Effects of Kamijihwang-tang on Immune Cells and Cytokines in OVA-induced Asthmatic Mice

서 론

( )

1) .

, ,

1) .

Effects of Kamijihwang-tang on Immune Cells and Cytokines in OVA-induced Asthmatic Mice

Do-Gyun Rah, Yang-Chun Park

Division of Respiratory System, Dept. of Internal Medicine, College of Oriental Medicine, Daejeon University

Objectives: The purpose of this study wasto examine the effects of Kamijihwang-tang (KJHT) extracts on immune cells and cytokines in ovalbumin (OVA)-induced asthmatic mice.

Methods: C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks (four times a week) for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 / and 200 / ) extracts and cyclosporine A (10 / ) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and immune cells were analyzed by flow cytometer, IL-5, IL-13, eotaxin-2, TNF-α were analyzed by real-time PCR, serum histamine was analyzed by ELISA kit.

Results: CD3

, CD3e

/CCR3

, CD3e

/CD69

, CD4

/CD25

, B220

/IgE

, and CD3e

/DX5

cells in lung, PLN, and spleen of the KJHT group (400 / ) decreased compared with that of the control group. CD3e

/CD69

, CD4

/CD25

, and CD3e

/DX5

cells in lung, PLN, and spleen of the KJHT group (200 / ), CD3

, CD3e

/CCR3

cells in lung and PLN of the KJHT group (200 / ) and B220

/IgE

cells in lung and spleen of the KJHT group (200 / ) decreased compared with that of the control group. mRNA expression of IL-5, IL-13, eotaxin-2, and TNF- α in lung tissue of the KJHT groups (400 / and 200 / ) decreased compared with that of the control group.

Histamine in serum of the KJHT group (400 / ) decreased compared with that of the control group.

Conclusions: These results suggest that KJHT can be utilized effectively in treating asthma because it significantly reduces inflammatory cells and cytokines.

Key Words : Asthma, Kamijihwang-tang (KJHT), immune cells, cytokine

2008 1 7 2008 3 24

, 173-9

1

(Tel:+82-43-229-3704, Fax:+82-43-253-8757, E-mail:omdpyc@dju.kr)

加味地黃湯

나도균, 박양춘

Original Article

, IgE

, ,

2,3) . ,

,

3) .

4,5) ,

6,7) 8,9)

. ¹⁰⁾

.

11)

CD4 ⁺ , CD8 ⁺ .

CD3 ⁺ , CD3e ^- /CCR3 ⁺ , CD3e ⁺ /CD69 ⁺ , CD4 ⁺ /CD25 ⁺ , B220 ⁺ /IgE ⁺ , CD3e ⁺ /DX5 ⁺ , histamine, IL-5, IL-13, TNF-α, eotaxin-2 mRNA

.

재료와 방법

1.

재료 1)

18-25g C57BL/6( , Korea) 2

.

구성약물 생약명 용량(g)

熟地黃 Rehmanniae Radix Preparat 12

山 藥 Dioscoreae Rhizoma 6

山茱萸 Corni Fructus 6

澤 瀉 Alismatis Rhizoma 4

牧丹皮 Moutan Cortex 4

白茯 Poria 4

麻 黃 Ephedrae Herba 4

杏 仁 Armeniacae Amarum Semen 4

甘 草 Glycyrrhizae Radix 4

沙 蔘 Adenophorae Radix 6

角子 Gleditsiae Spina 4

黃 芩 Scutellariae Radix 4

款冬花 Farfarae Flos 4

山 肉 Crataegii Fructus 6

桑白皮 Mori Cortex 4

生 薑 Zingiberis Rhizoma Recens 6

牛膽南星 Arisaematis Rhizoma 4

Total amount 76

Table 1.

2)

(Kamijihwang-tang, KJHT)

, 1

(Table 1).

2.

방법 1)

KJHT 4 2,000

3

(B-480, BUCHI, Switzerland)

, (FDU-540, EYELA,

Japan) 18.5 g .

