Genetic characterization of porcine circovirus 2 Korean isolates

전체 글

(1)³¤¥Èó. * .* a. (2004) 44 4 Korean J Vet Res(2004) 44(4) : 571~579. 1PSDJOFDJSDPWJSVT]ÚªÒ~F*'ß9. ;R Áã8ÁB*>.

(2). ]ã>~¦ö ÏÎL >~ (²Òß: 2004j 10ú 22¢) 1. Genetic characterization of porcine circovirus 2 Korean isolates Choi-Kyu Park*, Kyoung-Ki Lee and Hyun-Soo Kim1 National Veterinary Research and Quarantine Services, Anyang 430-824, Korea College of Veterinary Medicine, Chungnam National University, Daejeon 305-764, Korea (Accepted= October 22, 2004). 1. Abstract : In order to obtain the genetic informations of the Korean isolates of porcine circovirus 2 (PCV2), nucleotide sequences of total genome of three isolates and open reading frame 2 (ORF2) of four isolates were determined and compared with those of other reference PCV2 isolates. Nucleotide sequences of 3 isolates showed over 99% homology with those of reference strain (GenBank accession no. AF027217). Point mutations were mainly determined on ORF2 regions but little on ORF1 regions. The patterns of pointmutated sites and nucleotide substitution on ORF2 regions were generally consistent between Korean isolates, and these mutated sites observed in Korean isolates were also relatively similar to those of foreign isolates. Phylogenetic analysis of nucleotide or amino acid sequences showed that there were minor branches consisting of three clusters; cluster of Korea, Canada and America, cluster of Spain and Taiwan, and the last cluster of French and China isolates. These results suggested that Korean PCV2s were probably originated from North America such as Canada or USA. The genetic informations obtained from this study could be useful for the research of diagnosis and pathogenecity of PCV2. Key words : postweaning multisystemic wasting syndrom(PMWS), porcine circovirus(PCV), nucleotide sequence, open reading frame(ORF), phylogenetic tree. * . "öº >.W *"(post-transfusion hepatitis)ö Ö Ò²ö²B Ò²~ circovirus ¯, TT virus(TTV)& ÿ; B : ®b [24, 27], TTVº CAVf F*' W FÒ ©b > ® [24]. PCVº "æöB~ ÷öW FZö V¢ "æ Ë^

(3) "(PK-15, ATCC-CCL 33)öB F¾B j÷öW~ PCV1" " * ^ê'b B~ ®º F¶î~ *²ÎWÃê(postweaning multisystemic wasting syndrome, PMWS)~ 1N' öÚ PCV2 ª~ ««~ ® [2, 3, 21, 32]. PCV1" PCV2 ª Ò" ~ F*¶"VB ªCö & ¶. ~ ö V [12, 21, 23, 25] PCV1 ªÒ"*. º ê~ ö; j &ê ²; B ª ~> ®. öº ö ÿb F¾~ 5 f b F¾~ 5 ®b 7 ÿbF¾ «~ ¯ 5 *öº B F* ' ö' &W ìº ©b rJ^ ®. Porcine circovirus(PCV) DNA genome nonenveloped virus Circoviridae [14, 31]. Circoviridae PCV chicken anemia virus(CAV) [33] psittacine beak and feather disease virus(PBFDV) [28] subterranean clover stunt virus(SCSV) [7], banana bunchy top virus(BBTV) [13] coconut foliar decay virus (CFDV) [29] , 3 circovirus , PCV, CAV PBFDV , [6, 33].. *Corresponding author: Choi Kyu Park National Veterinary Research and Quarantine Services, Anyang 430-824, Korea [Tel: +82-31-467-1818, Fax: +82-31-467-1739, E-mail: [email protected]]. 571.

