Article: Bioactive Materials
Protective effects of Camellia sinensis fruit and fruit peels against oxidative DNA damage
Joung-Jwa Ahn1 · Tae-Won Jang2 · Jae-Ho Park2
Received: 16 June 2021 / Accepted: 16 July 2021 / Published Online: 30 September 2021
© The Korean Society for Applied Biological Chemistry 2021
Abstract Camellia sinensis, Green tea, contains phenolic compounds that act to scavenge reactive oxygen species (ROS), such as catechin, epicatechin, etc. In contrast with the tea leaf, the bioactivity of its fruit and the fruit peels remains still unclear. This study focused on the effects of fruit and fruit peels of C. sinensis (FC and PC) against oxidative DNA damage in NIH/3T3 cells.
The scavenging effects of FC and PC on ROS were assessed using 1,1-diphenyl-2-picryl hydrazyl or 2,2'-azino-bis(3-ethylbenzo- thiazoline-6-sulfonic acid radicals. The measurement of ROS in cellular levels was conducted by DCFDA reagent and the protein expression of γ-H2AX, H2AX, cleaved caspase-3, p53, and, p- p53 was analyzed by immunoblotting. The gene expressions of p53 and H2AX were assessed using polymerase chain reaction techniques. The major metabolites of FC and PC were quantitatively measured analyzed and the amounts of phenolic compounds and flavonoids in PC were greater than those in FC.
Further, PC suppressed ROS production, which protects the oxidative stress-induced DNA damage through reducing H2AX, p53, and caspase-3 phosphorylation. These results refer that the protective effects of FC and PC are mediated by inhibition of p53 signaling pathways, probably via the bioactivity of phenolic compounds. Thus, FC and PC can serve as a potential antioxidant in DNA damage-associated diseases.
Keywords Camellia sinensis · Caspase-3 · H2AX · Oxidative DNA damage · p53
Introduction
DNA damage is occurred under the influence of external factors to the cell or produced by normal cell metabolism. DNA damage works directly on DNA to change its structure or activity and consequently, complicated signaling pathways in cells are activated to react to the damage or promote apoptosis [1,2].
Reactive oxygen species (ROS), which known as the cause of oxidative DNA damage, mediate apoptosis and activate DNA damage responses (DDRs) such as expressions of p53 and H2AX in cells [3]. Also, DNA damage has been connected to the pathogenesis of various diseases such as heart disease, inflammation, and cancer [4]. The activation of tumor suppressor p53 induces apoptosis and causes cell cycle arrest, which mediates tumor suppression [5,6]. p53 has been shown to regulate basal expressions and DNA damage-induced levels of ROS [7-9]. This regulation of p53 activated a series of kinases that a crucial role in the expression of DNA repair proteins [10]. ROS-mediated oxidative DNA damage regulates both cell death and survival via the modification of histone H2AX [11-15]. Kinase-activated γ- H2AX plays the main role in preventing DNA damage by aggregating genes related to DNA repair to oxidative stress [16].
The expression of caspase 3 is known as one of the main factors of apoptosis and its cleft are regarded as a primary mechanism of apoptosis [17]. Thus, it is important to eliminate ROS for protecting DNA and for inhibiting the progression of many diseases in organisms [18]. Green tea (Camellia sinensis) is a widely popular drink worldwide [19] and has been reported to present bioactivities with benefits, such as diabetes, cardiovascular diseases, obesity, and the prevention of cancers [20,21]. These benefits are mainly due to its phenolics, flavonoids (catechins), Joung-Jwa Ahn and Tae-Won Jang are contributed equally.
Jae-Ho Park () E-mail: [email protected]
1Department of Food Science and Technology, Jungwon University, Goesan 28024, Republic of Korea
2Department of Pharmaceutical Science, Jungwon University, Goesan 28024, Republic of Korea
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.
org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
xanthic bases (caffeine), vitamins, etc [22]. In previous studies, green tea polyphenols have been shown to exert powerful antioxidant activity [23-25]. However, a study on the bioactivity of fruit and its peels which are by-products of green tea remains to be elucidated, compared with a leaf of green tea. In the present study, we assessed the protective effects of fruit and peels of C.
sinensis (FC and PC) on oxidative DNA damage.