KJHT (-84 )

. 2)

500 / (OVA, chicken egg oval- bumin; Grade IV) 10% (w/v) aluminum potassium

sulfate(Alum) PBS pH

6.5 750 × g 5

. OVA/ Alum

, 100 OVA 0.2

. 4

, (500 / ) 100 . 5

2.5 / 30

3 8

. (wild type) PBS

Alum ,

. 3)

OVA/Alum 4 KJHT

(400, 200 / ) 5

. .

4)

(Normal), (Control), cycrospolin A 10 /

(CsA), 400 /

KJHT 400 / , 200 /

KJHT 200 / .

5) ,

OVA ethyl ether

, (peripheral lymph node;

PLN), buffered ammonium

chloride(ACK) 37oC 5

. 0.04% trypan blue

. 6)

, ,

, ,

5 × 10 ⁵ 4

(immunofluorescence staining) . PE-anti-CD3e, PE-anti-CCR3, PE-anti-CD25, FITC-anti-CD69, PE-anti-B220, FITC- anti-IgE, PE-anti-DX5, PE-anti-NK 30

. 3

flow cytometer

Cell Quest CD4 ⁺ /CD25 ⁺ ,

B220 ⁺ /IgE ⁺ , CD3e ^- /CCR3 ⁺ , CD3e ⁺ /CD69 ⁺ , CD3e ⁺ /

DX5 ⁺ (%)

(absolute number) .

7) ELISA Analysis

histamine ELISA kit (R&D system)

.

8)

RNA diethyl pyrocarbonate(DEPC)

20 heating block 75

first strand cDNA . (reverse transcription) total RNA 3 DNase I (10 U/ ) 2 U/tube 37 heating block 30

75 10 , 2.5

10 mM dNTPs mix, 1 random sequence hexanucleotides (25 pmole/ 25 ), RNA inhibitor

1 RNase inhibitor (20 U/ ), 1 100 mM DTT, 4.5 5 × RT buffer(250 mM Tris- HCl, pH 8.3, 375 mM KCl, 15 mM Cl 2 )

, 1 M-MLV RT (200 U/ )

DEPC 20

. 20 2,000 rpm 5 37 heating block 60

first-strand cDNA , 95 5

M-MLV RT ,

cDNA polymerase chain reaction (PCR) . Real time quantitative RT-

PCR Applied Biosystems(USA) 7500 Fast

Real-Time PCR system .

primers .

SYBR Green PCR Master mix(ABI) , internal

standard G3PDH , primer

200 nM . Real time

quantitative PCR Pre-denaturation 2 min at 50 , 10 min 94 , 40 cycles 0.15 min at 95 , 1 min at 60 .

9)

mean ± standard

error , Student's T-test

.

결 과

1. CD3

⁺ 세포수에 미치는 영향 , PLN

CD3 ⁺ , PLN

KJHT 400 / 200 /

mouse IL-5

sence 5' agcctaaccctgttggaggt 3' anti- sence 5' gtgatcggcttttcttgagc 3'

mouse IL-13

sence 5' atgcccaacaaagcagagac 3' anti- sence 5' tgagagaaccagggagctgt 3'

mouse TNF-alpha

sence 5' tgggaggaaaggggtctaag 3' anti- sence 5' acctacgacgtgggctacag 3'

Mouse eotaxin-2

sence 5' ctgtgaccatcccctcatct 3' anti- sence 5' cttatggcccttcttggtga 3'

glyceraldehyde-3-phosphate dehydrogenase (G3PDH)

sence 5' tgcgctctagaaaaacctgccaa 3'

anti- sence 5' gccccaggctcaaaggtg 3'

Table 2.

(p < 0.001)

, KJHT 400 /

(p < 0.01) (Table 3).

2. CD3e

^-

⁺ 세포수에 미치는 영향 , PLN

CD3e ^- /CCR3 ⁺ ,

KJHT 400 / 200 /

(p < 0.001)

, PLN KJHT 400 / 200

/ (p < 0.001, p

< 0.01) , KJHT

400 / (p < 0.01)

(Table 4).