(4) ;RÁã8ÁB*>. 572. 6º PCV2 ªÒ"*öº *Ú F*¶"VB~ ¢ ~N 90% çb ¸f çÿWj ®b¾ PCV1" PCV2 ªÒ"*öº 68-76%~ ¢~Nj ¾ æÚÚ :Ê *ö F*' ßW çj " ® . PCV1~ genomef *Ú 1,759B~ Öb W> Ú ®b, 5 kDa ç~ Wîj W > ®º 7B ~ open reading frame(ORF) B;~ · "VBö B {B : ® [20, 21]. >ö PCV2~ genomef 1,767-1,768B~ Öb W>Ú ®b, 6B 6º 11 B~ ORF& Ò {>î [10, 12, 23, 25]. 7 PCV~ Ã" "º Wî~ Wö &ê~º ORF1" ORF2ö & F*¶"VB ªCÖ", ORF1 ~ ãÖ PCV1" PCV2 *~ "VB" jÖV ~ ¢~N '' 83%f 86% v :Ê *ö ö' &W ®rj Ò~ ®º > ORF2~ ã Ööº '' 67%f 65%~ ¢~Nj ¾æÚ ®Ú F*' N& PCV1" Ò PCV2& ÷öWj ¾ æÚº 7º j ~º ©b 6B [4, 17, 19, 26]. Þ '~ PCV2 ªÒ"*öº 90% ç~ ¸f F*¶ ¢~Nj ¾æÚ ®Ú [5, 10, 23], jçræ îÚ genotype Ò º Ãº ì . ¾ F #, §, jj B æöB ªÒB PCV2 ªÒ"*ö ¢¦ F*' æ& ®º ©b > ®b [12], F*' æö & ;º PCV2 6"ö & ê, ÷öW~ «, .O£~ BB . · ª¢ö 7º ¶ò& F ©b 'B . ÚöBê PMWS B÷î~ ÷æçöB PCV2~ 6" {>º PMWS~ B÷ Ã&~ ® [9, 15, 16]. ¾ jçræ ÚöB B~ ®º PCV2 ö & F*' ; öÚ~ ßWö & º ê ç . V¢B öBº Ú ·îË~ PMWS B÷îöB ªÒB PCV2 Ú ªÒ"ö & F*¶"VBj ªC~ ;¢ B~º ÿö ~ ªÒ"f jvªC~ F*' æ ¦¢ Òb Ëê PMWS PCV2~ ÷öW « ö V.¶ò Ï~¶ ~& .. Òò 5 O». :

(5) Ê 5 ^

(6) Ú ªÒ"~ F*' ßWj Ò~V *~ ; [1] PMWS 6" îb¦V ªÒ ªÒ" 7"¢ ~ 3"(PCK0101, PCK0201 5 PCK0203)º *Ú F*¶"VBj, ¾^æ 4"(PCK9901, PCK2K01,. PCK0102 5 PCK0202)º ORF2 F*¶"VBj ª C~& . PCV2~ V·f PCV& 6">æ pf "æ Ë^

(7) "(nPK-15 cell)¢ Ï~ ; [1]~ O»ö V¢ ~& . ¯, PCV2~ 6" {B nPK-15 ^

(8) ¢ ê&~ 37 CöB 1¢* V·~, phosphatebuffered saline(PBS, pH 7.4)b 2² ^¿ r, 300 mM D-glucosamine FB α-minimum essential medium(α-MEM, Gibco BRL, USA)j Î&~ 37 Cö B 30ª* ¾Ò~& . ¾Ò ¯ PBS ^¿~ 10% Öj.Ó(fetal calf serum, FCS, Moregate, USA) FB ^

(9) V·Væ¢ Î&~ 2¢* z V· êö ^

(10) ¢ >~ F*¶"VB ªCÏ DNA ºÂö ~& . ^

(11) V·Væº α-MEMö Væ 1 ml penicillin 100 IU, streptomycin 100 µg 5 lactalbumin hydrolysate 0.25% >² Î& r, 56 CöB 30ª* jÿz FCS ¢ 10% >² Î&~ ÒÏ~& . W PCV2 *Ú F*¶~ ªCf Hamel [12] F*¶"VB(GenBank accession number AF027217) j ^~ PCR Ã B ' F*¶Þ~ "VB j ªC, ~ *Ú F*¶"VB~ ªC &Ë ~ê 8«~ primer pair¢ W~ ÒÏ~& (Table 1). b& 1, 6, 7 5 8® primer pair¢ Ï~ '' PCR j r, Ã B DNA Þ j F*¶"VB ªCö B~&, 4«~ primer pairö ~ Ã B DNA j* 6ë ¦ ãÖöº 'b 2, 3, 4 5 5® primer pair Ã DNA Þj Ï~ º& "VBj ªC~& . ORF2 F*¶"VB ªCj * DNA Ã f ORF2F/R primer pair¢ W~ ÒÏ~& (Table 1).

