Copyright ⓒ 2016 by the Korean Society of Breeding Science
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
레스베라트롤 합성 GM 벼 검정을 위한 계통특이 마커 개발
우희종1*⋅친양1⋅백소현2⋅여윤수1⋅신공식1⋅임명호1⋅조현석1
1농촌진흥청 국립농업과학원, 2순천대학교 웰빙자원학과
Development of Event-Specific PCR Marker for Identification of Transgenic Resveratrol-Enriched Rice Plant
Hee-Jong Woo1*, Yang Qin1, So-Hyeon Baek2, Yunsoo Yeo1, Kong-Sik Shin1, Myung-Ho Lim1, and Hyun-Suk Cho1
1National Institute of Agricultural Sciences, Rural Development Administration (RDA), Jeonju 54874, Korea
2Department of Well-being Resources, Sunchon National University, Suncheon 57922, Korea
Abstract : A variety of genetically modified (GM) crops have been developed in Korea. In these crops, the resveratrol-enriched transgenic rice plant (Agb0102) has moved ahead to generate the dossier for regulatory review process required for commercialization of GM crop. The resveratrol-enriched transgenic rice plant could be released to farmers for cultivation after national regulators have determined that it is safe for the environment and human health. Here, we developed a PCR-based DNA marker based on flanking sequences of transgene for the discrimination of resveratrol-enriched transgenic rice plant. This DNA markers will be useful for identifying of resveratrol-enriched transgenic rice plant, and can also be used to estimate transgene movement occurred by pollen transfer or seed distribution. Moreover, it is helpful for prompt screening of a homozygote-transgenic progeny in the breeding program.
Keywords : Resveratrol, Transgenic rice, Event-specific marker, Monitoring, GM rice
*Corresponding author (E-mail: [email protected], Tel: +82-63- 238-4706, Fax: +82-63-238-4704)
(Received on December 10, 2015. Accepted on February 11, 2016.)
서 언
여러 위해성 논란에도 불구하고 유전자변형(Genetically modified, GM) 작물은 상업화 이후 19년째 지속적 증가세를 나타내어 2014년 재배면적이 1억 8,150만 헥타르에 달하고 있다(James 2014). 우리나라에서도 가공식품용 및 사료용으 로 수입되는 GM 작물의 양은 매년 증가하여 2014년 기준 총 1,082만 톤, 금액으로 약 31억 2천 달러에 달하고 있다 (KBCH 2015).
현재까지 국내에서는 GMO(Genetically modified organism) 위해성 심사승인 과정을 거쳐 상업화되어 재배되고 있는 작물 은 없지만 향후 상업화를 위해 다수의 GM 작물들이 개발 중이 다. 국내에서 개발되고 있는 GM 작물들 가운데 애그로박테리
움 형질전환 방법을 이용해 땅콩의 resveratrol synthase(RS) 유전자를 동진벼에 도입시켜 개발된 레스베라트롤 합성벼 Agb0102(익산526)는 현재 안전성평가를 완료하고, 상업화를 위해 GMO 규제기관에 대한 위해성 평가 심사자료를 준비하 고 있다. Agb0102 쌀은 동물실험을 통해 대사성질환 예방 및 비만 억제에 효과가 있으며, 피부 미백기능도 확인되었다 (Baek et al. 2013, 2014, Lee et al. 2014). 따라서 향후 GMO 위해성 심사승인을 거쳐 상업화된다면 Agb0102 벼는 건강증진 및 화장품, 기능성식품 등의 산업소재로 활용가치가 높을 것으로 기대된다.