3. CD3e

⁺

⁺ 세포수에 미치는 영향 , PLN

CD3e ⁺ /CD69 ⁺ ,

KJHT 400 / 200 /

(p < 0.001, p < 0.01) , PLN KJHT 400 /

200 / (p <

0.001, p < 0.05) ,

KJHT 400 / 200 /

CD3e

/CCR3

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

) 1.5 ± 0.1 10.4 ± 1.5 3.5 ± 0.1

2.8 ± 0.1

5.1 ± 1.5

PLN (×10

) 1.6 ± 0.0 8.2 ± 0.6 3.5 ± 10.3

4.5 ± 0.5

5.5 ± 0.7

Spleen (×10

) 1.3 ± 0.3 3.8 ± 0.9 1.9 ± 0.0

1.7 ± 0.3

1.9 ± 0.7 C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3e

/CCR3

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 4.

CD3

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

) 4.8 ± 0.4 38.7 ± 0.2 14.1 ± 0.1

12.7 ± 1.5

18.2 ± 4.5

PLN (×10

) 40.7 ± 1.1 83.7 ± 2.2 55.8 ± 10.0

57.2 ± 2.8

53.8 ± 4.5

Spleen (×10

) 53.6 ± 5.9 69.2 ± 4.2 46.6 ± 2.1

49.2 ± 5.2

51.0 ± 10.1 C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3

T cells were analyzed by flow cytometer. The results are expressed the mean ± S.E. Statistically significant value compared with control group data by T test (** p < 0.01, *** p < 0.001).

Table 3.

(p < 0.01) (Table 5).

4. CD4

⁺

⁺ 세포수에 미치는 영향 , PLN

CD4 ⁺ /CD25 ⁺ ,

KJHT 400 / 200 /

(p < 0.01, p < 0.001) , PLN KJHT 400 /

200 / (p <

0.001, p < 0.05) ,

KJHT 400 / 200 /

(p < 0.001, p < 0.01) (Table 6).

5. B220

⁺

⁺ 세포수에 미치는 영향 , PLN

B220 ⁺ /IgE ⁺ ,

KJHT 400 / 200 /

(p < 0.001, p < 0.01) , PLN KJHT 400 /

(p < 0.01)

CD4

/CD25

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

) 0.7 ± 0.1 0.9 ± 0.4 1.3 ± 0.0

1.7 ± 0.2

2.2 ± 0.2

PLN (×10

) 2.8 ± 0.5 2.0 ± 0.6 3.8 ± 0.1

4.9 ± 0.2

3.4 ± 0.5

Spleen (×10

) 0.9 ± 0.0 0.3 ± 0.2 0.7 ± 0.2 1.2 ± 0.2

1.7 ± 0.6

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN, and spleen were removed and CD4

/CD25

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 6.

CD3e

/CD69

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

) 0.4 ± 0.1 5.8 ± 0.3 2.4 ± 0.0

1.4 ± 0.6

3.3 ± 0.7

PLN (×10

) 2.3 ± 0.3 10.1 ± 1.3 4.7 ± 2.2

3.0 ± 0.3

5.2 ± 0.4

Spleen (×10

) 1.5 ± 0.2 5.1 ± 0.1 2.0 ± 0.6

3.0 ± 0.6

3.2 ± 0.5

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3e

/CD69

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 5.

, KJHT 400 / 200

/ (p < 0.05)

(Table 7).

6. CD3e

⁺

⁺ 세포수에 미치는 영향 , PLN

CD3e ⁺ /DX5 ⁺ ,

KJHT 400 / 200 /

(p < 0.01, p < 0.05) , PLN KJHT 400 /

200 / (p <

0.01, p < 0.001) ,

KJHT 400 / 200 /

(p < 0.001) (Table 8).

7.