(12) ºÂ 5 Ã Tissue DNA premate reagent(Bioneer, Korea) kitj Ï~ PCV2 6"^

(13) ¦V DNA¢ ºÂ~&b, º Â DNA 10 µlf ' primer 1 µl(50 pmol)¢ PCR > w(AccuPower PCR Premix, Bioneer)ö Î& r, PCRj ~& . PCR >wf 94 CöB 5ª* 1 N >wÎ r, 94 Cö 45., 55 Cö 45. 5 72 C ö 1ªO 30² >~ >wÎ ê « 72 CöB 10 ª* >w8 . PCR Ã B DNAº '' 10 µl O ~ 1.5% agarose gelj Ï~ *V'ÿj . r, ethidium bromide Ï(0.5 µg/ml)b "ï~ ¶ F ~öB ßZ¢ &V~ Ã ¦¢ {~ & [30]. o. o. o. o. o. o. o. o.

(14) Porcine circovirus 2. ]Ú ªÒ~ F*' ß9. 573. Table 1. Primers for amplification of porcine circovirus 2 genes in nucleotide sequencing Primer pairs. a. Nucleotide sequences (5'-3'). Position. Stranda. 1 (433bp) 2 (532bp) 3 (515bp) 4 (493bp) 5 (254bp) 6 (677bp) 7 (656bp) 8 (778bp). F R F R F R F R F R F R F R F R. GCAGCACCTCAGCAGCAACA CTGCTCTGCAACGGTCACCA TGGTGACCGTTGCAGAGCAG GGAAATTCAGGGCATGGGGG GCTCTCTATCGGAGGATTAC GGCTCCACTGCTGTTATTCT AGTGGAGTCAAGAACAGG GCGTTACCGCAGAAGAAGAC CTTCTCCAACGGTAGCGGTG GTCCGCTTCTTCCATTCTTC GGACGAACACCTCACCTCCA ATCCTCCGATAGAGAGCTTC CTACTGAGACTGTGTGATCG GGCTCCACTGCTGTTATTCT AGTGGAGTCAAGAACAGG GTCCGTCCTTCCTCATTACC. 32-51 464-445 445-464 976-957 867-886 1381-1362 1226-1243 1718-1699 1617-1636 81-62 207-226 883-864 726-745 1381-1362 1226-1243 214-195. V C V C V C V C V C V C V C V C. ORF2 (702bp). F R. ATGACGTATCCAAGGAGGCG TTAGGGTTTAAGTGGGGGGTC. 1735-1716 1034-1055. C V. V, viral sequence; C, complementary sequence.. Table 2. Porcine circovirus 2 (PCV2) isolates used in comparison of nucleotide sequences Type PCV2. a b. Isolates. Geographic regions. AF027217 AJ223185 AF055392 AF201311 AF201305 AF201308 AF538325 AF166528 AF544024 PCK9901b PCK2k01b PCK0101a PCK0102b PCK0201a PCK0202b PCK0203a. USA (California) USA (Iowa) Canada France Germany Spain China Taiwan Korea Korea Korea Korea Korea Korea Korea Korea. Reference or source Hamel et al. (1998) [12] Morozov et al. (1998) [25] Meehan et al. (1998) [23] Mankertz et al. (2000) [18] Mankertz et al. (2000) [18] Mankertz et al. (2000) [18] GenBank GenBank GenBank This study This study This study This study This study This study This study. PCV2 field isolates which were sequenced on entire genome. PCV2 field isolates which were sequenced on open reading frame 2 gene.. F*¶"8B 5 jÖ ªC PCR Ã B ' DNAº Geneclean II kit(Bio101, USA)¢ ÒÏ~ ;B r, -20 Cö &~B " VB ªCö ÒÏ~& . "VBªCf Taq Dye Primer Cycling kit(ABI, USA)f ABI PRISM 377 sequencer(Perkin Elmer, USA)¢ Ï~ ''~ "V o. Bj 6ë r, DNASIS *Î(Hitachi ver 2.5) b ªC~& . PCV2 Ú ªÒ" 3"ö & *Ú F*¶"VBf Hamel [12] "VB" jv .ªC~&b, 6 B , ¶¾ , * ·Ê, ë¢, Ê¾ ªÒ" 5 GenBankö >B , 7 5 &ò ªÒ" C 9"(Table 2)ö &.

