Extracts of <i>Polygonum multiflorum</i> Inhibit RANKL-mediated Osteoclast Differentiation

DOI 10.17480/psk.2018.62.2.83

Extracts of Polygonum multiflorum Inhibit RANKL-mediated Osteoclast Differentiation

Kwang-Jin Kim*, Yongjin Lee*, Kyung-Yun Kang**, Yun-Ho Hwang*, Sung-Tae Yee*, Sang-Jip Nam***, and Young-Jin Son*

*

Department of Pharmacy, Sunchon National University, Jeonnam, Suncheon 57922, Korea

**

Suncheon Research Center for Natural Medicines, Jeonnam, Suncheon 57922, Korea

***

Department of Chemistry and Nano Science, Global Top 5 Program, Ewha Womans University, Seoul 03760, Korea (Received March 7, 2018; Revised March 30, 2018; Accepted April 13, 2018)

Abstract — Osteoporosis is a disease caused by decreased bone density. The number of patients with osteoporosis is increasing, and the cost of medical treatment is rising because of the increase in fracture patients. Treatment of osteoporosis is important to prevention of bone loss. One treatment for osteoporosis is inhibition of osteoclast formation. Osteoclasts, which are multinucleated cells that absorb bone, are greatly increased and over-activated in bone disorders, including oste- oporosis and rheumatoid arthritis. In this study, we investigated whether extracts of P. multiflorum (PME) influence RANKL-induced osteoclast differentiation. The PME significantly inhibited RANKL-induced osteoclast differentiation by inhibiting transcriptional and translational expression of NFATc1, an essential element of RANKL-mediated osteoclast for- mation. Furthermore, it inhibited the mRNA expression of TRAP, DC-STAMP, and cathepsin K, which are all related to osteoclast differentiation and function. Thus, our results suggest that PME has the potential for use as a functional food and therapeutic substance for the treatment of osteoporosis.

Keywords bone, osteoporosis, osteoclast, RANKL, NFATc1, Polygonum multiflorum

Introduction

Bones are dynamic tissues composed of various types of cells that undergo regenerative and repair processes known as bone remodeling. Osteoclasts and osteoblasts are the main cell types involved in bone modification.

It is important to bal- ance the activity of osteoclasts and osteoblasts in bone homeo- stasis. The increased activity or number of osteoclasts in bone homeostasis causes bone diseases such as osteoporosis, Paget's disease, rheumatoid arthritis and periodontal disease.

Osteoporosis, which is the most common bone disease world- wide, is associated with decreased bone mass and increased risk of fracture. Osteoporosis patients are more likely to experience fractures, with osteopenia, worsening bone microstructure, and increased bone vulnerability being among the pathological fea-

tures of the disease. The main cause of osteoporosis is related to increased bone resorption because of increased osteoclast number.

Osteoclasts are large multinucleated cells formed by the fusion of several mononuclear precursors and the main cells responsible for absorption by the skeleton. Osteoclasts remove old bones and maintain mineral homeostasis.

Osteoclast dif- ferentiation is regulated by two cytokines, macrophage colony stimulating factor (M-CSF) and receptor activator of nuclear fac- tor- κB (NF-κB) ligand (RANKL).

M-CSF produced by immune cells/osteoblasts induces RANK expression and osteoclast sur- vival signals in osteoclast precursor cells.

RANKL, which is secreted by osteoblasts/activated T cells, binds to receptor RANK in osteoclasts, after which it induces activation of JNK, ERK, p38, NF-kB, and NFATc1.

NFATc1, which is the key transcription factor for osteoclastogenesis, regulates the expres- sion of osteoclast differentiation and activation factors, such as tartrate-resistant acid phosphatase (TRAP), cathepsin K and dendritic cell-specific transmembrane protein (DC-STAMP).

Polygonum multiflorum (PM) is one of the most popular Tra- ditional Chinese Medicines and a component of many medi-

#

Corresponding Author Young-Jin Son

Department of Pharmacy, Sunchon National University, Jeonnam, Suncheon 57922, Korea

Tel.: 061-750-3755 Fax.: 061-750-3028 E-mail: [email protected]

Short Report

cines and prescriptions. PM has a variety of pharmacological functions, such as bone and muscle strengthening, antioxidant action

, and hair growth promotion.

However, the mecha- nisms by which it strengthens bone have yet to be reported.

Therefore, in this study, we investigated the role of the extracts of PM (PME) in osteoclast differentiation affecting bone strength.