Materials and Methods Extracts plants materials
C. sinensis (whole plants) were purchased from Kyungdong commercial market (Korea) and fruit (peeled) and peels of C.
sinensis (100 g each) were obtained by immersion in 70% ethanol (1 L) and using a sonicator (40 kHz, 700 W). The ethanol extracts of fruit (peeled) and peels were filtered to remove the reside and concentrated by using N-1110S rotary vacuum evaporator (EYELA, Tokyo, Japan). The ethanol extracts from fruit and peels of C. sinensis (dry weights of FC and PC, 9.5 g, and 2.0 g) were collected, and each collection was dissolved in dimethyl sulfoxide (DMSO). FC and PC was refrigerated at 4 oC until use.
Chemicals and reagents
Dulbecco’s modified Eagle’s medium (DMEM) and bovine calf serum (BCS) were purchased from Biowest (Riverside, MO, USA). Penicillin/streptomycin was purchased from HyClone (Marlborough, MA, USA). Plasmocin prophylactic was purchased from InvivoGen (San Diego, CA, USA). Radioimmuno- precipitation assay buffer (RIPA) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Hanks balanced salt solution (HBSS) was purchased from Gibco (Waltham, MA, USA). Bradford protein assay and sodium dodecyl sulfate–
polyacrylamide gel electrophoresis (SDS-PAGE) related reagents were purchased from Bio-Rad Laboratories (Hercules, CA, USA).
Bovine serum albumin (BSA) and agarose were purchased from Biosesang (Korea). AlamarBlue® cell viability reagent was purchased from Thermo Fisher Scientific. An anti-cleaved caspase-3 polyclonal antibody (cat. no. ab13847), an anti-H2AX polyclonal antibody (cat. no. ab11175), an anti-γ-H2AX (Ser139) polyclonal antibody (cat. no. ab11174), an anti-p53 polyclonal antibody (cat. no. ab131442), an anti-phosphorylated-p53 (p-p53;
Ser15) polyclonal antibody (cat. no. ab1431), and an anti-GAPDH monoclonal antibody (cat. no. ab8245) were purchased from Abcam (Cambridge, UK). An anti-mouse IgG monoclonal antibody (cat. no. 18-8817-33) and anti-rabbit IgG monoclonal antibody (cat. no. 18-8816-33) were purchased from Rockland (USA). NucleoSpinTM RNA Plus kit was purchased from Macherey-Nagel (Düren, Germany). ReverTra Ace-α-TM and Quick Taq® HS Dye Mix were purchased from Toyobo Life Science (Osaka, Japan). Quanti Tect® SYBR Green PCR kit was purchased from Qiagen (Hilden, Germany). DNA SafeStain was
purchased from Lamda Biotech (St. Louis, MO, USA). 4′,6- Diamidine-2′-phenylindole dihydrochloride (DAPI) was purchased from Invitrogen (Waltham, MA, USA).
Antioxidant activity
For measuring the antioxidant activity of FC and PC, modified methods [26,27] of 2,2'-azino-bis (3-ethylbenzothiazoline-6- sulfonic acid) diammonium salt (ABTS) and 1,1-diphenyl-2- picryl hydrazyl (DPPH) radical scavenging activity were applied according to the previous study [28]. For ABTS and DPPH radical scavenging activity, FC and PC were added to ABTS solution or DPPH solution, which were measured by using a Xma-3000PC ultraviolet (UV)/visible spectrophotometer (Human Corporation, Korea). The scavenging capacity was measured as a reduced rate in the absorbance of ABTS (in 734 nm) or DPPH (in 515 nm), which calculated using the following formula: activity of radicals scavenging (%) = [1−(AS−AB)/AC]x100 where ‘AS’ = Absorbance values of radicals following treatment with the sample, ‘AB’ = Absorbance values of ethanol or H2O and ‘AC’ = Absorbance values of radicals.
Analysis of total phenolic compounds (TPC) and flavonoid compound content (TFC)
TPC in extracts was measured by Folin-Denis's phenol method [29]. Each sample was mixed with 2 N Folin-Ciocalteu reagent and the 20% sodium carbonate solution was added. After 40 min, the absorbance of the mixture was measured at 725 nm using a UV/visible spectrophotometer. TPC were calculated by standard curve of tannic acid. TPC was determined using an equation that was obtained from the standard curve. TFC was determined using the method [30]. Each sample was mixed with 10% aluminum chloride, 1 M potassium acetate, and distilled water. After 30 min at room temperature, the absorbance of the mixture was measured at 415 nm using a UV/visible spectrophotometer. TFC were calculated by standard curve of rutin. TFC was determined using an equation that was obtained from the standard curve.