(15) ;RÁã8ÁB*>. 574. ¢ ·W~ F*' ç&&ê¢ ªC~ & jÞ ~ F*¶ 7 jv' æ& © b rJê F*¶ö &Bº Ú ªÒ" 7" f *F ' ªÒ"~ F*¶"VB" jÖB j jvªC~, '' phylogenetic tree¢ ·W~ F*' ç&&ê¢ ªC~& . phylogenetic tree . PCV2 ORF2. Ö . F*¶"8B ªC «~ Ú ªÒ"(PCK0101, PCK0201 5 ö & *Ú F*¶"VBj ªC~V * ~ B·B «~ primer pair¢ Ï~ PCR¢ . 3 PCV2 PCK0203) 8. ~& Ã B F*¶Þ~ "VBj ªC ê *Îb ÒV~ PCV2 Ú ªÒ"ö & *Ú F*¶"VBæê¢ ·W~& (Fig. 1). *ÚF*¶~ Vº PCK0101"º 1,768B~ nucleotide W>Ú ®, PCK0201 5 PCK0203"º ORF2 ¦*ö ~º 1,335® "VBö 1B~ nucleotide& deletion>Ú 1,767B~ nucleotide W> Ú ®î . 3«~ Ú ªÒ"*öº *Ú F*¶"V B 7 5B ¦*öB "VB~ N& BÒ>îb¾ *Ú'b 99.5% ç~ ¸f ¢~Nj ¾æÚî . ªÒ" 3"~ F*¶ "VBj AF027217 " [11] f jv Ö", ' ªÒ" ê 11-16B~ nucleotide& point mutation>Ú ®º ©b {>î . ORF1ö , DNASIS. Fig. 1. Comparison of nucleotide sequences of porcine circovirus 2 Korean isolates and American isolate. Homologous nucleotides are indicated by dot. The start- and stop codons of two main ORFs (Rep and C1) are bold and double arrows indicate tanscriptional direction..

(16) Porcine circovirus 2. ]Ú ªÒ~ F*' ß9. 575. Fig. 2. Phylogenetic tree based on the total nucleotide sequences of porcine circovirus 2 genome. Abbreviations indicating geographic locations are as follows; FRA: France, CHI: China, SPA: Spain, TAI: Taiwan, KOR: Korea, CAN: Canada, GER: Germany.. Fig. 1. Continued. ~º "VB(51-995 bp)~ ãÖº 180® "VBö B 2B ªÒ"(PCV0201 5 PCK0203)º A& G æ >î, 294® "VBöBº Ú ªÒ" 3" ® G & C point mutation>Ú ®î . ORF2ö ~º "VB(1029-1735 bp)~ ãÖº ' ªÒ"ö V¢ 10 -14B~ point mutation {>Ú ORF1ö j ² ôf æ& &V>î . '~ PCV2 ªÒ"f Ú ªÒ" 3"~ *Ú F* ¶"VBö & phylogenetic tree¢ ·W~ ç&& ê¢ ªC Ö"(Fig. 2), Ú ªÒ"º ¶¾ ªÒ" 5 ªÒ"f 99% >&b &Ë &7 F*' ç &&ê¢ ¾æÚîb, Ê¾, ë¢ 5 &ò ªÒ"f º 97% >&~ ² Ôf ç&&ê¢ ¾æÚî . Þ *·Ê 5 7 ªÒ"º ·~ ªÒ"*öº 99% ç~ ¸f ç&&ê¢ ¾æÚîb¾ ·ªÒ" " Ú ªÒ""º 94% >&~ jv' Ôf ç&& ê¢ ¾æÚî . F*¶"8B 5 jÖ ªC Ú ªÒ PCV2 7"~ ORF2 F*¶"VBj ª C Ö", Ú ªÒ"*ö ¢¦ deletion 5 point. Fig. 3. Phylogenetic tree based on the open reading frame 2 nucleotide sequences of porcine circovirus 2 isolates. Abbreviations indicating geographic locations are as follows; FRA: France, CHI: China, SPA: Spain, TAI: Taiwan, KOR: Korea, CAN: Canada, GER: Germany.. ö ~ ç nucleotide& &V>îb¾ 99% ç~ ¸f ¢~Nj ¾æÚî . Ú ªÒ"~ F* ¶"VB 7 point mutationB nucleotide~ *~¾ « ~º &Ú'b ¢~~º ·çj &b, ªÒ "~ point mutation ·ç"ê jv' FÒ ãËj ¾ æÚî . PCV2 ªÒ"*~ F*' ç&&ê¢ rj. mutation.

