• 검색 결과가 없습니다.

Effects of Kamijihwang-tang on Immune Cells and Cytokines in OVA-induced Asthmatic Mice

N/A
N/A
Protected

Academic year: 2021

Share "Effects of Kamijihwang-tang on Immune Cells and Cytokines in OVA-induced Asthmatic Mice"

Copied!
14
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

서 론

( )

1) .

, ,

1) .

Effects of Kamijihwang-tang on Immune Cells and Cytokines in OVA-induced Asthmatic Mice

Do-Gyun Rah, Yang-Chun Park

Division of Respiratory System, Dept. of Internal Medicine, College of Oriental Medicine, Daejeon University

Objectives: The purpose of this study wasto examine the effects of Kamijihwang-tang (KJHT) extracts on immune cells and cytokines in ovalbumin (OVA)-induced asthmatic mice.

Methods: C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks (four times a week) for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 / and 200 / ) extracts and cyclosporine A (10 / ) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and immune cells were analyzed by flow cytometer, IL-5, IL-13, eotaxin-2, TNF-α were analyzed by real-time PCR, serum histamine was analyzed by ELISA kit.

Results: CD3

+

, CD3e

-

/CCR3

+

, CD3e

+

/CD69

+

, CD4

+

/CD25

+

, B220

+

/IgE

+

, and CD3e

+

/DX5

+

cells in lung, PLN, and spleen of the KJHT group (400 / ) decreased compared with that of the control group. CD3e

+

/CD69

+

, CD4

+

/CD25

+

, and CD3e

+

/DX5

+

cells in lung, PLN, and spleen of the KJHT group (200 / ), CD3

+

, CD3e

-

/CCR3

+

cells in lung and PLN of the KJHT group (200 / ) and B220

+

/IgE

+

cells in lung and spleen of the KJHT group (200 / ) decreased compared with that of the control group. mRNA expression of IL-5, IL-13, eotaxin-2, and TNF- α in lung tissue of the KJHT groups (400 / and 200 / ) decreased compared with that of the control group.

Histamine in serum of the KJHT group (400 / ) decreased compared with that of the control group.

Conclusions: These results suggest that KJHT can be utilized effectively in treating asthma because it significantly reduces inflammatory cells and cytokines.

Key Words : Asthma, Kamijihwang-tang (KJHT), immune cells, cytokine

2008 1 7 2008 3 24

, 173-9

1

(Tel:+82-43-229-3704, Fax:+82-43-253-8757, E-mail:[email protected])

加味地黃湯

나도균, 박양춘

Original Article

(2)

, IgE

, ,

2,3) . ,

,

3) .

4,5) ,

6,7) 8,9)

. 10)

.

11)

CD4 + , CD8 + .

CD3 + , CD3e - /CCR3 + , CD3e + /CD69 + , CD4 + /CD25 + , B220 + /IgE + , CD3e + /DX5 + , histamine, IL-5, IL-13, TNF-α, eotaxin-2 mRNA

.

재료와 방법

1.

재료 1)

18-25g C57BL/6( , Korea) 2

.

구성약물 생약명 용량(g)

熟地黃 Rehmanniae Radix Preparat 12

山 藥 Dioscoreae Rhizoma 6

山茱萸 Corni Fructus 6

澤 瀉 Alismatis Rhizoma 4

牧丹皮 Moutan Cortex 4

白茯 Poria 4

麻 黃 Ephedrae Herba 4

杏 仁 Armeniacae Amarum Semen 4

甘 草 Glycyrrhizae Radix 4

沙 蔘 Adenophorae Radix 6

角子 Gleditsiae Spina 4

黃 芩 Scutellariae Radix 4

款冬花 Farfarae Flos 4

山 肉 Crataegii Fructus 6

桑白皮 Mori Cortex 4

生 薑 Zingiberis Rhizoma Recens 6

牛膽南星 Arisaematis Rhizoma 4

Total amount 76

Table 1.

(3)

2)

(Kamijihwang-tang, KJHT)

, 1

(Table 1).

2.

방법 1)

KJHT 4 2,000

3

(B-480, BUCHI, Switzerland)

, (FDU-540, EYELA,

Japan) 18.5 g .

