한우 Fatty Acid Binding Protein 4 유전자 g.7516G>C SNP와 경제형질과의 연관성 분석

(1)

www.earticle.net

한우 Fatty Acid Binding Protein 4 유전자 g.7516G>C SNP와 경제형질과의 연관성 분석

이승규^1#⋅이영섭^1#⋅김훈¹⋅배윤호¹⋅이성진^2*

강원대학교 동물생명과학대학 대학원생¹, 교수²

Association between the g.7516G>C SNP in the Fatty Acid Binding Protein 4 Gene and Economic Traits in Hanwoo

Seung-Kyoo Lee^1#, Young-Sub Lee^1#, Hun Kim¹, Yun-Ho Bae¹ and Sung-Jin Lee^2*

1Graduate Students, ²Professor, College of Animal Life Sciences, Kangwon National University, Chuncheon 24341, Korea

ABSTRACT¹⁾

The fatty acid binding protein 4 (FABP4) gene plays an important role in lipid metabolism and homeostasis in adipocytes. The objective of this study was to analyze the association between a single nucleotide polymorphism (SNP), g.7516G>C, in the FABP4 gene and economic traits of Korean native cattle, Hanwoo. Primers were designed to target a region of the FABP4 gene between nucleotides 7417 and 7868 (AAFC01136716). The SNP, which was detected by polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) method using restriction enzyme MspA1I, was genotyped in 319 animals of Hanwoo steer population. Statistical analysis showed that the SNP genotype of the FABP4 gene significantly affected carcass weight (CW, p<0.01), longissimus muscle area (LMA, p<0.001), and marbling score (MS, p<0.001). GG allele of the SNP on 246 animals in a Wagyu × Limousin F2 reference population showed a higher MS (p<0.05) and subcutaneous fat depth (p<0.05) in previous report. But CC allele of the SNP showed greater values for MS, LMA, and CW in Hanwoo steers. These results suggest that the g.7516G>C SNP located in the FABP4 gene may affected differently depending on the cattle breed and can be used as a genetic selection marker in Korean native cattle.

(Key words: Korean native cattle, Fatty acid binding protein 4, RFLP, Carcass weight, Marbling score)

Ⅰ. Introduction

Korean native cattle is known as Hanwoo and is the main beef cattle breed of Korea. Accordingly, carcass weight and marbling score are considered to be critical

economic traits. To satisfy consumer demand, genetic and molecular techniques have been applied to native cattle research to produce better quality beef.

Fatty acid binding proteins (FABP4) are a family of small, highly conserved cytoplasmic proteins that bind

# Both authors contributed equally to this manuscript

* Corresponding author: Sung-Jin Lee, Department of Animal Biotechnology, Kangwon National University, Chuncheon 24341, Korea. Tel: +82-33-250-8636, E-mail: [email protected]

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc-nd/3.0/deed.ko), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The moral rights of the named author(s) have been asserted.

[Provider:earticle] Download by IP 118.70.52.165 at Monday, December 20, 2021 7:46 PM

(2)

www.earticle.net

long-chain fatty acids and other hydrophobic ligands (Kaikauset al., 1990). The gene can be found in adipose tissues, and it is known to combine with hormone- sensitive lipase by interacting with peroxisome proliferator- activated receptors (PPARs). It is also known to be an important gene for cellular lipid metabolism and homeostasis (Damcott et al., 2004). It is widely recognized that FABP4 is involved in lipid hydrolysis and intracellular fatty acid transportation through direct interaction and binding with hormone-sensitive lipase (Shen et al., 1999). One study has proposed that FABP4 is a potential candidate gene for obesity in mice because it is located in a quantitative trait locus (QTL) region that affects levels of serum leptin (Ogino et al., 2003). Leptin, a 16-kda protein secreted from white adipocytes, is involved in the regulation of food intake, energy expenditure, and whole-body energy balance (Jiang and Gibson 1999). Consequently, FABP4 is an important gene for homeostasis in adipocyte and lipid metabolism (Michal et al., 2006). A mutation in the FABP4 gene was shown to be correlated with intramuscular and subcutaneous fat, and both of these were important in the improvement of meat quality in a Wagyu x Limousin F2 population (Michal et al., 2006).