폐조직에서의 사이토카인 유전자 발현에 미치

는 영향

RNA

, IL-5, IL-13, Eotaxin-2, B220

/IgE

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

) 0.6 ± 0.1 10.3 ± 0.5 3.2 ± 1.3

1.9 ± 0.0

4.4 ± 1.9

PLN (×10

) 0.3 ± 0.2 6.7 ± 1.7 1.8 ± 0.2

1.3 ± 0.2

5.9 ± 1.9 Spleen (×10

) 1.7 ± 0.2 7.7 ± 1.6 3.2 ± 0.5

3.1 ± 0.7

4.2 ± 0.4

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and B220

/IgE

B cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 7.

CD3e

/DX5

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

) 0.2 ± 0.1 2.7 ± 0.6 0.8 ± 0.1

0.5 ± 0.2

1.0 ± 0.2

PLN (×10

) 1.4 ± 0.0 5.0 ± 0.7 1.6 ± 0.8

2.2 ± 0.3

2.0 ± 0.1

Spleen (×10

) 0.9 ± 0.3 4.9 ± 0.5 1.5 ± 0.0

1.5 ± 0.4

2.0 ± 0.1

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3e

/DX5

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 8.

TNF-α RQ

(Fig. 1).

8. Histamine

생성에 미치는 영향 serum

hista-

mine , 4.4 ±

101 (μM), 19.3 ± 3.1 (μM), (CsA) 8.7 ± 2.2 (μM), KJHT 400 /

9.8 ± 2.1 (μM), 200 / 14.6 ±

3.4 (μM) , KJHT 400

/ (p < 0.01)

(Fig 2).

고 찰

, , T

12) .

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue 0.008

1.000

0.176 0.138 0.418 IL-5 mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue _0.041

1.000

0.309

0.442 0.511 IL-13 mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue 0.031

1.000

0.178 0.198 0.399 Eotaxin2 mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue ^0.109

1.000

0.647 0.491

0.628 TNF-α mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

Fig. 1.

, , , T ,

, ,

.

13) . T

(T helper : Th ) Th1 Th2

Th2 IL-4, IL-5, IL-6, IL-9, IL-13

, IL-4 B

IgE , Th1

IFN-γ, IL-2 ,

cytotoxic T

.

Th1

Th2 , Th2

Th1 ¹⁴⁾ .

(dendritic cell)

Th0 Th2 IL-3, IL-4, IL-5,

IL-13 .

IgE

15) .

CD34 ⁺

IgE

histamine, leukotrien

16) . tryptase, chymase, proteoglycan IL-1, IL-2, IL-3, IL-4, IL-5, GM-CSF, IFN-γ, TNF-α .

17) .

, ,

18) .

(apoptosis) major

basic protein(MBP), eosinophil cationic protein(ECP), eosinophil derived neurotoxin(EDN), eosinophil

25 20

15

10

5

0

H is ta m in e re le as e in s eru m ( M )

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

** **

Fig. 2.

peroxidase(EPO)

.

arachidonic acid, leukotrien C4(LTC4), (platelet activating factor, PAF)

19) .

T

T

20) .

low affinity IgE

receptor IL-1,

TNF-α, IL-6

. GM-CSF,

IL-8, RANTES

21) . PD-GF, TGF-β

myofibroblast ,

22) .

,

, ,

, , , ,

1,23)

.

, ,

, ,

1) .

10) ,

, , , , ,

, ,

, , ,

, , ,

24)

11)

CD4, CD8 .

400 / 200

/ 8 CD3 ⁺ , CD3e ⁺ /19 ⁺ ,

CD3e ^- /CCR3 ⁺ , CD3e ⁺ /CD69 ⁺ , CD4 ⁺ /CD25 ⁺ , CD4 ⁺ , CD8 ⁺ , B220 ⁺ /IgE ⁺ , CD3e ⁺ /DX5 ⁺ , histamine, IL-5, IL-13, TNF-α, eotaxin-2

mRNA ,

.