Cell culture
The murine NIH/3T3 cells were purchased from ATCC (ATCC® CRL-1658TM). Cells were cultured in DMEM supplemented with 10% (v/v) BCS, 0.2% (v/v) anti-mycoplasma agents, and 1%
(v/v) antibiotics. Referring to previous studies [28], oxidative damage (0.5 mM FeSO4+ 0.5 mM H2O2) was applied for subsequent studies such as cell viability, western blotting, and PCR assays.
Cell viability
The cell viability was measured using alamarBlue® reagent, and the manufacturer's protocols were followed to obtain the range of toxic and nontoxic concentrations. The results were calculated as the percentage of viable cells over non-treated cells [31].
Measurement of intracellular reactive oxygen species (ROS) For measuring ROS, DCF-DA assay was conducted by using a CKX53 microscope (Olympus, Tokyo, Japan). DCF-DA gets into the cell inside and responds with ROS to generate a fluorescent color (green) compound dichlorofluorescein (DCF) [32,33]. A working solution of 100 μM DCF-DA (Sigma-Aldrich, St. Louis, MO, USA) was prepared with culture medium. Cells were treated with FC and PC for 24 h. Then cells were treated with H2O2 for 30 min. After then, the cells were washed with HBSS and incubated with the working solution for 30 min at 37 oC. The slides were mounted to capture images using a microscope. The intensity of fluorescence was analyzed using the ImageJ software v1.51K (developed at the National Institutes of Health, USA, http://rsb.info.nih.gov/ij).
Immunoblotting
Cells were lysed using RIPA buffer supplemented with a protease inhibitor cocktail (Sigma-Aldrich). The protein concentration of cell lysates was calculated using Bradford solution. A certain amount of protein was separated by SDS-PAGE on gels of appropriate concentration and then transferred to PVDF membrane (Bio-Rad Laboratories). The membrane was blocked with 5% BSA (TBST) for 1 h at room temperature, then incubated with primary antibodies in 3% BSA overnight at 4oC. After washing, membranes were incubated with secondary antibodies for 1 h. Visualized bands by ECL solution were detected by Chemi-Doc imaging system (Bio-Rad Laboratories). The intensity of bands was analyzed using the ImageJ software v1.51K.
Reverse transcription (RT)-semi-quantitative PCR (qPCR) and Quantitative PCR analysis
Total RNA was isolated from NIH/3T3 cells using the NucleoSpinTM RNA Plus kit. cDNA was synthesized using ReverTra Ace-α-TM according to the manufacturer’s protocol. RT- PCR was carried out using Quick Taq® HS Dye. RT-qPCR was performed using Quanti Tect® SYBR Green PCR kit on a 7500 Real-Time PCR system (Applied Biosystems, Waltham, MA, USA, USA). The amplifications were performed with initial denaturation at 95 oC for 2 min, followed by 35 cycles of 95 oC for 30 s and appropriate melting temperature (Tm) value for 30 sec using Thermal cycler (Bio-Rad Laboratories). Primer
sequences using Primer 3 program 0.4.0 (http://bioinfo.ut.ee/
primer3-0.4.0/) are presented in Table 1. DNA density was visualized by 2% agarose gel with DNA SafeStain. Transcription levels were normalized to GAPDH. The 2−ΔΔCt formula was used to analyze mRNA expression levels, where ΔΔCt = (Cttarget- CtGAPDH)sample− (Cttarget− CtGAPDH)control [34]. Density was analyzed using the ImageJ software 1.51K.2.9.
Immunofluorescence staining
For immunofluorescence staining, a glass coverslips (BD Biosciences, USA) were prepared with attached cells, then fixed with 4% paraformaldehyde. The fixed cells were blocked for 1 h with 3% BSA contained 0.1% Triton X-100. Nuclei were stained using DAPI. Cells were incubated with primary antibodies at 4 oC, then with with Alexa Fluor488 and Alexa Fluor568-conjugated secondary antibodies (Abcam) in the dark. The fluorescence images captured using a CKX53 fluorescence microscope (magnification, x400; Olympus).