(17) ;RÁã8ÁB*>. 576. º *Ú F*¶ "VBj, ¾^æ 4" 5 PCK0202)º ªÒ" *ö jv' æ& ©b rJê ORF2ö & F*¶"VBj ªC~ Ö"¢ '~ PCV2 ª Ò"~ F*¶"VB(Table 2)" jvªC~& . *Ú F*¶"VBj ªC 3«~ Ú ªÒ"º 1,767B(PCK0201 5 PCK0203) 5 1,768B(PCK0101)~ nucleotide W>Ú ®î . 6 ORF2 F*¶"VB j ªC Ú ªÒ" 4" 7 2"(PCK2K01 5 PCK0102)º deletionB ¦*& ìÚ 1,768B~ nucleotide , ¾^æ 2"(PCK9901 5 PCK0202)º ÿ¢ ¦* öB 1B~ nucleotide& deletion>Ú ®Ú f 1,767 B~ nucleotide W>Ú ®j ©b 6>îb, ·çf '~ PCV2 ªÒ"~ F*¶"VB j jvªC Fenaux [11]~ W'"ê ¢~~& . ORF1~ "VBf Ú ªÒ"*ö 99% ç~ ¸ f ¢~Nj ¾æÚîb, ªÒ"(AF027271)fº 2B "VB*~(180 5 294® "VB)öB point mutation {>îb¾ 99% ç~ ¢~Nj ¾ æÚÚ Ö n;B ·çj ¾æÚ ®î . º PCV2 ~ ORF1f :Ê~ Ãö j>' replicationassociated proteinj W~ ®bæ n;W ¸ º [21, 22]f ¢~~º © . 6 " PMWSf î÷~ ·ç ê>º "æb¦" 5 ÃÃê (porcine dermatitis and nephropathy syndrome, PDNS) B ÷ .öB ªÒB PCV2~ ãÖê ORF1~ "VBf PMWS &N PCV2 ªÒ"f ¸f ¢~Nj ¾æÚ ® º [22]f ¢^~ Ú ªÒ"~ "VB ªC Ö"öB ORF1~ "VB Ö n;'ªj J r ORF1~ F*' N& PCV2~ ÷öW N ö 'Ëj &ËWf Ö Ôf ©b 'B . Ú ªÒ" 7"ö & ORF2ö & F*¶"VB ªCÖ", Ú ªÒ"*öº 98% ç~ ¸f ¢~ Nj ¾æÚî, ªÒ"(AF027217)fê 97% > &b ¢~~& . ¾ AF027217~ F*¶"VB " jv Ö", ' ªÒ"ö V¢ 9-13B~ point mutationj { > ®îb, æB "VB*~ " r 9B "VB *~ ¯, ORF2 F*¶ "VB ·¦*¦V 7®(TG), 86®(AT), 161®(GT), 312 ®(TG), 477/478®(T/AG/C), 515®(CG) 5 517/ 518®(G/CC/G) "VB *~öBº Ú ªÒ" 7 "& ÿ¢~² æB ©b {>Ú ¦*~ æ º Ú ªÒ"*~ Û' æ 6>î . 6 ªÒ"ö V¢ 202®(AC)f 7"7 4", 302®(G deletion)f 7" 7 5", 334®(AG)f 7" 7 3", 403 ®(CT)f 7" 7 2" 5 661®(GA)f 7" 7 5". PCK0203) (PCK9901, PCK2K01, PCK0102. Fig. 4. Phylogenetic tree based on amino acid sequences of the open reading frame 2 of porcine circovirus 2 isolates. Abbreviations indicating geographic locations are as follows; FRA: France, CHI: China, SPA: Spain, TAI: Taiwan, KOR: Korea, CAN: Canada, GER: Germany.. V *~ öB ªC Ú ªÒ" 7"f V ö B ªÒ" 2" [12, 25], ¶¾ [22], *· Ê, ë¢ 5 Ê¾ ªÒ" ' 1" [18] 5 GenBank ¦V «> 7, &ò 5 ªÒ"~ ORF2 F* ¶"VBö &~ phylogenetic analysis¢ ~&. (Fig. 3). Ú ªÒ" 7"f .¶¾ ªÒ"*ö º 96-100%~ ¢~Nj ¾æÚÚ F*' ç&&ê&. Ö ¸~b¾, Ê¾ .&ò ªÒ" 5 ë¢ ªÒ"º Ú ªÒ"" 94.6% 5 93.9% jv' Ôf ç&& ê¢ ¾æÚîb, *·Ê .7 ªÒ""º z Ôf 89% >&~ ç&&ê¢ ¾æÚî . ¾ Ê¾" &ò ªÒ" 6º *·Êf 7 ªÒ"*öº '' 96% 6º 98% ç~ ç&&ê¢ ¾æÚÚ &ê ªÒ "*ö ¢¦ minor branch& Ò~º ©b {>î. . ORF2 jÖ B ªCÖ"ê ¢¦ ªÒ"*ö çÿWö ² N& ®j ö F*¶"VB ªCÖ "f FÒ ·çj ¾æÚî (Fig. 4).. V. PCV2 Ú ªÒ"~ F*' ßW" ªÒ"f~ ç&W ¦¢ rj¶ PMWS B÷î~ çòö B ªÒ PCV2ö & F*¶"VB ªCj ~ & . ¯, Ú ªÒ" 7"7 3"(PCK0101, PCK0201 5.