GM작물이 재배될 경우 가장 우려되는 문제 중 하나는 GM작물의 비의도적 환경방출이다. 포장에서 주변 환경으로 GM작물이 환경방출 되는 주 경로는 GM화분이 재배포장 주 변의 교잡 가능한 동종 또는 근연종으로 유전자가 이동되거 나, 또는 GM종자의 취급과정에서 발생될 수 있는 비의도적 인 혼입, 낙곡, 살포 등의 오염에 의해 발생된다. GM작물의
韓育誌(Korean J. Breed. Sci.) 48(2), 2016
120Name Primer sequence (5´- 3´) Specificity
P1 AGGCATTCCTCAAGAAAGAGTCCATGTGGA Flanking region
(Chr. 12, 330534-330563)
P2 ATGTGCAAGATACAATATATGTTCATATGTGCAGAAATT Flanking region
(Chr. 12, 331483-331521)
P3 GCGTTAATTCAGTACATTAAAAACGTCCGCAAT T-DNA region
(CaMV 35s terminator) Table 1. Sequence information of event-specific primers used in this study.
안전관리를 위해서 GM작물의 비의도적 환경방출을 대비한 검정방법 확립 및 종자와 화분의 이동성 분석 기법은 GM작 물의 이동성 연구뿐 아니라 비의도적 오염에 대비한 사후 모 니터링을 위해서도 필요하다.
GMO 검정방법으로는 도입유전자(T-DNA)를 중합효소연 쇄반응(polymerase chain reaction, PCR)으로 검출하는 방법 이 일반적으로 많이 사용되고 있다. 특히 도입유전자가 삽입 된 게놈내의 삽입 인접염기서열 및 T-DNA 염기서열을 바탕 으로 분석하는 이벤트 특이적(event-specific) 방법은 도입유 전자가 삽입되어 새롭게 형성된 특정 염기부위를 검출할 수 있어 각 형질전환체의 계통간 구별이 가능하고 교배에 의해 파생된 개체의 모본을 쉽게 파악할 수 있어 GMO 모니터링 및 이력추적에 용이하다(Querci et al. 2007, Su et al. 2011, Zhang & Guo 2011, Shin et al. 2013). 본 연구에서는 국내 개발된 레스베라트롤 합성벼의 비의도적 방출여부 확인을 위 해 계통특이 primer를 제작하고 정성 PCR 검정법을 이용하 여 분석조건을 수립하고자 하였다.
재료 및 방법
식물재료
본 실험은 땅콩 유래의 stilbene synthase(STS, GenBank accession no. DQ124938) 유전자를 maize Ubi1 프로모터로 과발현 될 수 있도록 제조한 pSB2220 벡터를 동진벼(Oryza sativa subsp. japonica cv. Dongjin) 품종에 형질전환하여 종 자에서 레스베라트롤이 생성되도록 개발한 Agb0102 벼 및 교배종을 사용하였다(Baek et al. 2013). PCR 증폭의 특이성 확인을 위한 대조구로 동진벼 모본과 재배품종 21종(삼광, 금 오, 동안, 설향찰, 영안, 오대, 남평, 낙동, 운광, 하이아미, 칠 보, 소비, 안미, 화성, 화영, 큰섬, 한아름, 다산, 안다, 일품, 일미)을 사용하였다.
DNA 추출
Total genomic DNA(gDNA) 추출은 각 벼 품종의 잎 조 직 1g씩을 취하여 막자사발에 액체질소를 넣어 분말화한 후 GeneJETTMPlantGenomicDNApurificationkit(ThermoScient ific,EU)를 이용하여 제조사의 매뉴얼에 따라 추출하였다. 추 출된 gDNA는 NanoDrop spectrophotometer ND-1000 (NanoDrop technologies Inc., Wilmington, DE, USA)을 이 용하여 정량 하였다.
계통 특이성 primer 제작 및 PCR 증폭 분석
기존에 보고된 Agb0102 GM 벼의 형질전환 binary 벡터 및 T-DNA 삽입부위 인접 염기서열 정보(Qin et al. 2013)를 기초로 RAP-DB(http://rapdb.dna.affrc.go.jp) Blast 분석 및 ClustalW2 program(EMBL-EBI, http://www.ebi.ac.uk)을 이용한 염기서열 상동성 분석을 실시하여 인접 염기서열 및 도입유전자 부위에 대한 검정 특이 프라이머를 제작하였다 (Table 1). 제작된 프라이머는 PCR 증폭 반응의 특이성 확인 을 위해 반응온도, 프라이머 농도 및 gDNA의 농도에 따른 영향을 조사하였고, 프라이머의 검정 정확성을 확인하기 위하 여 GM 벼 및 대조 품종에 대한 분석을 수행하였다.