Materials and Methods

Preparation of PM Extracts

Polygonum multiflorum was purchased from Dong-Bu Herbal Market (Suncheon, KR) and 500 g was thoroughly soaked in distilled water (3 × 5 L) at 85

C for 3 h. The supernatant was then filtered using Whatman number 2 filter paper (90 mm ø;

GE Healthcare, GB), after which it was transferred to a pre- weighed container. The liquid was then concentrated on a rotary evaporator (EYELA, JP) and lyophilized (OPERON, KR) to yield crude extract (170 g).

Cell cultures and preparation of macrophages and osteo- clasts

This study was conducted in strict accordance with the recom- mendations contained in the Standard Protocol for Animal Study of Sunchon National University (SCNU, Suncheon, Korea). The protocol was approved by the SCNU Institutional Animal Care and Use Committee (IACUC) with Permit No. SCNU IACUC 2016- 05. All efforts were made to minimize suffering.

All cells were cultured in a 37°C and 5% CO

incubator and the culture medium was replaced with fresh medium once every three days. To prepare macrophages, bone marrow cells (BMCs) were obtained from the femurs and tibias of 5 week old male ICR mice (n=2: DBL, KR). The BMCs were cul- tured with 10 ng/mL macrophage colony-stimulating factor (M- CSF; Peprotech, NJ, USA) for 18 h in α-MEM (Invitrogen Life

Technologies, CA, USA) containing 10% Fetal bovine serum (FBS; Invitrogen Life Technologies, CA, USA) and 100 U/mL penicillin/streptomycin (10% α-MEM) on a culture dish. The non-adherent cells were then incubated with 30 ng/mL M-CSF in 10% α-MEM on a Petri dish for 3 days, after which adhered cells were used as bone marrow derived macrophages (BMMs).

For osteoclastogenesis, BMMs were seeded in 96-well plates at a density of 1 × 10

cells/well and cultured with vehicle (0.1%

DW) or PME in the presence of 30 ng/mL M-CSF and 10 ng/

mL RANKL in 10% α-MEM for 4 days.

TRAP staining assay

Cells were fixed with 3.7% formalin for 5 min, permeabi- lized with 0.1% Triton X-100 for 10 min, and then incubated with a TRAP-staining solution (Sigma-Aldrich, MO, USA) for 10 min. TRAP positive cells with three or more nuclei were counted as mature osteoclasts.

Cytotoxicity assay for extracts of P. multiflorum

BMMs were seeded in 96-well plates at a density of 1 × 10

cells/well and cultured with vehicle (0.1% DW) or PME in the presence of 30 ng/mL M-CSF in 10% α-MEM for 3 days. Cell survival was assessed using a CCK-8 kit (Dojindo Molecular Technologies, JP) according to the manufacturer’s protocols.

Real-time PCR

BMMs were seeded in 6-well plates at a density of 3.5 × 10

cells/well and cultured with vehicle (0.1% DW) or PME in the presence of 30 ng/mL M-CSF and 10 ng/mL RANKL in 10%

α-MEM for the indicated days. The primer sets shown in Table 1 were designed using the online primer3 program for real-time PCR [17]. Total RNA of the cells was obtained by the TRIzol extraction method. The complementary DNA was mod- ified using a ReverTra Ace qPCR RT Master Mix according to the manufacturer's protocol. Quantitative real-time PCR was

Table I − Primer sequences used in this study.

Gene of interest Primer sequence (5’→ 3’)

Sense Anti-sense

NFATc1 GGGTCAGTGTGACCGAAGAT GGAAGTCAGAAGTGGGTGGA

cathepsin K GGCCAACTCAAGAAGAAAAC GTGCTTGCTTCCCTTCTGG

DC-STAMP CCAAGGAGTCGTCCATGATT GGCTGCTTTGATCGTTTCTC

TRAP GATGACTTTGCCAGTCAGCA ACATAGCCCACACCGTTCTC

GAPDH AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA

performed using the TOPreal qPCR 2 × PreMIX in Real-Time PCR Detection System (BioRad, CA, USA). The relative lev- els of the tested genes were normalized to the level of glycer- aldehyde-3-phosphate dehydrogenase (GAPDH) and the data were analyzed by the 2

method.