(18) Porcine circovirus 2. ]Ú ªÒ~ F*' ß9. öB "VB~ æ& &V>º · æ·ç j ¾æÚî . 6 æ·çj ~ ªÒ"f jv Ö", Ú ªÒ"~ æ& B ¦*öº ª Ò" 7 2B ç~ ªÒ"& æ¢ ®º ¦* ª {>Ú PCV2 ORF2 F*¶"VB~ æ& jv' ¢; ¦*öB Úæº ©b º;>î . PCV2~ "º Wîj W~ ®º ORF2º PCV2 ~ ORF 7öB &Ë æ& ©b rJ^ ® [11, 12, 18], ORF2~ æ& PCV2~ ?" ÿbö & ÷öW" & ® º Ò& ¢¦ ¶ö ~ BV> ® [18, 22]. Feline parvovirusf ?f ²; DNA :Ê~ ãÖöº ¢¦ F*¶ " VB~ point mutationö V 1-2B~ jÖW ~ æ& 6>WÿbN ·öB B æzÒ ;ê :Ê~ ÷öWö Ö;' 'Ëj > ®rj ~ ® [8]. j PCV2 ²; DNA :ÊB ORF2 "VBö ®Ú ²>~ point mutation ÷öWö Ö;' 'Ëj &ËW ¸b, æ& ÚöB B~ ®º PMWS~ ÷öW¾ ªçÃç~ ·W" & ®j ©b 6>¾ ö &Bº Ëê z «>Ú ¢ ©b 'B . Ú ªÒ" 7"f '~ ªÒ"~ ORF2 F*¶" VBj jv~ phylogenetic analysis F*' ç& Wj ªC Ö", . .¶¾ ªÒ", ë¢ ª Ò", Ê¾ .&ò ªÒ" 5 *·Ê .7 ªÒ" b F*' ç&&ê& ª>º ¢«~ minor branch & Ò~º ©b ¾æÒb(Fig. 3), ·çf ORF2~ jÖ B ªCÖ"öBê ÿ¢~² { >î (Fig. 4). º Fenaux [11] '~ PCV2 ª Ò"ö & F*¶"VBj jvªC Ö", ' æ ê ªÒ"*ö F*' Nö V «~ minor branch& Ò~, ß® *·Ê ªÒ"~ ãÖ ª Ò" " Â]® ªB º f ¢~~& . ¢ ^öB ªC '~ ªÒ"*~ F*' ç&&êº &* "æ~ vç" &7 &W ®j ©b º;>¾ z× ;& ' ªC jº ©b 'B . Þ ¢^öB ªC PCV2 Ú ªÒ" ~ F*¶"VB ;º PCR" ?f PCV2 6"Ã~ F*¶êö ®Ú primer ·W ö 7º ;& F ©b 6>, Ëê PCV2 6"Ãö & ÷öW~ « öê Ï&~& Ö ¸j ©b 6B .. Ö . PMWS. ßÃçj º Ú ·îË~ "æ¦V. 577. ªÒ PCV2 Ú ªÒ" 7«ö & F*¶ "VB j ªC~& . 3«~ Ú ªÒ"(PCK0101, PCK0201 5 PCK0203)ö & *Ú F*¶"VBj ªC Ö ", Ú ªÒ"*öº 99.5% ç~ ¸f ¢~Nj ¾ æÚîb, ªÒ"(AF027217)fê 99% ç~ ¸ f ¢~Nj ¾æÚî . Ú ªÒ"~ F*¶"VB j ªÒ"(AF027217)f jv®j r ' ªÒ" ö V¢ 11-16B ¦*~ point mutationB ¦*& *Ú F*¶"VBöB {>î . æº ORF1 F*¶ º ORF2 F*¶öB " &V>îb, ORF2 F*¶"VB~ æB *~¾ Öf Ú ª Ò"*ö &Ú'b ¢~>º ·çj ¾æÚîb, æ¦*º ~ ªÒ"öBê z® æ& &V >º ¦* {>î . Ú ªÒ" 7"f ' ªÒ"~ ORF2 F*¶"V B 5 jÖBö &~ phylogenetic analysis F*' ç&&ê¢ ªC Ö", . .¶¾ ª Ò", ë¢ªÒ", Ê¾ .&òªÒ" 5 *·Ê .7 ªÒ" " ? F*' ç&&ê& ² ç minor branch& Ò~º ©b {>îb, Ö" Ú " r ~ PCV2º §öB F¾> îj &ËW ¸f ©b º;B . ¢ Û~ áÚê PCV2 Ú ªÒ"~ F*' ;º Ëê ê »BB¾ ÷öW « ö FÏ ©b 6B .. ^^ò. 1.. ;R, B*>. F¶î *²ÎWÃê` ~ ¶ îöB~ :