Based on this, our study analyzed the possibility of using the FABP4 gene as a genetic selection marker for Hanwoo for improved meat quality, and to this end, we examined qualitative traits using a PCR-based restriction fragment length polymorphism (RFLP) methodology.

Ⅱ. Materials and Methods

1. Animals and data collection

A total of 319 Hanwoo steers, average 30.5 months of age, were included in this analysis. Four standard carcass economic traits were obtained from databases held by the Korean Institute for Animal Products Quality Evaluation: carcass weight (CW), longissimus muscle area (LMA), backfat thickness (BF), and

marbling score (MS). These traits were used for comparative analyses.

2. DNA extraction

Genomic DNA was extracted from 25 mg samples of each individual animal using an i-genomic CTB DNA Extraction Mini Kit (Intron Biotechnology, Korea). DNA concentration and purity (A260/A280 ratio) for each sample were estimated using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The quantified DNA samples were stored at -8 0℃ until further analysis.

3. PCR-RFLP genotypes

Primers for the FABP4 gene g.7516G>C SNP were designed based on a previous study (Michal et al., 2006) and confirmed using GenBank (accession number NC_007312.4). The primer sequences were as follows:

one pair (ATATAGTCCATAGGGTGGCAAAGA and AACCTCTCTTTGAATTCTCCATTCT) amplifies a region of 7417–7868 bp, which contains a short tandem repeat (CA). We used the GeneAmp^® PCR System 9700 (Applied Biosystems, Foster, CA, USA) to amplify the genomic DNA. Approximately 50 ng of genomic DNA was amplified in a final volume of 20 µl that contained 0.01 µM of each primer, 0.15 mM dNTPs, 1.5 µl 10X PCR buffer containing 15 mM MgCl2/mL and 5 U of Taq DNA polymerase (Applied Biosystems). The PCR conditions were as follows: 94℃ for 2 min, 32 cycles of 94℃ denaturation for 30 sec, 56℃ annealing for 30 sec and 72℃ extension for 30 sec, followed by 5 min final extension at 72℃. PCR products were examined by electrophoresis on a 1.5% agarose gel with 0.5X TBE buffer to determine the size of DNA fragments.

For FABP4 gene genotyping, RFLP analysis was performed in a final volume of 20 µl that contained 10 µl of PCR product, 5 U of MspA1I restriction enzyme (Promega, Fitchburg, WI, USA), 2 µl of 10X buffer and 2 µg of acetylated BSA. The mixture was incubated at 37℃ for 3 h to digest the PCR products. Products were then loaded onto a 1.5% agarose gel and run for 40

(3)

www.earticle.net

Fig. 1. Agarose gel electrophoresis of PCR-RFLP products obtained by the MspA1l restriction enzyme. CC genotype shows one fragment (452 bp), GG genotype shows two fragments (352 bp and 100 bp), CG genotype shows three fragments (452 bp, 352 bp and 100 bp). Adapted from Lee et al. (2013).

min to analyze the digested fragment size for genotyping. The MspA1I restriction enzyme recognizes specific sites created by the G>C mutation process and divides each segment into restriction fragments.

Fragments containing the G allele resulted in two bands of 100 bp and 352 bp. Fragments containing the C allele resulted in a single 452 bp band, as the amplicon was not cut by MspA1I (Fig. 1).

4. Statistical analysis

The allele frequency data for economic traits was analyzed using the Cervus Ver. 2.0 program (Marshall et al., 1998). Statistical analysis of variance was calculated using the SAS v9.2 Package (SAS Institute, Cary, NC, USA) and the PROC GLM procedure to evaluate the effects of different genotypes on meat quality and carcass traits. Sources of variation included observation of the carcass trait, whole average for each trait, effect of genotype, and random error effects of each observation.