Western blot analysis

BMMs were incubated with vehicle (0.1% DW) or PME in the presence of 30 ng/mL M-CSF and 10 ng/mL RANKL in 10% α-MEM for the indicated days. Cells were lysed in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Tri- ton X-100, 1 mM sodium fluoride, 1 mM sodium vanadate, 1%

deoxycholate, and 1 mM PMSF) on ice for 30 min. The lysates were then centrifuged at 20,000 g for 15 min, after which the protein concentration in the supernatant was determined by the DC™ Protein Assay (BioRad, CA, USA). The proteins (20 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 10%), then blotted to a polyvi- nylidene difluoride (PVDF) membrane (Amersham Biosci- ences, NJ, USA). The membrane was treated with primary antibodies for about 16 h at 4

C. The blots were then incu- bated with horseradish peroxidase (HRP)-conjugated second- ary antibody for 2 h at room temperature, after which the membranes were visualized using MicroChemi 4.2 (DNR Bio- imaging System, Jerusalem, IL, USA) and Super-Signal West

Pico Chemiluminescent Substrate (Pierce Chemical, Rockford, IL, USA). The detected NFATc1 and actin bands were quanti- fied on the basis of the intensity using ImageJ software and the relative normalization ratios of NFATc1 to actin are shown in the figure.

Statistical analysis

All quantitative data are presented as the means ± standard deviation of three replicate experiments. Statistical differences were analyzed by Student’s t-tests. Probability (p) values less than 0.05 were considered significant (p values *<0.05,

**<0.01, and ***<0.001).

Results

PME inhibits RANKL-induced osteoclast differentiation We evaluated the effects of PME on the ability of RANKL to differentiate BMM to determine the potential role of PME in osteoclast differentiation. Cells were cultured with vehicle (0.1% DW) or PME (indicated concentration) for 4 days in the presence of RANKL (10 ng/mL) and M-CSF (30 ng/mL). The formation of TRAP positive MNCs was induced by RANKL, but PME decreased it (Fig. 1A). Moreover, PME reduced the number of TRAP positive MNCs (3 ≤ nuclei) in a dose-depen- dent manner at concentrations greater than 50 μg/mL (Fig. 1B).

Fig. 1 − PME inhibited osteoclast differentiation. (A) BMMs were cultured with 10 ng/mL RANKL and 30 ng/mL M-CSF for 4 days in the presence of vehicle (0.1% DW) or the indicated concentrations of PME. Cells were fixed in 3.7% formalin, permeabilized with 0.1%

Triton X-100, and stained with TRAP solution. (B) TRAP-positive multinucleated cells (3 or more nuclei) were counted as osteoclasts.

**P < 0.01, *** P < 0.001.

PME had no cytotoxic effect on BMMs

To determine if inhibition of osteoclastogenesis was due to PME-induced cytotoxicity, we conducted cytotoxicity experi- ments with BMMs. BMMs were cultured with vehicle (0.1%

DW) or PME for 3 days in the presence of M-CSF (30 ng/mL).

As shown in Figure 2, PME did not show cytotoxic effects on BMMs at the concentrations used in this study.

PME inhibited RANKL-induced mRNA expression of NFATc1

To confirm the inhibitory effects of PME on osteoclast dif- ferentiation, expression of transcription factors necessary for osteoclast formation and genes involved in osteoclast differen- tiation were evaluated. RANKL significantly increased the mRNA level of NFATc1, but PME decreased its level (Fig. 3).

PME also strongly reduced mRNA expression of TRAP, DC-

STAMP and cathepsin K genes regulated by NFATc1.

PME inhibited RANKL-induced protein expression of NFATc1

We evaluated the inhibitory effects of PME on protein expression of NFATc1, a major regulator of osteoclast differen- tiation, using western blot analysis. The increase in protein expression of NFATc1 induced by RANKL was significantly reduced by PME (Fig. 4). These results implied that PME Fig. 2 − PME had no cytotoxic effects on BMMs. BMMs were

cultured with 30 ng/mL M-CSF for 3 days in the presence of vehicle (0.1% DW) or the indicated concentrations of PME.

The effects of PME on BMMs viability were assessed using a CCK-8 assay kit. n = 3.

Fig. 3 − PME inhibited RANKL-induced mRNA expression of NFATc1 and osteoclast-specific genes. BMMs were treated with vehicle (0.1% DW) or PME (100 μg/mL) and stimulated with 10 ng/mL RANKL and 30 ng/mL M-CSF for the indicated days. Expressed mRNA levels relative to a DW control were measured by real-time PCR. * P < 0.05, ** P < 0.01, ***

P < 0.001 (n = 3).

Fig. 4 − PME inhibited RANKL-induced protein expression of NFATc1. BMMs were pretreated with vehicle (0.1% DW) or PME (100 μg/mL)

for 1 h, then stimulated with 10 ng/mL RANKL and 30 ng/mL M-CSF for the indicated times. Cell lysates were subsequently

analyzed by SDS-PAGE and western blotting was performed using anti-NFATc1 and actin antibody.

inhibited translational expression of NFATc1 and inhibited osteoclast formation.