Statistical analysis
All results were analyzed by GraphPad Prism 5.0 (San Diego, CA, USA) and are presented as mean ± standard deviation (n ≥3). The section of antioxidant activity was analyzed by paired Student’s t- test. Other values were analyzed by ANOVA followed by Tukey’s post hoc test were used to compare the means across multiple groups. p <0.05 was considered to indicate a statistically significant difference.
Results
Analysis of phenolic compounds and flavonoid contents Upon analysis of phenolic compounds and flavonoid contents, FC and PC showed 76.59±0.01 and 172.97±0.01 mg/g GAE of phenolic compounds, respectively, based on a calibration curve (y =0.5828x−0.1099, R2=0.9998). FC and PC showed flavonoid content at 8.45±0.01 and 10.77±0.01 mg/g QAE, respectively, based on a calibration curve (y =3.02x−0.0922, R2=0.9864).
Antioxidant activity of FC and PC
FC and PC suppressed the DPPH radicals in a dose-dependent
Table 1 Sequences of primers used in the RT-PCR and RT-qPCR analysis
A, RT-semi-qPCR Forward (5'-3') Reverse (5'-3')
H2AX p53 GAPDH
TTGCTTCAGCTTGGTGCTTAG AACTGGTATGAGGCCAGCAAC
CGGATAGTATTTCACCCTCAAGATCCG AGCCCTGCTGTCTCCAGACTC
AACTTTGGCATTGTGGAAGG ATGCAGGGATGATGTTCTGG
B, RT-qPCR Forward (5'-3') Reverse (5'-3')
H2AX p53 GAPDH
GCGTCTTTGCTTCAGCTTG CACACTGGCCTACGAATGG
GATGTTCCGGGAGCTGAAT GCCCCACTTTCTTGACCAT
CCTCCAAGGAGTAAGAAACC CTAGGCCCCTCCTGTTATTA
manner (Fig. 1A). DPPH radical scavenging activity was increased from PC (88.4±3.1) compared with FC (49.0±1.7) at 200 µg/mL. Also, FC and PC suppressed ABTS radicals in a dose-dependent manner (Fig. 1B). ABTS radical scavenging activity was increased from PC (99.6±0.1) compared with FC (88.9±0.8) at 200 µg/mL. IC50 (half-maximal inhibitory concentration) values of FC and PC were 318.1 and 6.66 µg/mL, respectively.
Cytotoxicity of FC and PC in NIH/3T3 cells
To determine whether FC and PC had any cytotoxic effect, NIH/
3T3 cells were cultured with FC and PC concentrations ranging between 2 and 100 µg/mL; cell viability was then assessed following 24 h incubation. FC and PC did not affect cell viability (Fig. 2).
Fig. 1 Antioxidant activities of FC and PC. (A) DPPH radical scavenging activity. (B) ABTS radical scavenging activity. Data are presented as the mean ± standard deviation of ≥3 independent experiments. ***p <0.001 vs. PC at the same concentration
Fig. 2 FC and PC provide the viability of NIH/3T3 cells. NIH/3T3 cells were treated with various concentrations of FC and PC (0-100 µg/mL) for 24 h and was assessed using the alamarBlue® cell viability reagent.
Data are presented as the mean ± SD of ≥3 independent experiments.
*p <0.05, **p <0.01 and ***p <0.001 vs. untreated group
Fig. 3 FC and PC suppressed the ROS production. (A) Representative fluorescence image of NIH/3T3 cells treated with DCF-DA probe in the presence or absence of FC and PC under oxidative stress (100 μM H2O2). The fluorescence intensity was visualized using a fluorescence microscope (magnification, ×400). Scale bar, 40 μm (B) Bar graphs indicated the fluorescence intensity of ROS in NIH/3T3 cells. Data are presented as the mean ± SD of ≥3 independent experiments. #p <0.001 vs. Control, *p <0.05, **p <0.01, and ***p <0.001 vs. Non-treated group without oxidative damage
Effect of FC and PC on oxidative damage-induced ROS production
To investigate whether an increase in oxidative damage was suppressed by treatment with FC and PC, DCF-DA assay was performed (Fig. 3A). The results showed that oxidative damage
increased intracellular ROS production (6.1±1.6-fold of the control) in NIH/3T3 cells. However, FC and PC significantly decreased the ROS production (3.1±0.2 and 2.1±0.3-fold) compared to the non-treated group with oxidative damage (Fig.
3B).
