으로 나타나 기존 보고된(Michal 등, 2006) 연구에서 나타난 우월한 근내지방도를 가지는 유전자형인 GG

genotype과는 다르게 나타난 것을 알 수 있었다. 또한 CC genotype이 우월한 도체형질을 가진다고 나타난 한우 거세 우에서의 연구(Lee 등, 2012)와 비교 해 보았을 때 칡소에서 CG genotype이 우월한 형질을 가지는 것으로 나타나 한국 재래종인 두 종간에도 차이점이 있는 것으로 나타났 .

이종 간(individual population)의 동일 유전자의 SNP이 도체특성에 영향을 미치고 있지만 서로 다른 도체형질에 영향을 주는 것으로 보아 Bos taurus 내에서 지방생성 및 지 방산 수송과 관련되어 여러 가지 도체형질에 영향을 미치 는 것을 알 수 있었다. 이로 미루어보아 Bos taurus 내에서 도 서로 다른 종간에 동일한 유전자의 SNP이 영향을 미치 는 도체특성은 차이가 있을 것으로 사료된다. 따라서 하나 DNA marker로 여러 가지 종에서 종 특이적인 선발 마 커로써 이용할 수 있는 가치가 높을 것으로 사료된다.

FABP4 유전자는 현재 소 뿐만 아니라 다른 동물에서도 지방생성 및 지방산 수송과 관련 된 것으로 알려져 있다 (ogino 등, 2003). 또한 Wagyu X Limousin F2 종(Michal , 2006) 에서도 FABP4 유전자의 SNP이 지방생성과 관련 된 도체형질에서 유의적인 상관관계가 있는 것으로 나타났 지만 아직까지 칡소 및 흑소에서는 FABP4 유전자의 SNP 과 경제형질 관련 도체특성과의 연관성에 대해서는 보고된 바가 없었다. 동물에서는 약 200만개의 SNP이 밝혀지면서 품종의 특성, 개체의 특성을 규명할 수 있게 되었다(Kim

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(6)

www.earticle.net

, 2008). 후보 유전자를 이용한 선발효과의 효율성을 향상 시키기 위해서는 한우와 칡소 및 흑소의 더 많은 개체군을 대상으로 한 추가연구가 필요하며 한우의 경제형질에 영향 을 미치는 다수의 추가적인 후보유전자의 SNP을 발굴하여 비교 및 분석 할 필요가 있으며 향후 본 유전자의 SNP과 상호작용하는 그 외의 경제형질에 영향을 주는 다른 후보 유전자의 SNP에 대한 추가 발굴과 연구를 통한 한우선발 DNA marker로써 발전시킬 필요가 있을 것으로 요구된다.

Ⅳ. 요약

Fatty Acid Binding Protein 4(FABP4)는 지방조직에서 발 현되며 세포내 지질대사와 항상성에 있어서 중요한 유전자 로 알려져 있다. 한우에서 FABP4 유전자의 g.7516G>C SNP과 경제형질과의 연관성에 대해서는 연구 된 바 있지 만 칡소와 흑우에서는 아직 연구 된 바가 없다. 이 연구의 목적은 칡소와 흑소에서 FABP4 유전자 발현 양상을 비교 분석하고, 유전자 내 Single Nucleotide Polymorphism (SNP)를 이용하여 칡소 및 흑소 경제형질과의 연관성을 분 석하여 고급육 생산을 위해 활용 가능한 DNA마커 개발하 고자 수행하였다. 총 117두의 칡소와 24두의 흑소 고기시료 에서 Genomic DNA를 추출하였다. 실험에 사용된 프라이 머는 기존에 보고된 NCBI Genebank(NC_007312.4)에 등록 된 정보를 활용하여 증폭하기위한 프라이머를 (5’-ATA TAG TCC ATA GGG TGG CAA AGA-3’ and 5’-AAC CTC TCT TTG AAT TCT CCA TTC T-3’) 제작하여 PCR 을 수행하였다. FABP4의 SNP는 MspA1I 제한효소를 사용 PCR-RFLP방법으로 칡소와 흑소 집단의 유전자형 분석 을 실행하였다. 칡소와 흑소의 도체 성적자료를 이용하여 FABP4 유전자의 g.7516G>C SNP과 연관성을 분석한 결과 칡소의 도체중(p<0.05)과 유의적인 상관관계가 있는 것으로 나타났다. 하지만 나머지 등지방두께, 배최장근 단면적 그 리고 근내지방도에서는 유의적인 상관관계가 나타나지 않 았다. 또한 흑소에서는 모든 경제형질 관련 도체특성과 유 의적인 상관관계가 없는 것으로 나타났다. 본 연구결과, FABP4 유전자의 g.7516G>C SNP는 칡소 집단에서 경제형 질중 도체중에 대한 성적을 평가할 수 있는 DNA marker 로써 사용할 수 있는 이용가치가 높을 것으로 예상된다. 하 지만 유전자 마커를 이용한 고급육 선발효과와 효율성을 높이기 위해 소의 경제형질에 영향을 주는 다른 SNP마커 를 검출하여 본 연구에서 나타난 경제형질 외 다른 경제형

질과 연관된 다른 후보유전자에 대한 SNP의 탐색 및 연관 성 분석이 필요할 것으로 사료된다.