Discussion

Osteoporosis is a bone related disease characterized by decreased amounts of bone and a decrease in the strength of bone tissue. In 2000, there were 9 million osteoporotic frac- tures, of which 1.6 million were in the hip, 1.7 million in the forearm, and 1.4 million in clinical vertebral fractures.

Osteo- porosis is a burden to health and the global economy because of its high mortality rate and associated costs.

Therefore, it is essential that effective methods to prevent or treat the onset of osteoporosis be developed.

Bone quality is greatly influenced by the balance between osteoclasts that absorb bones and osteoblasts that form bones.

The osteoclasts formed from hematopoietic stem cells in bone marrow are the only cells that can absorb bone.

These cells are matured by fusion of the monocyte/macrophage lineage

, and their formation is strongly influenced by RANKL.

RANKL signaling has been an important target for osteo- clastogenesis and the treatment of pathological bone loss.

When RANKL binds to the receptor RANK, it rapidly acti- vates mitogen-activated protein (MAP) kinases such as p38, ERK, and JNK. These MAP kinases are important factors for osteoclast differentiation, survival, and activation.

Acti- vated MAP kinases induce the stimulation of transcription fac- tors such as NFATc1.

The root of Polygonum multiflorum (PM) has long been used in traditional Asian medicine to strengthen muscles and bones, improve the digestive system, and for detoxification. Here, we investigated the effects of extracts of PM (PME) on RANKL- mediated osteoclast differentiation. BMMs were incubated with RANKL and M-CSF in the presence of PME. PME com- pletely inhibited TRAP positive MNCs and did not show any cytotoxicity at concentrations above 100 μg/mL. These results suggest that PME had an inhibitory effect on osteoclast forma- tion without cytotoxicity to BMMs.

The transcriptional factors of the NFAT family were origi- nally found in T cells, and were involved in the regulation of various biological systems.

It is evident that the NFATc1 gene plays an important role during osteoclast formation, both in vitro and in vivo.

Therefore, the mRNA and protein expression levels of NFATc1 were analyzed by real-time PCR

and western blotting, respectively, to confirm the inhibitory effects of PME on osteoclast differentiation at the molecular level. In the presence of PME, the expression levels of mRNA and protein of NFATc1 decreased in RANKL treated BMMs. In addition, mRNA levels of TRAP, DC-STAMP, and cathepsin K, which are regulated by NFATc1, were decreased by PME.

Conclusion

The results of this study demonstrated that PME exerted inhibitory effects by downregulating NFATc1 in RANKL-medi- ated osteoclast differentiation in vitro. Reduced NFATc1 also lowered the expression of genes known as osteoclast differen- tiation markers, such as TRAP, DC-STAMP, and cathepsin K.

Thus, our results suggested that PME could be useful in pre- venting and treating osteoclastogenesis leading to bone destruc- tion, and that it may be useful as a functional food material and therapeutic agent for osteoporosis.

Acknowledgement

This paper was supported by Sunchon National University Research Fund in 2017.

References

1) Goltzman, D. : Discoveries, drugs and skeletal disorders.

Nat.Rev.Drug Discov. 1, 784 (2002).

2) Rodan, G. A. and Martin, T. J. : Therapeutic approaches to bone diseases. Science. 289, 1508 (2000).

3) Vaananen, H. K. and Laitala-Leinonen. T. : Osteoclast lineage and function. Arch. Biochem. Biophys. 473, 132 (2008).

4) Boyle, W. J., Simonet W. S. and Lacey, D. L. : Osteoclast differentiation and activation. Nature. 423, 337 (2003).

5) Feng, X. : RANKing intracellular signaling in osteoclasts.

IUBMB Life. 57, 389 (2005).

6) Kansara, M., Teng, M. W., Smyth, M. J., and Thomas, D. M. : Translational biology of osteosarcoma. Nat. Rev. Cancer. 14, 722 (2014).

7) Galibert, L., Tometsko, M. E., Anderson, D. M., Cosman, D., and Dougall, W. C. : The involvement of multiple tumor necrosis factor receptor (TNFR)-associated factors in the signaling mechanisms of receptor activator of NF-kappaB, a member of the TNFR superfamily. J. Biol. Chem. 273, 34120 (1998).

8) Wong, B. R., Josien, R., Lee, S. Y., Vologodskaia, M., Steinman,

R. M., and Choi, Y. : The TRAF family of signal transducers mediates NF-kappaB activation by the TRANCE receptor. J.

Biol. Chem. 273, 28355 (1998).

9) Teitelbaum, S. L. : RANKing c-Jun in osteoclast development.