기본 PCR 반응은 시료당 총 50 μL로 하여 25 μL의 SapphireAmp Fast PCR Master Mix (Takara Bio Inc., Madison, WI, USA)를 사용하여 각각 2 μL의 10 nmole 프 라이머와 200 ng의 주형 gDNA가 포함되도록 조성되도록 하 였다. 반응조건은 94℃에서 5분간 전처리 후 94℃ 1 min, 6 4℃ 1 min, 72℃ 1 min을 1 주기(Cycle)로 하여 34회 연속 반응 시킨 후 5분간 72℃에서 후 처리하였다. 증폭된 PCR 산물은 EtBr이 함유된 1% agarose gel에 전기영동 하여 UV 로 확인하였다.
Fig. 1. Nucleotide sequence comparison of T-DNA flanking region of the chromosome 12 and similar nucleotide sequences of rice chromosome 11 for primer construction. The underlined sequences and boxed sequence indicate T-DNA insertion site and the locations of primer on T-DNA flanking region, respectively.
결과 및 고찰
Agb0102 벼의 계통 특이 프라이머 제작
국내에서 상용화되어 재배되고 있는 GM작물은 현재까지 전무하지만 국제적 GM작물의 증가추세를 고려하면 국내에 서도 상용화된 GM작물의 재배가 멀지 않으리라 예상된다.
국내에서 개발되고 있는 GM작물 가운데 레스베라트롤 합성 Agb0102 벼는 안전성 평가 연구단계를 거쳐 상업화를 위한 위해성평가심사 자료를 준비 중이다. GM작물은 상업화 승인 이후에도 비의도적 환경방출에 따른 안전성 확보를 위해 사 후 모니터링 기술이 필수적이다.
Agb0102 벼의 상업화 이후를 대비한 모니터링 기술의 일 환으로 Agb0102 벼의 계통 특이 PCR 마커를 개발하고자, 도입유전자가 삽입된 12번 염색체(Chromosome)의 T-DNA 인접 벼 유전체(Genome)의 염기서열을 이용하여 벼 전체 유 전자에 대한 상동성을 분석해 보았다. 염기서열의 상동성 분 석결과 염색체 12번의 T-DNA 인접서열은 11번 염색체의 염 기서열과 매우 높은 상동성이 있는 것으로 나타났다(Fig. 1).
T-DNA의 특이적 PCR 증폭을 위해 T-DNA의 양 방향 인접 염기서열 가운데 11번 염색체의 염기서열과 비교적 상이한 부분의 염기서열 정보를 이용하여 PCR증폭을 위한 P1 및 P2
primer를 제작하였다. Agb0102 벼의 도입유전자는 두 개의 T-DNA가 RB방향으로 inverted repeat된 형태로 구성되어 있다(Qin et al. 2013). 도입유전자의 특이적 검출을 위해 T-DNA 부위의 LB 부분에 인접한 CaMV 35S terminator 부 위의 염기서열을 이용하여 P3 primer를 제작하여 PCR 분석 에 이용하였다(Fig. 2).