사사

본 연구는 농촌 진흥청 차세대 바이오그린21 사업(과제번 PJ008196, PJ008028)으로 이루어 졌으며 이에 감사드립 니다.

Ⅴ. References

1. Casas, E., Shackelford, S. D., Keele, J. W., Koohmaraie, M., Smith, T. P. & Stone, R. T. 2003. Detection of quantitative trait loci for growth and carcass composition in cattle. J. Anim. Sci. 81:2976-83.

2. Damcott, C. M., Moffett, S. P., Feingold, E., Barmada, M. M., Marshall, J. A., Hamman, R. F. & Ferrell, R. E.

2004. Genetic variation in fatty acid-binding protein-4 and peroxisome proliferator-activated receptor gamma interactively influence insulin sensitivity and body composition in males. Metabolism: Clinical and Experimental 53:303-9.

3. Jiang, Z. & Gibson, J. P. 1999. Genetic polymorphisms in the leptin gene and their association with fatness in four pig breeds. Mammalian Genome 10:191-3.

4. Kim, D. H. 2008. The Identification of single nucleotide polymorphism (SNP) related to economic traits in Hanwoo. M. Sc. Dissertation, Kangwon National University, Chunchoen, Korea.

5. Marshall, T. C., Slate, J., Kruuk, L. E. B. & Pemberton, J. M. 1998. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol.

7:639-655.

6. Michal, J. J., Zhang, Z. W., Gaskins, C. T. & Jiang, Z.

2006. The bovine fatty acid binding protein 4 gene is significantly associated with marbling and subcutaneous fat depth in Wagyu x Limousin F2 crosses. Anim. Genet. 37:400-402.

7. Ogino, T., Moralejo, D. H., Kose, H., Yamada, T. &

Matsumoto, K. 2003. Serum leptin concentration is linked to chromosomes 2 and 6 in the OLETF rat, an animal model of type 2 diabetes with mild obesity.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

(7)

www.earticle.net

Mammalian Genome 14:839-44.

8. Pannier, L., Mullen, A. M., Hamill, R. M., Stapleton, P.

C. & Sweeney, T. 2010. Association analysis of single nucleotide polymorphisms in DGAT1, TG and FABP4 genes and intramuscular fat in crossbred Bos taurus cattle. Meat Science 85:515-518.

9. Shen, W. J., Bernlohr, K., Sridhar, D. A. & Kraemer, F.

B. 1999. Interaction of rat hormone-sensitive lipase with adipocyte lipidbinding protein. Proceedings of the

National Academy of Sciences of the United States of America 96:5528-32.

10. Shin, K. H., Shin, S. C., Chung, K. Y. & Chung, E. R.

2009. Effects of SNP markers of the apolipoprotein E (APOE) gene on meat quantity and quality traits in Korean cattle. Korean J. Food Sci. Ani. Resour.

29(1):108-113.

(투고일: 2013.05.15 수정일: 2013.06.13. 판정일: 2013.06.14.)

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 8:01 PM

수치

Table 1. Sequence of the forward (F) and reverse (R) primers used for the amplification of FABP4 gene regions
Table 2. Means, standard deviation (SD) and extreme values of phenotypic values measured on carcass traits in brindle and black cattle
Table 5. Association of the bovine SNP in fatty acid binding protein 4 gene ( g.7516G&gt;C ) with carcass traits in black cattle

참조

관련 문서

Identification of Hanwoo and Holstein meat using MGB probe based real-time PCR associated with single nucleotide polymorphism SNP in Melanocortin 1 receptor MC1R gene

This study aims to investigate whether major single nucleotide polymorphism (SNP)s and their haplotypes of the ADRB2 ( 2 β -adrenoceptor) gene are associated with children with

In addition, quantitative trait loci (QTL) analysis for synchronous maturity of pods was conducted by using single nucleotide polymorphism (SNP) markers used to construct

polymorphism of angiotensin converting enzyme gene on progression of diabetic nephropathy during inhibition of angiotensin converting enzyme: obser- vational follow

Association between postoperative nausea and vomiting (PONV) and µ-opioid receptor A118G single nucleotide polymorphism (SNP) is undefined and might underlie inconsistent results

Abstract : The aim of this study was to identify the polymorphism on fatty acid binding protein (FABP4) gene promoter region and its association with carcass traits in

These results suggest that the g.7516G&gt;C SNP located in the FABP4 gene may affected differently depending on the cattle breed and can be used as a genetic selection marker in

We report three patients with normal karyotype (NK) ALL, who showed genetic aberrations as determined by high-resolution single nucleotide polymorphism array (SNP-A) analysis at