KJHT (-84 )

. 2)

500 / (OVA, chicken egg oval- bumin; Grade IV) 10% (w/v) aluminum potassium

sulfate(Alum) PBS pH

6.5 750 × g 5

. OVA/ Alum

, 100 OVA 0.2

. 4

, (500 / ) 100 . 5

2.5 / 30

3 8

. (wild type) PBS

Alum ,

. 3)

OVA/Alum 4 KJHT

(400, 200 / ) 5

. .

4)

(Normal), (Control), cycrospolin A 10 /

(CsA), 400 /

KJHT 400 / , 200 /

KJHT 200 / .

5) ,

OVA ethyl ether

, (peripheral lymph node;

PLN), buffered ammonium

chloride(ACK) 37oC 5

. 0.04% trypan blue

. 6)

, ,

, ,

5 × 10 5 4

(immunofluorescence staining) . PE-anti-CD3e, PE-anti-CCR3, PE-anti-CD25, FITC-anti-CD69, PE-anti-B220, FITC- anti-IgE, PE-anti-DX5, PE-anti-NK 30

. 3

flow cytometer

Cell Quest CD4 + /CD25 + ,

B220 + /IgE + , CD3e - /CCR3 + , CD3e + /CD69 + , CD3e + /

DX5 + (%)

(absolute number) .

7) ELISA Analysis

histamine ELISA kit (R&D system)

.

(4)

8)

RNA diethyl pyrocarbonate(DEPC)

20 heating block 75

first strand cDNA . (reverse transcription) total RNA 3 DNase I (10 U/ ) 2 U/tube 37 heating block 30

75 10 , 2.5

10 mM dNTPs mix, 1 random sequence hexanucleotides (25 pmole/ 25 ), RNA inhibitor

1 RNase inhibitor (20 U/ ), 1 100 mM DTT, 4.5 5 × RT buffer(250 mM Tris- HCl, pH 8.3, 375 mM KCl, 15 mM Cl 2 )

, 1 M-MLV RT (200 U/ )

DEPC 20

. 20 2,000 rpm 5 37 heating block 60

first-strand cDNA , 95 5

M-MLV RT ,

cDNA polymerase chain reaction (PCR) . Real time quantitative RT-

PCR Applied Biosystems(USA) 7500 Fast

Real-Time PCR system .

primers .

SYBR Green PCR Master mix(ABI) , internal

standard G3PDH , primer

200 nM . Real time

quantitative PCR Pre-denaturation 2 min at 50 , 10 min 94 , 40 cycles 0.15 min at 95 , 1 min at 60 .

9)

mean ± standard

error , Student's T-test

.

결 과

1. CD3

+ 세포수에 미치는 영향 , PLN

CD3 + , PLN

KJHT 400 / 200 /

mouse IL-5

sence 5' agcctaaccctgttggaggt 3' anti- sence 5' gtgatcggcttttcttgagc 3'

mouse IL-13

sence 5' atgcccaacaaagcagagac 3' anti- sence 5' tgagagaaccagggagctgt 3'

mouse TNF-alpha

sence 5' tgggaggaaaggggtctaag 3' anti- sence 5' acctacgacgtgggctacag 3'

Mouse eotaxin-2

sence 5' ctgtgaccatcccctcatct 3' anti- sence 5' cttatggcccttcttggtga 3'

glyceraldehyde-3-phosphate dehydrogenase (G3PDH)

sence 5' tgcgctctagaaaaacctgccaa 3'

anti- sence 5' gccccaggctcaaaggtg 3'

Table 2.

(5)

(p < 0.001)

, KJHT 400 /

(p < 0.01) (Table 3).

2. CD3e

-

/CCR3

+ 세포수에 미치는 영향 , PLN

CD3e - /CCR3 + ,

KJHT 400 / 200 /

(p < 0.001)

, PLN KJHT 400 / 200

/ (p < 0.001, p

< 0.01) , KJHT

400 / (p < 0.01)

(Table 4).

3. CD3e

+

/CD69

+ 세포수에 미치는 영향 , PLN

CD3e + /CD69 + ,

KJHT 400 / 200 /

(p < 0.001, p < 0.01) , PLN KJHT 400 /

200 / (p <

0.001, p < 0.05) ,

KJHT 400 / 200 /

CD3e

-

/CCR3

+

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

5.