Fig. 4 FC and PC increased protective effects on oxidative DNA damage in NIH/3T3 cells. (A) Western blot analysis revealed the expression of each proteins (B) RT-PCR analysis revealed the levels of genes (C) Bar graphs indicated the density of the expression of each proteins (D) Bar graphs indicated the density of the levels of genes (E) Bar graphs indicated 2-ΔΔCt of genes. Data are presented as the mean ± standard deviation of the mean of at least three independent experiments. #p <0.001, vs. untreated group, *p <0.05, **p <0.01 and ***p <0.001 vs. oxidatively damaged group
Effect of FC and PC on oxidative DNA damage in NIH/3T3 cells
Immunoblotting results (Fig. 4A and 4B) indicated that the expression of p-p53 (388.0±9.4%), γ-H2AX (524.9±8.2%), and cleaved caspase-3 (274.9±9.8%) were increased after oxidative damage treatment. FC and PC significantly suppressed the expression of p-p53 (232.6±2.8 and 72.1±1.4%, respectively), γ- H2AX (152.5±4.7 and 154.9±1.9%, respectively), and cleaved caspase-3 (136.7±4.2 and 120.1±1.5%, respectively) at 10 μg/mL.
RT-PCR analysis (Fig. 4C and D) showed increased expression of p53 (796.7±7.0%) and H2AX (555.1±3.9%) genes after oxidative damage treatment. FC and PC significantly suppressed the levels of p53 (436.1±6.6 and 282.1±5.9%) and H2AX (216.9±3.1 and 244.2±3.8) genes at 10 μg/mL. The expression levels of p53 and H2AX gene, as detected by RT-qPCR, followed the same pattern as levels of p53 and H2AX gene detected by RT-PCR (Fig. 4E).
Cells were stained with immunofluorescence to detect p-p53 and γ-H2AX, markers of DNA damage (Fig. 5). The expression intensity of γ-H2AX and p-p53 increased after oxidative damage and was decreased with FC and PC treatment compared to the non-treated group. These results suggest that FC and PC inhibit oxidative damage-induced apoptosis by regulating the expression
of p53 and H2AX induced by ROS generation. Further, the protective effect of PC was significantly higher than those of FC.
Discussion
Plant-derived natural antioxidants such as phenolic compounds, L-ascorbic acid, and flavonoids, help to interfere with the oxidation process by reacting with free radicals, chelating catalytic metal ions, and scavenging oxygen [35,36]. These biologically active molecules are called phytochemicals [37,38]. Phenolic compounds containing a resonance structure have electron- donating potential, and their antioxidant potential can suppress the levels of ROS such as superoxide radicals, hydroxyl radicals, and peroxyl radicals. [39,40]. Green tea contains phenolic compounds such as catechins, phenolic acids, and flavonoids. In the results of this study, PC showed higher amounts of phytochemicals compared to FC. Overall, this suggests a deep relationship between radical- scavenging activity and phytochemicals. These results indicated that PC scavenged DPPH and ABTS radicals more effectively than FC. As a further study, decreasing DNA damage by ROS at the cellular levels was considered to the indicator which represents Fig. 5 FC and PC regulated the expression of γ-H2AX (green) and p-p53 (red) in NIH/3T3 cells. Fluorescence microscopy showed the expression of anti-p-p53 and anti-γ-H2AX antibody treated for 24 h with oxidative damage (150 µM FeSO4 and 600 µM H2O2) + FC or PC (10 µg/mL). Scale bar, 40 µm. DAPI, 4, 6-diamidino-2-phenylindole (blue)
the bioactivity of FC and PC against DNA damage response (DDR). DNA damage activates DDR, which include DNA damage recognition, activation of checkpoints, cell cycle arrest, and eventual outcomes of repair, apoptosis, and immune clearance [41,42]. In addition, oxidative DNA damage plays a major role in diseases including aging, neurodegenerative disorders (Alzheimer’s disease), cancer, multiple sclerosis, and so on [43-46]. Oxidative stress increases H2AX phosphorylation by inducing DNA double- strand breaks (DSBs), and H2AX phosphorylation is affected by DDR signaling factor (phosphatidylinositol 3-kinase, PI3K) [47].
Furthermore, γ-H2AX recruits multiple components of DDR to the site of DNA double-strand breaks (DSBs) to initiate DNA DSB repair [16,48]. The p53 pathway is a key effector of DDR, and phosphorylated p53 (p-p53) might regulate the cellular response to DNA damage [49,50]. In p53-dependent pathways, pro-caspase-3 is cleaved, thereby inactivating PARP, which repairs DNA lesions and eventually leads to apoptosis [51].