PCR 증폭 방법을 이용한 Agb0102 벼 검출 조건 확립 제작된 P1, P2 및 P3 primer들의 조합별 PCR 증폭의 특이 성을 확인하고자 Agb0102와 형질전환 모본인 동진벼에서 추 출한 gDNA를 주형으로 PCR을 수행하였다(Fig. 3). Agb0102 벼에서 T-DNA가 도입된 벼 인접서열에 특이적인 P1과 P2 primer를 이용한 PCR 반응에서 동진벼에서는 약 1.0 kb의 증폭산물이 생성된 반면 Agb0102 벼에서는 특정 증폭산물이 생성되지 않았다. 또한 T-DNA 부분 특이적 P3 primer를 P1 또는 P2 primer와 함께 이용한 경우 동진벼에서는 PCR 증폭 이 일어나지 않았지만 Agb0102에서는 약 400 bp 및 700 bp 의 DNA가 증폭되었다. PCR 증폭밴드를 추출하여 염기서열 분석을 수행한 결과 기대한 염기서열로 확인되었다. 따라서 제작한 primer 조합은 Agb0102 벼의 특이적 검정마커로 사 용 가능한 것으로 판단된다.
韓育誌(Korean J. Breed. Sci.) 48(2), 2016
122Fig. 2. Schematic diagram of the T-DNA region of Agb0102 GM rice plant and PCR strategy for specific detection to differentiate from other non-transgenic rice varieties. The P1 and P2 primer were designed from flanking sequence of rice genomic DNA, and the P3 primer was specific to 35S terminator of T-DNA. The black arrows indicate the primers and their direction.
Fig. 3. PCR amplification analysis of the specific primer pairs to GM Agb0102 event and non-GM rice plants. The amplification products of gDNA extracted from GM or non-GM rice plants were electrophoresed on a 1.0% agarose gel. The gDNA samples used as the template and the primers used in the PCR are shown in the image. M: DNA molecular size marker, N: negative control (distilled water).
일반적으로 GM작물의 개발과정은 도입유전자의 분리가 일어나지 않는 homogeneous한 계통을 선발 육성하여 안전성 평가 및 우량 계통(event)을 육성한다. 따라서 도입유전자의 homogeneity분석은 GMO 모니터링에 유용하게 활용할 수 있다. 즉 GMO 재배포장 주변에 대한 모니터링 과정에서 발
견된 식물체의 T-DNA가 homozygous 한 경우에는 종자로의 오염으로, heterozygous로 확인될 경우에는 화분에 의한 유전 자 이동으로 인한 환경방출로 경로를 판단할 수 있는 것이다.
도입유전자 확인을 위해 제작된 P1, P2 및 P3 primer를 함께 이용한 다중 PCR 증폭 조건에서 동진벼와 형질전환 벼의
Fig. 4. PCR amplification products on different concentrations of gDNA extracted from leaf (A) or milled rice grains (B) of GM rice Agb0102. Lanes 1-10: 100, 10, 1, 0.5, 0.25, 0.1, 0.05, 0.01, or 0.005 ng of gDNA were used as template with P1, P2, and P3 primers. M: DNA molecular size marker, N: negative control.
gDNA가 혼재한 이형 이배체 (Heterozygous diploid) 분석에 서 형질전환체에 특이적인 PCR 산물과 함께 T-DNA 도입부 위의 내재유전자가 모두 증폭되어 homozygous 형질전환계 통과 구별이 가능했다. 따라서 개발된 계통특이 검정방법은 도입유전자가 고정된 형질전환 계통 및 일반 벼 품종의 확인 뿐 아니라 heterozygous 교잡계통에 대해서도 확인이 가능한 것으로 판단된다.
일반적으로 프라이머의 특성, 중합효소의 활성 및 annealing 온도 등 여러 요인에 의해 PCR 증폭의 검출감도가 달라질 수 있다(Shin et al. 2009). GM벼 Agb0102의 PCR 검출감도를 확인하고자 잎과 종자에서 추출한 DNA를 농도별로 희석하 여 PCR 분석한 결과 1 ng 이상의 DNA를 주형으로 사용한 시료에서 뚜렷한 증폭밴드가 일정하게 나타나는 것을 확인할 수 있었다(Fig. 4). 따라서 이들 계통특이 마커를 이용하여 PCR분석을 수행한다면 비교적 낮은 농도의 DNA주형을 사 용하더라도 신속하고 정확하게 Agb0102 계통을 확인할 수 있을 것으로 판단된다.