) 1.5 ± 0.1 10.4 ± 1.5 3.5 ± 0.1

***

2.8 ± 0.1

***

5.1 ± 1.5

**

PLN (×10

5.

) 1.6 ± 0.0 8.2 ± 0.6 3.5 ± 10.3

***

4.5 ± 0.5

***

5.5 ± 0.7

*

Spleen (×10

6.

) 1.3 ± 0.3 3.8 ± 0.9 1.9 ± 0.0

*

1.7 ± 0.3

**

1.9 ± 0.7 C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3e

-

/CCR3

+

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 4.

CD3

+

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

5.

) 4.8 ± 0.4 38.7 ± 0.2 14.1 ± 0.1

***

12.7 ± 1.5

***

18.2 ± 4.5

***

PLN (×10

5.

) 40.7 ± 1.1 83.7 ± 2.2 55.8 ± 10.0

**

57.2 ± 2.8

***

53.8 ± 4.5

***

Spleen (×10

6.

) 53.6 ± 5.9 69.2 ± 4.2 46.6 ± 2.1

***

49.2 ± 5.2

**

51.0 ± 10.1 C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3

+

T cells were analyzed by flow cytometer. The results are expressed the mean ± S.E. Statistically significant value compared with control group data by T test (** p < 0.01, *** p < 0.001).

Table 3.

(6)

(p < 0.01) (Table 5).

4. CD4

+

/CD25

+ 세포수에 미치는 영향 , PLN

CD4 + /CD25 + ,

KJHT 400 / 200 /

(p < 0.01, p < 0.001) , PLN KJHT 400 /

200 / (p <

0.001, p < 0.05) ,

KJHT 400 / 200 /

(p < 0.001, p < 0.01) (Table 6).

5. B220

+

/IgE

+ 세포수에 미치는 영향 , PLN

B220 + /IgE + ,

KJHT 400 / 200 /

(p < 0.001, p < 0.01) , PLN KJHT 400 /

(p < 0.01)

CD4

+

/CD25

+

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

5.

) 0.7 ± 0.1 0.9 ± 0.4 1.3 ± 0.0

***

1.7 ± 0.2

**

2.2 ± 0.2

***

PLN (×10

5.

) 2.8 ± 0.5 2.0 ± 0.6 3.8 ± 0.1

**

4.9 ± 0.2

***

3.4 ± 0.5

*

Spleen (×10

6.

) 0.9 ± 0.0 0.3 ± 0.2 0.7 ± 0.2 1.2 ± 0.2

***

1.7 ± 0.6

*

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN, and spleen were removed and CD4

+

/CD25

+

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 6.

CD3e

+

/CD69

+

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

5.

) 0.4 ± 0.1 5.8 ± 0.3 2.4 ± 0.0

***

1.4 ± 0.6

***

3.3 ± 0.7

***

PLN (×10

5.

) 2.3 ± 0.3 10.1 ± 1.3 4.7 ± 2.2

*

3.0 ± 0.3

***

5.2 ± 0.4

**

Spleen (×10

6.

) 1.5 ± 0.2 5.1 ± 0.1 2.0 ± 0.6

***

3.0 ± 0.6

**

3.2 ± 0.5

**

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3e

+

/CD69

+

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 5.

(7)

, KJHT 400 / 200

/ (p < 0.05)

(Table 7).

6. CD3e

+

/DX5

+ 세포수에 미치는 영향 , PLN

CD3e + /DX5 + ,

KJHT 400 / 200 /

(p < 0.01, p < 0.05) , PLN KJHT 400 /

200 / (p <

0.01, p < 0.001) ,

KJHT 400 / 200 /

(p < 0.001) (Table 8).

7.

폐조직에서의 사이토카인 유전자 발현에 미치

는 영향

RNA

, IL-5, IL-13, Eotaxin-2, B220

+

/IgE

+

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

5.

) 0.6 ± 0.1 10.3 ± 0.5 3.2 ± 1.3

***

1.9 ± 0.0

***

4.4 ± 1.9

**

PLN (×10

5.

) 0.3 ± 0.2 6.7 ± 1.7 1.8 ± 0.2

**

1.3 ± 0.2

**

5.9 ± 1.9 Spleen (×10

6.