Therefore, expression of cleaved caspase-3, γ-H2AX, and p-p53 may play distinct roles in DNA damage responses. In the present study, FC and PC treatment suppressed the phosphorylation of p53, cleaved caspase-3, and γ-H2AX in oxidative damage- induced NIH/3T3 cells. Furthermore, the gene expression levels of H2AX and p53 were suppressed. Although there might be other ways to explain these suppressions effects, this study demonstrates that FC and PC could decrease ROS, leading to protect DNA against oxidative damage.
Acknowledgments This work was supported by the 2018 Jungwon University Grant.
References
1. Chakarov S, Petkova R, Russev GC, Zhelev N (2014) DNA damage and mutation. Types of DNA damage. BioDiscovery 11: e8957
2. Roos WP, Thomas AD, Kaina B (2016) DNA damage and the balance between survival and death in cancer biology. Nat Rev Cancer 16: 20.
doi: 10.1038/nrc.2015.2
3. Jang SH, Lim JW, Morio T, Kim H (2012) Lycopene inhibits Helicobacter pylori-induced ATM/ATR-dependent DNA damage response in gastric epithelial AGS cells. Free Radical Biol Med 52: 607− 615. doi: 10.1016/j.freeradbiomed.2011.11.010
4. Gilgun-Sherki Y, Rosenbaum Z, Melamed E, Offen D (2002) Antioxidant therapy in acute central nervous system injury: current state.
Pharmacol Rev 54: 271–284. doi: 10.1124/pr.54.2.271
5. Toshiyuki M, Reed JC (1995) Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80: 293–299. doi:
10.1016/0092-8674(95)90412-3
6. Lahiry L, Saha B, Chakraborty J, Bhattacharyya S, Chattopadhyay S, Banerjee S, Choudhuri T, Mandal D, Bhattacharyya A, Sa G (2008) Contribution of p53-mediated Bax transactivation in theaflavin-induced mammary epithelial carcinoma cell apoptosis. Apoptosis 13: 771–781.
doi: 10.1007/s10495-008-0213-x
7. Liu B, Chen Y, Clair DKS (2008) ROS and p53: a versatile partnership.
Free Radic Biol Med 44: 1529–1535. doi: 10.1016/j.freeradbiomed.
2008.01.011
8. Polyak K, Xia Y, Zweier JL, Kinzler KW, Vogelstein B (1997) A model
for p53-induced apoptosis. Nature 389: 300–305. doi: 10.1038/38525 9. Sablina AA, Budanov AV, Ilyinskaya GV, Agapova LS, Kravchenko JE,
Chumakov PM (2005) The antioxidant function of the p53 tumor suppressor. Nat Med 11: 1306–1313. doi: 10.1038/nm1320
10. Shibata A, Jeggo P (2014) DNA double-strand break repair in a cellular context. Clin Oncol 26: 243–249. doi: 10.1016/j.clon.2014.02.004 11. Hamanaka RB, Chandel NS (2010) Mitochondrial reactive oxygen
species regulate cellular signaling and dictate biological outcomes.
Trends Biochem Sci 35: 505–513
12. Simon H-U, Haj-Yehia A, Levi-Schaffer F (2000) Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5: 415–418.
doi: 10.1016/j.tibs.2010.04.002
13. Fernandez-Capetillo O, Lee A, Nussenzweig M, Nussenzweig A (2004) H2AX: the histone guardian of the genome. DNA repair 3: 959–967.
doi: 10.1016/j.dnarep.2004.03.024
14. Stucki M, Clapperton JA, Mohammad D, Yaffe MB, Smerdon SJ, Jackson SP (2005) MDC1 directly binds phosphorylated histone H2AX to regulate cellular responses to DNA double-strand breaks. Cell 123:
1213–1226. doi: 10.1016/j.cell.2005.09.038
15. Cook PJ, Ju BG, Telese F, Wang X, Glass CK, Rosenfeld MG (2009) Tyrosine dephosphorylation of H2AX modulates apoptosis and survival decisions. Nature 458: 591–596. doi: 10.1038/nature07849
16. Paull TT, Rogakou EP, Yamazaki V, Kirchgessner CU, Gellert M, Bonner WM (2000) A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol 10: 886–895.