, , CD3 ⁺ , CD3e ^- /CCR3 ⁺ , CD3e ⁺ /CD69 ⁺ , CD4 ⁺ /CD25 ⁺ , B220 ⁺ /IgE ⁺ , CD3e ⁺ /

DX5 ⁺ ,

400 / CD3 ⁺ ,

CD3e ^- /CCR3 ⁺ , CD3e ⁺ /CD69 ⁺ , CD4 ⁺ /CD25 ⁺ , B220 ⁺ / IgE ⁺ , CD3e ⁺ /DX5 ⁺

,

200 / CD3e ⁺ /

CD69 ⁺ , CD4 ⁺ /CD25 ⁺ , CD3e ⁺ /DX5 ⁺

, CD3 ⁺ , CD3e ^- /CCR3 ⁺

, B220 ⁺ /IgE ⁺

(Table 3-8).

CD3 T CD69

B T ,

T ,

25) . CD3 ⁺ , CD3e ⁺ /CD69 ⁺

T

.

, eotaxin

. CCR3

26) . CCR3

27) CD3e ^- /CCR3 ⁺

.

CD25 T B

CD4 ⁺ /CD25 ⁺ Th2

IL-4, IL-5, IL-13 mRNA , CD4 ⁺ /CD25 ⁺

Th2

28) . CD4 ⁺ /CD25 ⁺

Th2 type

.

B IgE

,

IgE

1 ²⁹⁾ .

B220 ⁺ /IgE ⁺

IgE

.

CD3e ⁺ /DX5 ⁺ T NK

marker NK-T

,

, ,

30) . CD3e ⁺ /DX5 ⁺

NK-T

. RT-PCR IL-5, IL-13, TNF-α, eotaxin-2

mRNA IL-5, IL-

13, eotaxin-2, TNF-α

(Fig. 1).

IL-5 IL-4 B

, , ,

31) . IL-13 B Th2

IL-4 25%

. IL-13 B ,

integrin, MHC class CD23

, IL-6 , class switching

IgE IgG4 . IL-13

VCAM-1

32) . Eotaxin-2 eotaxin 39%

(7q11) eotaxin

migration ³³⁾ .

TNF-α

adhesion molecules ,

,

34) . Th2

IL-5, IL-13 ,

eotaxin-2, TNF-α

.

ELISA , histamine

(P<0.05)

(Fig. 2). Histamine

, , ,

19)

histamine

.

, ,

.

결 론

.

1. 400 /

, ,

CD3 ⁺ , CD3e ^- /CCR3 ⁺ , CD3e ⁺ / CD69 ⁺ , CD4 ⁺ /CD25 ⁺ , B220 ⁺ /IgE ⁺ , CD3e ⁺ /DX5 ⁺

.

2. 200 /

, ,

CD3e ⁺ /CD69 ⁺ , CD4 ⁺ / CD25 ⁺ , CD3e ⁺ /DX5 ⁺

, CD3 ⁺ , CD3e ^- / CCR3 ⁺

, B220 ⁺ /IgE ⁺

.

3. IL-5, IL-13, eotaxin-2, TNF-α

.

4. histamine

400 / , 200 /

.

참고문헌

1. .

. : . 2002:329-31.

2. , . - :

. .

: , pp.244-245, 2002.

3. Muro S, Minshal EM, Hamid QA. The patho- logy of chronic asthma. Clin Chest Med. 2000;

21(2):225-44.

4. Ko E, Rho S, Cho C, Choi H, Ko S, Lee Y, Hong MC, Shin MK, Jung SG, Bae H.

So-Cheong-Ryong-Tang, traditional Korean medicine, suppresses Th2 lineage development.

Biol Pharm Bull, 2004;27(5):739-43.

5. , . B anti-CD40

rIL-4 Cytokine IgE,

Histamine .

. 2004;25(2):245-57.

6. , , , .

Allergy

BALF IgE

. . 2003;24(3):1-10.

7. , . (Glycyrrhiza uralensis

Fisch, GLU) BALF

Cytokine .

. 2004;25(3):408-17.

8. , , , , ,

, .

. . 2004;25(2):110-8.

9. , , , , ,

, , .

. . 2004;25

(3):379-87.

10. . . :

. 1983:5-6.

11. , .

CD4, CD8 .

. 2007;21(2):438-3.