) 1.7 ± 0.2 7.7 ± 1.6 3.2 ± 0.5

**

3.1 ± 0.7

*

4.2 ± 0.4

*

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and B220

+

/IgE

+

B cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 7.

CD3e

+

/DX5

+

absolute cell number

WT Control CsA KJHT-400 KJHT-200

Lung (×10

5

) 0.2 ± 0.1 2.7 ± 0.6 0.8 ± 0.1

***

0.5 ± 0.2

**

1.0 ± 0.2

*

PLN (×10

5

) 1.4 ± 0.0 5.0 ± 0.7 1.6 ± 0.8

**

2.2 ± 0.3

**

2.0 ± 0.1

***

Spleen (×10

6.

) 0.9 ± 0.3 4.9 ± 0.5 1.5 ± 0.0

***

1.5 ± 0.4

***

2.0 ± 0.1

***

C57BL/6 mice were injected, inhaled and sprayed with OVA for 12 weeks for asthma induction. Two experimental groups were treated with different concentrations of KJHT (400 ㎎/㎏ and 200 ㎎/㎏) extracts and cyclosporine A (10 ㎎/㎏) for the later 8 weeks. At the end of the experiment, the mice lung, PLN and spleen were removed and CD3e

+

/DX5

+

cells were analyzed by flow cytometer. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (* p < 0.05, ** p < 0.01, *** p

< 0.001).

Table 8.

(8)

TNF-α RQ

(Fig. 1).

8. Histamine

생성에 미치는 영향 serum

hista-

mine , 4.4 ±

101 (μM), 19.3 ± 3.1 (μM), (CsA) 8.7 ± 2.2 (μM), KJHT 400 /

9.8 ± 2.1 (μM), 200 / 14.6 ±

3.4 (μM) , KJHT 400

/ (p < 0.01)

(Fig 2).

고 찰

, , T

12) .

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue 0.008

1.000

0.176 0.138 0.418 IL-5 mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue 0.041

1.000

0.309

0.442 0.511 IL-13 mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue 0.031

1.000

0.178 0.198 0.399 Eotaxin2 mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

1.2 1.0 0.8 0.6 0.4 0.2 0.0 R Q o f O VA - C T in lu ng ti ss ue 0.109

1.000

0.647 0.491

0.628 TNF-α mRNA

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

Fig. 1.

(9)

, , , T ,

, ,

.

13) . T

(T helper : Th ) Th1 Th2

Th2 IL-4, IL-5, IL-6, IL-9, IL-13

, IL-4 B

IgE , Th1

IFN-γ, IL-2 ,

cytotoxic T

.

Th1

Th2 , Th2

Th1 14) .

(dendritic cell)

Th0 Th2 IL-3, IL-4, IL-5,

IL-13 .

IgE

15) .

CD34 +

IgE

histamine, leukotrien

16) . tryptase, chymase, proteoglycan IL-1, IL-2, IL-3, IL-4, IL-5, GM-CSF, IFN-γ, TNF-α .

17) .

, ,

18) .

(apoptosis) major

basic protein(MBP), eosinophil cationic protein(ECP), eosinophil derived neurotoxin(EDN), eosinophil

25 20

15

10

5

0

H is ta m in e re le as e in s eru m ( M )

WT Control CsA 10mg/kg

KJHT 400mg/kg

KJHT 200mg/kg

OVA/Alum - + + + +

** **

Fig. 2.

(10)

peroxidase(EPO)

.

arachidonic acid, leukotrien C4(LTC4), (platelet activating factor, PAF)

19) .

T

T

20) .

low affinity IgE

receptor IL-1,

TNF-α, IL-6

. GM-CSF,

IL-8, RANTES

21) . PD-GF, TGF-β

myofibroblast ,

22) .

,

, ,

, , , ,

1,23)

.

, ,

, ,

1) .

10) ,

, , , , ,

, ,

, , ,

, , ,

24)

11)

CD4, CD8 .

400 / 200

/ 8 CD3 + , CD3e + /19 + ,

CD3e - /CCR3 + , CD3e + /CD69 + , CD4 + /CD25 + , CD4 + , CD8 + , B220 + /IgE + , CD3e + /DX5 + , histamine, IL-5, IL-13, TNF-α, eotaxin-2

mRNA ,

.