Ⅲ. Results and discussion

Michal et al. (2006) reported that the g.7516G>C SNP

of the FABP4 gene was significantly correlated with the marbling score (p=0.0398) and subcutaneous fat depth (p=0.0246) in Wagyu x Limousin F2 crosses. Our study was based on information in the previous study and investigated the FABP4 gene SNP in Hanwoo. We analyzed the statistical association between the economic traits of cattle and the genetic effects of the SNP.

Findings from the previous study (Michal et al., 2006) showed that the genotype frequency for CC was higher (59.91%) than that for the CG (31.04%) and GG genotypes (9.05%). Pannier et al. (2010) analyzed the genotype frequencies in nine different breeds of cattle.

Their research showed that most breeds, including Limousin, Friesian, Simmental, Hereford, Belgian Blue, Blonde d’Aquitaine, and Salers, had a higher average CC genotype (66.5%) compared with CG (28.0%) and GG (5.5%) genotypes. However, other breeds of cattle, such as Charolaise and Angus, had a higher average CG genotype (58.3%) compared with CC (30.7%) and GG (11%) genotypes. Table 1 lists the observed genotype and allele frequencies for Hanwoo for the g.7516G>C SNP of the FABP4 gene in the present study. The PCR RFLP analysis of the SNP revealed that the allele frequencies of C and G were 0.702 and 0.298, and those of CC, CG, and GG were 0.496, 0.411, and 0.093, respectively. These results show ratios similar to

(4)

www.earticle.net

Table 1. Allele and genotype frequencies for the SNP (g.7516G>C) in theFABP4 gene in Hanwoo

No. of animal Genotype frequency Allele frequency

CC CG GG C G

319 0.496 0.411 0.093 0.702 0.298

Table 2. Association of the bovine SNP (g.7516G>C) in fatty acid binding protein 4 gene with carcass traits in Hanwoo

Trait SNP Genotype

P-value

CC (mean ± SE) CG (mean ± SE) GG (mean ± SE)

CW 408.95 ± 4.27^a 393.48 ± 5.57^a 371.11 ± 16.14^b <0.01

LMA 90.34 ± 1.01^a 84.75 ± 1.27^b 77.43 ± 3.50^c <0.001

BF 10.68 ± 0.31 11.04 ± 0.53 11.46 ± 1.08 0.6999

MS 5.57 ± 0.20^a 4.31 ± 0.24^b 3.61 ± 0.48^b <0.001

CW, carcass weight; LMA, longissimus muscle area; BF, backfat thickness; MS, marbling scores.

a,b,cDifferent superscripts within columns are significantly different (p<0.05).

those obtained in other studies (Michal et al., 2006;

Pannier et al., 2010).

To measure the effects of the g.7516G>C SNP on carcass traits, we used the genotype data obtained using the PCR RFLP method and the SAS 9.2 statistical analysis program (Table 2).

The results of the correlation analysis in 319 Hanwoo cattle showed a highly significant association between the FABP4 g.7516G>C SNP and MS (p<0.001), CW (p<0.01), and LMA (p<0.001) traits. The CC genotype (5.57) had a higher mean MS value than did the CG (4.31) and GG genotypes (3.61). With regard to CW, the CC genotype (402.02 kg) had higher carcass weight than did the CG (358.4 kg) and GG (358.40 kg) genotypes.

For the mean LMA values, the CC genotype was 90.67 cm², the CG genotype was 81.52 cm², and the GG genotype was 74.85 cm². The CC genotype appeared to have higher mean MS, CW, and LMA values compared with the CG and GG genotypes. According to the previous study of 232 Wagyu x Limousin F2 cattle (Michal et al., 2006), the GG (6.211) genotype had significantly higher MS (p=0.0398) than the GC (6.106) and CC (5.791) genotypes had. That study also found that the CC genotype had significantly lower subcutaneous fat depth (0.378 inches) compared with GC (0.428 inches) and GG genotypes (0.418 inches).