doi: 10.1016/s0960-9822(00)00610-2
17. Galluzzi L, Kepp O, Kroemer G (2012) Caspase-3 and prostaglandins signal for tumor regrowth in cancer therapy. Oncogene 31: 2805–2808.
doi: 10.1038/onc.2011.459
18. Ji K, Jang NY, Kim YT (2015) Isolation of lactic acid bacteria showing antioxidative and probiotic activities from kimchi and infant feces. J Microbiol Biotechnol 25: 1568–1577. doi: 10.4014/jmb.1501.01077 19. Pardau MD, Pereira AS, Apostolides Z, Serem JC, Bester MJ (2017)
Antioxidant and anti-inflammatory properties of Ilex guayusa tea preparations: a comparison to Camellia sinensis teas. Food Funct 8:
4601–4610. doi: 10.1039/c7fo01067b
20. Vuong QV, Golding JB, Nguyen MH, Roach PD (2012) Production of caffeinated and decaffeinated green tea catechin powders from underutilised old tea leaves. J Food Eng 110: 1–8. doi: 10.1016/
j.jfoodeng.2011.12.026
21. Prathapan A, Singh MK, Anusree S, Kumar DS, Sundaresan A, Raghu K (2011) Antiperoxidative, free radical scavenging and metal chelating activities of Boerhaavia Diffusa L. J Food Biochem 35: 1548–1554. doi:
10.1111/j.1745-4514.2010.00477.x
22. Armoskaite V, Ramanauskiene K, Maruska A, Razukas A, Dagilyte A, Baranauskas A, Briedis V (2011) The analysis of quality and antioxidant activity of green tea extracts. J Med Plant Res 5: 811–816. doi: 10.5897/
JMPR.9001183
23. Ahmad N, Mukhtar H (1999) Green tea polyphenols and cancer:
biologic mechanisms and practical implications. Nutr Rev 57: 78–83.
doi: 10.1111/j.1753-4887.1999.tb06927.x
24. Romano B, Pagano E, Montanaro V, Fortunato AL, Milic N, Borrelli F (2013) Novel insights into the pharmacology of flavonoids. Phytother Res 27: 1588–1596. doi: 10.1002/ptr.5023
25. Schröder L, Marahrens P, Koch JG, Heidegger H, Vilsmeier T, Phan- Brehm T, Hofmann S, Mahner S, Jeschke U, Richter DU (2019) Effects of green tea, matcha tea and their components epigallocatechin gallate and quercetin on MCF-7 and MDA-MB-231 breast carcinoma cells.
Oncol Rep 41: 387–396. doi: 10.3892/or.2018.6789
26. Bondet V, Brand-Williams W, Berset C (1997) Kinetics and mechanisms of antioxidant activity using the DPPH. free radical method. LWT-Food Sci Technol 30: 609–615. doi: 10.1006/fstl.1997.0240
27. Van den Berg R, Haenen GR, Van den Berg H, Bast A (1999) Applicability of an improved Trolox equivalent antioxidant capacity (TEAC) assay for evaluation of antioxidant capacity measurements of
mixtures. Food Chem 66: 511–517. doi: 10.1016/S0308-8146(99)00089-8 28. Jang TW, Choi JS, Park JH (2020) Protective and inhibitory effects of acteoside from Abeliophyllum distichum Nakai against oxidative DNA damage. Mol Med Rep 22: 2076–2084. doi: 10.3892/mmr.2020.11258 29. Park JY, Ji YJ, Seo KH, Lee JY, Kim GS, Kang MH, Lee JH, Jang GY,
Kim HD (2021) Heat Treatment Improves UV Photoprotective Effects of Licorice in Human Dermal Fibroblasts. Processes 9: 1040. doi: 10.3390/
pr9061040
30. Al Amri FS, Hossain MA (2018) Comparison of total phenols, flavonoids and antioxidant potential of local and imported ripe bananas.
Egypt J Basic Appl Sci 5: 245–251. doi: 10.1016/j.ejbas.2018.09.002 31. Harikrishnan H, Jantan I, Haque MA, Kumolosasi E (2018) Anti-
inflammatory effects of hypophyllanthin and niranthin through downregulation of NF-κB/MAPKs/PI3K-Akt signaling pathways.