Agb0102 계통 특이 마커를 이용한 후대교배 계통 및 국내 벼 품종 검정
재배되는 일반 벼 품종 간에도 gDNA의 유전적 다형성으 로 PCR 반응물의 패턴이 다르게 나타날 수 있다(Shin et al.
2009). 동진벼 및 Agb0102벼에서 특이적 반응이 확인된 프 라이머 조합을 이용하여 국내에서 재배되는 일반벼 품종 및 Agb0102 교배 계통에 대한 PCR증폭의 특이성을 확인하였 다. PCR 분석결과 일반 벼 품종들에서 분리한 gDNA를 주형 으로 사용한 반응에서는 Agb0102의 모본인 동진벼에서와 같 은 약 1 kb 산물의 DNA가 증폭된 반면 Agb0102 교배계통 에서는 Agb0102와 같은 DNA 증폭 밴드가 나타났다(Fig.
5). 이는 본 연구에서 개발된 계통특이적 마커로 다른 벼 품 종 및 교배계통에 대해서도 신속하고 정확하게 Agb0102 계 통을 판별해 낼 수 있음을 보여주는 것이다.
특이 마커를 이용한 검출법 개발은 상업화된 GM작물의 대 표적 정성분석 방법으로 RRS 콩(Berdal & Holst-Jensen 2001)과 옥수수(Hernández et al. 2003, Taverniers et al.
2005, Lee et al. 2006, Yang et al. 2005, Milcamps et al.
2009) 등에서 수행되어졌으며, 국내에서 개발된 벼 (Kim et al. 2005, Shin et al. 2009, 2013), 배추 (Lim et al. 2007), 들 깨 (Kim et al. 2006) 등에서도 특이마커를 이용한 정성분석 결과가 보고된 바 있다. 레스베라트롤 성분이 합성되도록 개발 된 Agb0102 벼는 최근 상업화를 위한 GMO 위해성 심사를 준비 중이다. 본 연구에서는 Agb0102 벼가 상업화되어 국내 에서 재배될 경우를 대비한 안전관리 방안의 일환으로 계통 특 이적 검출법을 개발하였다. 개발된 Agb0102 검정 방법은 형
韓育誌(Korean J. Breed. Sci.) 48(2), 2016
124Fig. 5. PCR amplification products of the event-specific primers (P1, P2, and P3) on some commercial rice varieties of Korea. Lane 1 and 31: Agb0102, lane 2 and 23: Dongjin, lane 3: Hwaseong, lane 4: Dongan, lane 5 and 26: Hwayoung, lane 6: Youngan, lane 7: Anmi, lane 8: Chilbo, lane 9: Unkwang, lane 10: Geumo, lane 11: Seolhyangchal, lane 12:
Nakdong, lane 13: Odae, lane 14 and 25: Nampyeong, lane 15: Sobi, lane 16: Hiami, lane 17: Samgwang, lane 18: Dasan, lane 19: Keunseom, lane 20: Anda, lane 21: Hanarem, lane 22: Ilpum, lane 24: Ilmi, lane 27:Agb0102/Donjin, lane 28: Agb0102/Donjin/Dongjin, 29 lane: Agb0102/Mipum, lane 30: Agb0102/Boramchan, M: DNA molecular size marker, N:
negative control.
질전환체와 일반벼 품종을 증폭 DNA의 크기에 의해 쉽게 구 별 가능해 추후 GMO 검출뿐 아니라 후대계통 육성 및 비의도 적 오염에 대비한 사후 모니터링에도 적용될 수 있을 것이다.