In our study, we found by correlation analyses that the SNP was linked to desirable economic traits in

Korean native cattle. However, the association of MS showed contrasting results to the previous research (Michal et al., 2006). In Hanwoo, the mean value of the MS was higher in the CC genotype, but Wagyu x Limousin F2 cattle with the GG genotype in the previous report had higher MS than genotype CC.

According to the previous research of Qinchuan cattle (Liu et al., 2010), the 1069C>G SNP in MC4R gene showed significant association (p<0.05) with CW, BF, and MS. Whereas, Lee et al. (2013) reported that the SNP was significantly correlated with only the BF in the Korean brindle and black cattle (p<0.05). These results suggest that there are differences of the association between SNP and economic traits depending on the cattle breed.

To conclude, the g.7516G>C SNP in the FABP4 gene showed a highly significant association with MS, CW, and LMA in Hanwoo. These results suggest that the CC allele of g.7516G>C SNP of the FABP4 gene could be a suitable specific DNA marker for the economic traits of Hanwoo.

Ⅳ. References

1. Damcott, C. M., Moffett, S. P., Feingold, E., Barmada, M. M., Marshall, J. A., Hamman, R. F. and Ferrell, R.

E. 2004. Genetic variation in fatty acid-binding

(5)

www.earticle.net

protein-4 and peroxisome proliferator-activated receptor gamma interactively influence insulin sensitivity and body composition in males.

Metabolism. 53(3):303-309.

2. Jiang, Z. H. and Gibson, J. P. 1999. Genetic polymorphisms in the leptin gene and their association with fatness in four pig breeds. Mamm Genome. 10:191-193.

3. Kaikaus, R. M., Bass, N. M. and Ockner, R. K. 1990.

Functions of fatty acid binding proteins. Experientia.

46:617–630.

4. Lee, S. K., Lee, Y. S., Park, S. R., Kim, H., Choi, S.

Y., Lee, J. Y., Kim, K. B., Park, J. W., Choi, J. W., Lee, H. K. and Lee, S. J. 2013. Effect of g.7516G>C SNP in FABP4 gene with carcass traits in Korean brindle cattle and Black cattle. Ann. Anim. Resour.

Sci. 24(1):16-22.

5. Marshall, T. C., Slate, J., Kruuk, L. E. B. and Pemberton, J. M. 1998. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol. 7:639-655.

6. Michal, J. J., Zhang, Z. W., Gaskins, C. T. and Jiang,

Z. 2006. The bovine fatty acid binding protein 4 gene is significantly associated with marbling and subcutaneous fat depth in Wagyu x Limousin F2 crosses. Anim. Genet. 37:400-402.

7. Ogino, T., Moralejo, D. H., Kose, H. Yamada, T. and Matsumoto, K. 2003. Serum leptin concentration is linked to chromosomes 2 and 6 in the OLETF rat, an animal model of type 2 diabetes with mild obesity.

Mamm. Genom. 14:839-844.

8. Pannier, L., Mullen, A. M., Hamill, R. M., Stapleton, P. C. and Sweeney, T. 2010. Association analysis of single nucleotide polymorphisms in DGAT1, TG and FABP4 genes and intramuscular fat in crossbred Bos taurus cattle. Meat Sci. 85:515-518.

9. Shen, W. J., Sridhar, K., Bernlohr, D. A. and Kraemer, F. B. 1999. Interaction of rat hormone-sensitive lipase with adipocyte lipidbinding protein. Proc. Natl. Acad. Sci. USA. 96:5528-5532.

(Received 07 September 2020, Revised 25 September 2020, Accepted 25 September 2020)