J. Clin. Invest. 114, 463 (2004).

10) Takayanagi, H. : The role of NFAT in osteoclast formation.

Ann. N. Y. Acad. Sci. 1116, 227 (2007).

11) Takayanagi, H. : Osteoimmunology: shared mechanisms and crosstalk between the immune and bone systems. Nat. Rev.

Immunol. 7, 292 (2007).

12) Wagner, E. F., and Eferl, R. : Fos/AP-1 proteins in bone and the immune system. Immunol. Rev. 208, 126 (2005).

13) Matsumoto, M., Kogawa, M., Wada, S., Takayanagi, H., Tsujimoto, M., Katayama, S., Hisatake, K., and Nogi, Y. : Essential role of p38 mitogen-activated protein kinase in cathepsin K gene expression during osteoclastogenesis through association of NFATc1 and PU.1. J. Biol. Chem. 279, 45969 (2004).

14) Yagi, M., Miyamoto, T., Sawatani, Y., Iwamoto, K., Hosogane, N., Fujita, N., Morita, K., Ninomiya, K., Suzuki, T., Miyamoto, K., Oike, Y., Takeya, M., Toyama, Y., and Suda, T. : DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body giant cells. J. Exp. Med. 202, 345 (2005).

15) Lv, L., Cheng, Y., Zheng, T., Li, X., and Zhai, R. : Purification, antioxidant activity and antiglycation of polysaccharides from Polygonum multiflorum Thunb. Carbohydr. Polym. 99, 765 (2014).

16) Park, H. J., Zhang, N., and Park, D. K. : Topical application of Polygonum multiflorum extract induces hair growth of resting hair follicles through upregulating Shh and beta-catenin expression in C57BL/6 mice. J. Ethnopharmacol. 135, 369 (2011).

17) Rozen, S., and Skaletsky, H. : Primer3 on the WWW for general users and for biologist programmers. Methods Mol.

Biol. 132, 365 (2000).

18) Livak, K. J., and Schmittgen, T. D. : Analysis of relative gene expression data using real-time quantitative PCR and the 2(- Delta Delta C(T)) Method. Methods. 25, 402 (2001).

19) Johnell, O. and Kanis, J. A. : 2006. An estimate of the worldwide

prevalence and disability associated with osteoporotic fractures.

Osteoporos. Int. 17, 1726 (2006).

20) Harvey, N., Dennison, E., and Cooper, C. : Osteoporosis:

impact on health and economics. Nat. Rev. Rheumatol. 6, 99 (2010).

21) Cauley, J. A. : Public health impact of osteoporosis. J. Gerontol.

A Biol. Sci. Med. Sci. 68, 1243 (2013).

22) Teitelbaum, S. L. : Bone resorption by osteoclasts. Science.

289, 1504 (2000).

23) Grigoriadis, A. E., Wang, Z. Q., Cecchini, M. G., Hofstetter, W., Felix, R., Fleisch, H. A., and Wagner, E. F. : c-Fos: a key regulator of osteoclast-macrophage lineage determination and bone remodeling. Science. 266, 443 (1994).

24) Mansky, K. C., Sankar, U., Han, J., and Ostrowski, M. C. : Microphthalmia transcription factor is a target of the p38 MAPK pathway in response to receptor activator of NF-kappa B ligand signaling. J. Biol. Chem. 277, 11077 (2002).

25) Gingery, A., Bradley, E., Shaw, A., and Oursler, M. J. : Phosphatidylinositol 3-kinase coordinately activates the MEK/

ERK and AKT/NFkappaB pathways to maintain osteoclast survival. J. Cell. Biochem. 89, 165 (2003).

26) Crabtree, G. R. and Olson, E. N. : NFAT signaling:

choreographing the social lives of cells. Cell. 109 Suppl, S67 (2002).

27) Hogan, P. G., Chen, L., Nardone, J., and Rao, A. : Transcriptional regulation by calcium, calcineurin, and NFAT.

Genes Dev. 17, 2205 (2003).

28) Takayanagi, H., Kim, S., Koga, T., Nishina, H., Isshiki, M., Yoshida, H., Saiura, A., Isobe, M., Yokochi, T., Inoue, J., Wagner, E. F., Mak, T. W., Kodama, T., and Taniguchi, T. : Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev. Cell. 3, 889 (2002).

29) Asagiri, M., Sato, K., Usami, T., Ochi, S., Nishina, H., Yoshida, H.,

Morita, I., Wagner, E. F., Mak, T. W., Serfling, E., and Takayanagi,

H. : Autoamplification of NFATc1 expression determines its

essential role in bone homeostasis. J. Exp. Med. 202, 1261

(2005).