(19) ÊW öÚ ¦ï 5 porcine circovirus 2 ªÒÿ;. &>~²æ. 2004, 44, 561-569.. 2. Allan, G., Meehan, B., Todd, D., Kennedy, S., McNeilly, F., Ellis, J., Clark, E. G., Harding, J., Espuna, E., Botner, A. and Charreyre, C. Novel porcine circoviruses from pigs with wasting disease syndromes. Vet. Rec. 1998, 142, 467-468. 3. Allan, G. M. and Ellis, J. A. Porcine circoviruses: a review. J. Vet. Diagn. Invest. 2000, 12, 3-14. 4. Allan, G. M., McNeilly, F., Cassidy, J. P., Reilly, G. A., Adair, B., Ellis, W. A. and McNulty, M. S. Pathogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material. Vet. Microbiol. 1995, 44, 49-64. 5. Allan, G. M., McNeilly, F., Kennedy, S., Daft, B., Clark, E. G., Ellis, J. A., Haines, D. M., Meehan, B. M. and Adair, B. M. Isolation of porcine circoviruslike viruses from pigs with a wasting disease in the USA and Europe. J. Vet. Diagn. Invest. 1998, 10, 3-10..

(20) 578. ;RÁã8ÁB*>. 6. Bassami, M. R., Berryman, D., Wilcox, G. E. and Raidal, S. R. Psittacine beak and feather disease virus nucleotide sequence analysis and its relationship to porcine circovirus, plant circoviruses, and chicken anaemia virus. Virology. 1998, 249, 453-459. 7. Boevink, P., Chu. P. W. and Keese, P. Sequence of subterranean clover stunt virus DNA: affinities with the geminiviruses. Virology. 1995, 207, 354-361. 8. Chang, S. F., Sgro, J. Y. and Parrish, C. R. Multiple amino acids in the capsid structure of canine parvovirus coordinately determine the canine host range and specific antigenic and hemagglutination properties. J. Virol. 1992, 66, 6858-6867. 9. Choi, C. and Chae, C. In-situ hybridization for the detection of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J. Comp. Pathol. 1999, 121, 265-270. 10. Ellis, J., Hassard, L., Clark, W., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D. and Haines, D. Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can. Vet. J. 1998, 39, 41-51. 11. Fenaux, M., Halbur, P. G., Gill, M., Toth, T. E. and Meng, X. J. Genetic characterization of type 2 porcine circovirus (PCV-2) from pigs with postweaning multisystemic wasting syndrome in different geographic regions of North America and development of a differential PCR-restriction fragment length polymorphism assay to detect and differentiate between infections with PCV-1 and PCV-2. J. Clin. Microbiol. 2000, 38, 24942503. 12. Hamel, A. L., Lin, L. L. and Nayar, G. P. Nucleotide sequence of porcine circovirus associated with postweaning multi-systemic wasting syndrome in pigs. J. Virol. 1998, 72, 5262-5267. 13. Harding, R. M., Burns, T. M. and Dale, J. L. Viruslike particles associated with banana bunchy top disease contain small single-stranded DNA. J. Gen. Virol. 1991, 72, 225-230. 14. Lukert, P., de Boer, G. F. and Dale, J. L. The Circoviridae. In: Murphy, F.A., Fauquet, C.M., Bishop, D.H.L., eds. Virus Toxonomy. 6th Rep. Int. Committee Taxon. Viruses. pp. 166-168, Vienna: Springer-Verlag, 1995. 15. Lyoo, K. S., Park, Y. H. and Park, B. K. Prevalence of porcine reproductive and respiratory syndrome virus,. 16.. 17.. 18.. 19.. 20.. 21.. 22.. 23.. 24.. 25.. porcine circovirus type 2 and porcine parvovirus from aborted fetuses and pigs with respiratory problems in Korea. J. Vet. Sci. 2001, 2, 201-207. Lyoo, Y. S., Kim, J. H. and Park, C. K. Identification of porcine circoviruses with genetic variation from lymph nodes collected in pigs with PMWS. Kor. J. Vet. Sci. 1999, 39, 353-358. Mahe, D., Blanchard, P., Truong, C., Arnauld, C., Le Cann, P., Cariolet, R., Madec, F., Albina, E. and Jestin, A. Differential recognition of ORF2 protein from type 1 and type 2 porcine circoviruses and identification of immunorelevant epitopes. J. Gen. Virol. 2000, 81, 1815-1824. Mankertz, A., Domingo, M., Folch, J. M., LeCann, P., Jestin, A., Segales, J., Chmielewicz, B., PlanaDuran, J. and Soike, D. Characterisation of PCV-2 isolates from Spain, Germany and France. Virus Res. 2000, 66, 65-77. Mankertz, A., Mankertz, J., Wolf, K. and Buhk, H. J. Identification of a protein essential for replication of porcine circovirus. J. Gen. Virol. 1998, 79, 381-384. Mankertz, A., Persson, F., Mankertz, J., Blaess, G. and Buhk, H. J. Mapping and characterization of the origin of DNA replication of porcine circovirus. J. Virol. 1997, 71, 2562-2566. Meehan, B. M., Creelan, J. L., McNulty, M. S. and Todd, D. Sequence of porcine circovirus DNA: affinities with plant circoviruses. J. Gen. Virol. 1997, 78, 221-227. Meehan, B. M., McNeilly, F., McNair, I., Walker, I., Ellis, J. A., Krakowka, S. and Allan, G. M. Isolation and characterization of porcine circovirus 2 from cases of sow abortion and porcine dermatitis and nephropathy syndrome. Arch. Virol. 2001, 146, 835-842. Meehan, B. M., McNeilly, F., Todd, D., Kennedy, S., Jewhurst, V. A., Ellis, J. A., Hassard, L. E., Clark, E. G., Haines, D. M. and Allan, G. M. Characterization of novel circovirus DNAs associated with wasting syndromes in pigs. J. Gen. Virol. 1998, 79, 2171-2179. Miyata, H., Tsunoda, H., Kazi, A., Yamada, A., Khan, M. A., Murakami, J., Kamahora, T., Shiraki, K. and Hino, S. Identification of a novel GC-rich 113nucleotide region to complete the circular, singlestranded DNA genome of TT virus, the first human circovirus. J. Virol. 1999, 73, 3582-3586. Morozov, I., Sirinarumitr, T., Sorden, S. D., Halbur, P. G., Morgan, M. K., Yoon, K. J. and Paul, P. S..