Inflammation 41: 984–995. doi: 10.1007/s10753-018-0752-4
32. Pramanik A, Laha D, Dash SK, Chattopadhyay S, Roy S, Das DK, Pramanik P, Karmakar P (2016) An in vivo study for targeted delivery of copper-organic complex to breast cancer using chitosan polymer nanoparticles. Mater Sci Eng C Mater Biol Appl 68: 327–337. doi:
10.1016/j.msec.2016.05.014
33. Laha D, Pramanik A, Chattopadhyay S, kumar Dash S, Roy S, Pramanik P, Karmakar P (2015) Folic acid modified copper oxide nanoparticles for targeted delivery in in vitro and in vivo systems. RSC Advances 5:
68169–68178. doi: 10.1039/c5ra08110f.
34. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. methods 25: 402–408. doi: 10.1006/meth.2001.1262
35. Pisoschi AM, Cheregi MC, Danet AF (2009) Total antioxidant capacity of some commercial fruit juices: electrochemical and spectrophotometrical approaches. Molecules 14: 480–493. doi: 10.3390/molecules14010480 36. Prasad KN, Chew LY, Khoo HE, Kong KW, Azlan A, Ismail A (2010)
Antioxidant capacities of peel, pulp, and seed fractions of Canarium odontophyllum Miq. fruit. Biomed Res Int 2010: doi: 10.1155/2010/
871379
37. Quideau S, Deffieux D, Douat-Casassus C, Pouysegu L (2011) Plant polyphenols: chemical properties, biological activities, and synthesis.
Angew Chem Int Ed 50: 586–621. doi: 10.1002/anie.201000044 38. Tomas-Barberan FA, Andres-Lacueva C (2012) Polyphenols and health:
current state and progress. J Agric Food Chem 60: 8773–8775. doi:
10.1021/jf300671j
39. Valko M, Morris H, Cronin M (2005) Metals, toxicity and oxidative stress. Curr Med Chem 12: 1161–1208. doi: 10.2174/0929867053764635 40. Sang LX, Chang B, Li XH, Jiang M (2013) Green tea consumption and risk of esophageal cancer: a meta-analysis of published epidemiological studies. Nutr Cancer 65: 802–812. doi: 10.1080/01635581.2013.805423 41. Ciccia A, Elledge SJ (2010) The DNA damage response: making it safe
to play with knives. Mol Cell 40: 179–204. doi: 10.1016/j.molcel.2010.
09.019
42. McNally JP, Millen SH, Chaturvedi V, Lakes N, Terrell CE, Elfers EE, Carroll KR, Hogan SP, Andreassen PR, Kanter J (2017) Manipulating DNA damage-response signaling for the treatment of immune-mediated diseases. Proc Natl Acad Sci USA 114: E4782–E4791. doi: 10.1073/
pnas.1703683114
43. Kanvah S, Schuster GB (2004) One-electron oxidation of DNA: The effect of replacement of cytosine with 5-methylcytosine on long-distance radical cation transport and reaction. J Am Chem Soc 126: 7341–7344.
doi: 10.1021/ja049468i
44. Demple B, Harrison L (1994) Repair of oxidative damage to DNA:
enzymology and biology. Annu Rev Biochem 63: 915–948. doi: 10.1146/
annurev.bi.63.070194.004411
45. Poulsen HE, Prieme H, Loft S (1998) Role of oxidative DNA damage in cancer initiation and promotion. Eur J Cancer Prev 7: 9–16
46. Hasty P, Vijg J (2002) Aging. Genomic priorities in aging. Science 296:
1250–1251. doi: 10.1126/science.1071808
47. Li Z, Yang J, Huang H (2006) Oxidative stress induces H2AX phosphorylation in human spermatozoa. FEBS Lett 580: 6161–6168.
doi: 10.1016/j.febslet.2006.10.016
48. Rogakou EP, Pilch DR, Orr AH, Ivanova VS, Bonner WM (1998) DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem 273: 5858–5868. doi: 10.1074/jbc.273.10.5858 49. Phillips E, McKinnon P (2007) DNA double-strand break repair and
development. Oncogene 26: 7799. doi: 10.1038/sj.onc.1210877 50. Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, Craig RW (1991)
Participation of p53 protein in the cellular response to DNA damage.
Cancer Res 51: 6304–6311
51. Green DR, Reed JC (1998) Mitochondria and apoptosis. Science 281:
1309–1312. doi: 10.1126/science.281.5381.1309