12. . : .

. : . 2004:317-47.

13. Haley KJ, Sunday ME, Wiggs BR, Kozak- ewich HP, Reilly JJ, Mentzer SJ, Sugarbaker DJ, Doerschuk CM, Drazen JM. Inflammatory cell distribution within and along asthmatic airways. Am J Respir Crit Care Med. 1998;

158(2):565-72.

14. Schwartz RS. A new element in the mechanism of asthma. N Engl J Med. 2002;346(11):857-8.

15. National Asthma Education and Prevention Program. Guidelines for the diagnosis and management of asthma. Bethesda MD, Nati- onal Heart, Lung, and Blood Institute, National Institutes of Health, 2004.

16. Siraganian RP. Biochemical events in basophil or mast cell activation and mediator release. In:

Middleton E Jr, Reed CE, Ellis EF, Adkinson NF Jr, Yunginger JW, Busse WW, eds.

Allergy: principles & practice. 5th ed. Vol. 1.

St. Luis:Mosby-Year Book, 1998:204-7.

17. Clark JM, Abraham WM, Fishman CE, Forteza R, Ahmed A, Cortes A, Warne RL, Moore WR, Tanaka RD. Tryptase inhibitors block allergen- induced airway and inflammatory responses in allergic sheep. Am J Respir Crit Care Med.

1995;152(6 Pt 1):2076-83.

18. . . .

1999;46(1):5-16.

19. , , , , .

:

. . :

. 2002:34-8.

20. Spiteri MA, Knight RA, Jeremy JY, Barnes PJ, Chung KF. Alveolar macrophage-induced suppression of peripheral blood mononuclear cell responsiveness is reversed by in vitro allergen exposure in bronchial asthma. Eur Respir J. 1994;7(8):1431-8.

21. Chung KF, Barnes PJ. Cytokines in asthma.

Thorax. 1999;54(9):825-57.

22. Brewster CE, Howarth PH, Djukanovic R, Wilson J, Holgate ST, Roche WR. Myofibr- oblasts and subepithelial fibrosis in bronchial asthma. Am J Respir Cell Mol Biol. 1990;

3(5):507-11.

23. , .

. . 1986;7(1):60-7.

24. . . :

, 1991:121-588.

25. Hartnell A, Robinson DS, Kay AB, Wardlaw AJ. CD69 is expressed by human eosinophils activated in vivo in asthma and in vitro by cytokines. Immunology, 1993;80(2):281-6.

26. Murdoch C, Finn A. Chemokine receptors and their role in inflammation and infectious diseases. Blood, 2000;95(10):3032-43.

27. Gangur V, Birmingham NP, Thanesvorakul S, Joseph S. CCR3 and CXCR3 as drug targets for allergy: principles and potential. Curr Drug Targets Inflamm Allergy, 2004;2(1):53-62.

28. Jaffar Z, Sivakuru T, Roberts K. CD4 ⁺ CD25 ⁺

T cells regulate airway eosinophilic inflam-

mation by modulating the Th2 cell phenotype.

J Immunol. 2004;172(6):3842-9.

29. . IgE . .

1993;13:460-4.

30. Mercer JC, Ragin MJ, August A. Natural killer T cells: rapid responders controlling immunity and disease. Int J Biochem Cell Biol. 2005;

37(7):1337-43.

31. Hamelmann E, Gelfand EW. IL-5-induced airway eosinophilia-the key to asthma? Immunol Rev, 2001;179:182-91.

32. .

IL-13 .

. 1999;19(1):31-41.

33. Forssmann U, Uguccioni M, Loetscher P, Dahinden CA, Langen H, Thelen M, Bagg- iolini M. Eotaxin-2, a novel CC chemokine that is selective for the chemokine receptor CCR3, and acts like eotaxin on human eosinophil and basophil leukocytes. J Exp Med. 1997;185(12) :2171-6.

34. Thomas PS. Tumour necrosis factor-alpha: the role of this multifunctional cytokine in asthma.

Immunol Cell Biol. 2001;79(2):132-40.