(21) Porcine circovirus 2. 26.. 27.. 28.. 29.. ]Ú ªÒ~ F*' ß9. Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J. Clin. Microbiol. 1998, 36, 2535-2541. Nawagitgul, P., Morozov, I., Bolin, S. R., Harms, P. A., Sorden, S. D. and Paul, P. S. Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J. Gen. Virol. 2000, 81, 2281-2287. Nishizawa, T., Okamoto, H., Konoshi, K., Yoshizawa, H., Miyazawa, Y. and Mayumi, M. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem. Biophys. Res. Commun. 1997, 241, 92-97. Ritchie, B. W., Niagro, F. D., Latimer, K. S., Lukert, P. D., Steffens, W. L. 3rd, Rakich, P. M. and Pritchard, N. Ultrastructural, protein composition, and antigenic comparison of psittacine beak and feather disease virus purified from four genera of psittacine birds. J. Wildl. Dis. 1990, 26, 196-203. Rohde, W., Randles, J. W., Langridge, P. and. 30.. 31.. 32.. 33.. 579. Hanold, D. Nucleotide sequence of a circular singlestranded DNA associated with coconut foliar decay virus. Virology. 1990, 176, 648-651. Sambrook, J. F., Russell, D. W. and Irwin, N. Molecular Cloning: A laboratory manual. 3rd ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2000. Tischer, I., Geldblom, H., Vettermann, W. and Koch, M. A. A very small porcine virus with circular singlestranded DNA. Nature. 1982, 295, 64-66. Tischer, I., Mields, W., Wolff, D., Vagt, M. and Griem, W. Studies on epidemiology and pathogenicity of porcine circovirus. Arch. Virol. 1986, 91, 271-276. Todd, D., Niagro, F. D., Ritchie, B. W., Curran, W., Allan, G. M., Lukert, P. D., Latimer, K. S., Steffens, W. L. and NcNulty, M. S. Comparison of three animal viruses with circular single-stranded DNA genomes. Arch. Virol. 1991, 117, 129-135..

(22)