, , CD3 + , CD3e - /CCR3 + , CD3e + /CD69 + , CD4 + /CD25 + , B220 + /IgE + , CD3e + /

DX5 + ,

400 / CD3 + ,

CD3e - /CCR3 + , CD3e + /CD69 + , CD4 + /CD25 + , B220 + / IgE + , CD3e + /DX5 +

,

200 / CD3e + /

CD69 + , CD4 + /CD25 + , CD3e + /DX5 +

, CD3 + , CD3e - /CCR3 +

, B220 + /IgE +

(Table 3-8).

CD3 T CD69

B T ,

T ,

25) . CD3 + , CD3e + /CD69 +

T

.

(11)

, eotaxin

. CCR3

26) . CCR3

27) CD3e - /CCR3 +

.

CD25 T B

CD4 + /CD25 + Th2

IL-4, IL-5, IL-13 mRNA , CD4 + /CD25 +

Th2

28) . CD4 + /CD25 +

Th2 type

.

B IgE

,

IgE

1 29) .

B220 + /IgE +

IgE

.

CD3e + /DX5 + T NK

marker NK-T

,

, ,

30) . CD3e + /DX5 +

NK-T

. RT-PCR IL-5, IL-13, TNF-α, eotaxin-2

mRNA IL-5, IL-

13, eotaxin-2, TNF-α

(Fig. 1).

IL-5 IL-4 B

, , ,

31) . IL-13 B Th2

IL-4 25%

. IL-13 B ,

integrin, MHC class CD23

, IL-6 , class switching

IgE IgG4 . IL-13

VCAM-1

32) . Eotaxin-2 eotaxin 39%

(7q11) eotaxin

migration 33) .

TNF-α

adhesion molecules ,

,

34) . Th2

IL-5, IL-13 ,

eotaxin-2, TNF-α

.

ELISA , histamine

(P<0.05)

(12)

(Fig. 2). Histamine

, , ,

19)

histamine

.

, ,

.

결 론

.

1. 400 /

, ,

CD3 + , CD3e - /CCR3 + , CD3e + / CD69 + , CD4 + /CD25 + , B220 + /IgE + , CD3e + /DX5 +

.

2. 200 /

, ,

CD3e + /CD69 + , CD4 + / CD25 + , CD3e + /DX5 +

, CD3 + , CD3e - / CCR3 +

, B220 + /IgE +

.

3. IL-5, IL-13, eotaxin-2, TNF-α

.

4. histamine

400 / , 200 /

.

참고문헌

1. .

. : . 2002:329-31.

2. , . - :

. .

: , pp.244-245, 2002.

3. Muro S, Minshal EM, Hamid QA. The patho- logy of chronic asthma. Clin Chest Med. 2000;

21(2):225-44.

4. Ko E, Rho S, Cho C, Choi H, Ko S, Lee Y, Hong MC, Shin MK, Jung SG, Bae H.

So-Cheong-Ryong-Tang, traditional Korean medicine, suppresses Th2 lineage development.

Biol Pharm Bull, 2004;27(5):739-43.

5. , . B anti-CD40

rIL-4 Cytokine IgE,

Histamine .

. 2004;25(2):245-57.

6. , , , .

Allergy

BALF IgE

. . 2003;24(3):1-10.

7. , . (Glycyrrhiza uralensis

Fisch, GLU) BALF

Cytokine .

. 2004;25(3):408-17.

8. , , , , ,

(13)

, .

. . 2004;25(2):110-8.

9. , , , , ,

, , .

. . 2004;25

(3):379-87.

10. . . :

. 1983:5-6.

11. , .

CD4, CD8 .

. 2007;21(2):438-3.

12. . : .

. : . 2004:317-47.

13. Haley KJ, Sunday ME, Wiggs BR, Kozak- ewich HP, Reilly JJ, Mentzer SJ, Sugarbaker DJ, Doerschuk CM, Drazen JM. Inflammatory cell distribution within and along asthmatic airways. Am J Respir Crit Care Med. 1998;

158(2):565-72.

14. Schwartz RS. A new element in the mechanism of asthma. N Engl J Med. 2002;346(11):857-8.

15. National Asthma Education and Prevention Program. Guidelines for the diagnosis and management of asthma. Bethesda MD, Nati- onal Heart, Lung, and Blood Institute, National Institutes of Health, 2004.

16. Siraganian RP. Biochemical events in basophil or mast cell activation and mediator release. In:

Middleton E Jr, Reed CE, Ellis EF, Adkinson NF Jr, Yunginger JW, Busse WW, eds.

Allergy: principles & practice. 5th ed. Vol. 1.

St. Luis:Mosby-Year Book, 1998:204-7.

17. Clark JM, Abraham WM, Fishman CE, Forteza R, Ahmed A, Cortes A, Warne RL, Moore WR, Tanaka RD. Tryptase inhibitors block allergen- induced airway and inflammatory responses in allergic sheep. Am J Respir Crit Care Med.

1995;152(6 Pt 1):2076-83.

18. . . .

1999;46(1):5-16.

19. , , , , .

:

. . :

. 2002:34-8.

20. Spiteri MA, Knight RA, Jeremy JY, Barnes PJ, Chung KF. Alveolar macrophage-induced suppression of peripheral blood mononuclear cell responsiveness is reversed by in vitro allergen exposure in bronchial asthma. Eur Respir J. 1994;7(8):1431-8.

21. Chung KF, Barnes PJ. Cytokines in asthma.

Thorax. 1999;54(9):825-57.

22. Brewster CE, Howarth PH, Djukanovic R, Wilson J, Holgate ST, Roche WR. Myofibr- oblasts and subepithelial fibrosis in bronchial asthma. Am J Respir Cell Mol Biol. 1990;

3(5):507-11.

23. , .

. . 1986;7(1):60-7.

24. . . :

, 1991:121-588.

25. Hartnell A, Robinson DS, Kay AB, Wardlaw AJ. CD69 is expressed by human eosinophils activated in vivo in asthma and in vitro by cytokines. Immunology, 1993;80(2):281-6.

26. Murdoch C, Finn A. Chemokine receptors and their role in inflammation and infectious diseases. Blood, 2000;95(10):3032-43.

27. Gangur V, Birmingham NP, Thanesvorakul S, Joseph S. CCR3 and CXCR3 as drug targets for allergy: principles and potential. Curr Drug Targets Inflamm Allergy, 2004;2(1):53-62.

28. Jaffar Z, Sivakuru T, Roberts K. CD4 + CD25 +

T cells regulate airway eosinophilic inflam-

mation by modulating the Th2 cell phenotype.

(14)

J Immunol. 2004;172(6):3842-9.

29. . IgE . .

1993;13:460-4.

30. Mercer JC, Ragin MJ, August A. Natural killer T cells: rapid responders controlling immunity and disease. Int J Biochem Cell Biol. 2005;

37(7):1337-43.

31. Hamelmann E, Gelfand EW. IL-5-induced airway eosinophilia-the key to asthma? Immunol Rev, 2001;179:182-91.

32. .

IL-13 .

. 1999;19(1):31-41.

33. Forssmann U, Uguccioni M, Loetscher P, Dahinden CA, Langen H, Thelen M, Bagg- iolini M. Eotaxin-2, a novel CC chemokine that is selective for the chemokine receptor CCR3, and acts like eotaxin on human eosinophil and basophil leukocytes. J Exp Med. 1997;185(12) :2171-6.

34. Thomas PS. Tumour necrosis factor-alpha: the role of this multifunctional cytokine in asthma.

Immunol Cell Biol. 2001;79(2):132-40.

참조

관련 문서

When 3 different doses of MSCs were intravenously injected into mice treated with elastase, only 5×10 4 MSCs showed a significant effect on the emphysematous mouse lung..

Five-week-old BALB/c mice were divided into four groups: normal group (N, non-treated), control group (C, atopic dermatitis-induced), positive control group (PC,

After recovering from the surgery for four weeks, the ovariectomized (OVX) mice were randomly allocated to each experimental groups and treated as described in the

Methods 24 Male C57Bl/6J mice were randomly assigned to normal group fed with normal research diet NOR, n=6, high fat diet control group treated with water HFD, n=6, high fat diet