적 요
최근 생명공학 기술의 발달로 국내에서도 다수의 형질전환 작물들이 개발되어 상업화를 추진 중이다. 유전자변형 작물은 상업화 이후에도 환경 및 주변작물에 대한 영향에 대한 지속 적 평가가 필요하다. 본 연구는 국내에서 개발된 레스베라트 롤 합성 벼 Agb0102의 관리 및 환경 모니터링을 위해 도입 유전자와 삽입위치의 염기서열에 기초한 프라이머 조합을 이 용한 PCR 증폭으로 Agb0102 계통 확인을 위한 계통특이 검 정방법을 개발하였다. 본 연구에서 개발된 도입유전자 삽입부 위의 계통 특이 프라이머를 사용한 다중 PCR 검정 방법은 homozygous 및 heterozygous 상태의 Agb0102 벼와 일반품 종의 구별이 쉽고 간편해 GM작물의 이동성 연구뿐 아니라
비의도적 오염에 대비한 사후 모니터링 및 형질전환 후대교 배종 육성에도 유용하게 이용될 수 있을 것이다.
사 사
본 연구는 2015년도 농촌진흥청 국립농업과학원 농업과학 기술 연구개발사업(과제번호: PJ01090201) 및 농촌진흥청 차 세대 바이오그린21사업(과제번호: PJ01118802)에 의해 지원 되었습니다.
REFERENCES
1. Baek SH, Chung HJ, Lee HK, D’Souza R, Jeon Y, Kim HJ, Kweon SJ, Hong ST. 2014. Treatment of obesity with the resveratrol-enriched rice DJ-526. Sci. Rep. 4: 3879.
doi: 10.1038/srep03879.
2. Baek SH, Shin WC, Ryu HS, Lee DW, Moon E, Seo CS,
et al. 2013. Creation of resveratrol-enriched rice for the tr eatment of metabolic syndrome and related diseases. PLo S ONE 8: e57930. doi: 10.1371/journal.pone.0057930.
3. Berdal KG, Holst-Jensen. 2001. Roundup® soybean event-specific real-time quantitative PCR assay and estimation of the practical detection and quantification limits in GMO analyses. Eur. food Res. Technol. 213:
432-438.
4. Hernández M, Pla M, Esteve T, Prat S, Puigdomènech P, Ferrando A. 2003. A specific real-time quantitative PCR detection system for event MON810 in maize Yield Gard based on the 3'-transgene integration sequence.
Transgenic Res. 12: 179-189.
5. James C. 2014. Global status of commercialized biotech/GM crops: 2014. ISAAA Brief No. 49. ISAAA:
Ithaca, NY.
6. KBCH. 2015. Global area of GM crops & LMO major statistics. Biosafety Vol. 16 (No. 2), pp. 48-61. Korea biosafety clearing house, Korea.
7. Kim JH, Ahn JH, Song HS, Kim KH, Kim DH, Kim HY.
2006. Qualitative PCR detection of vitamin E-enriched GM perilla. J. Korean Soc. Appl. Biol. Chem. 49:
192-195.
8. Kim JH, Song HS, Hee SM, Ryu TH, Kim DH, Kim HY.
2005. Qualitative PCR detection of GM rices (Milyang 204 and Iksan 483) developed in Korea. J. Korean Soc.
Appl. Biol. Chem. 48: 335-338.
9. Lee SH, Min DM, Kim JK. 2006. Qualitative and quantitative polymerase chain reaction analysis for genetically modified maize MON863. J. Agric. Food Chem. 54: 1124-1129.
10. Lee TH, Seo JO, Do MH, Ji E, Baek SH, Kim SY. 2014.
Resveratrol-enriched rice down-regulates melanin synthesis in UVB-induced guinea pigs epidermal skin tissue. Biomol. Ther. 22: 431-437.
11. Lim SH, Kim NY, Lee SM, Woo HJ, Shin KS, Jin YM, Cho HS. 2007. Molecular characterization and event-specific marker development of insect resistant Chinese cabbage for environmental risk assessment. J.
Biotechnol. 34: 347-354.
12. Milcamps A, Rabe S, Cade R, De Framond AJ, Henriksson P, Kramer V, Lisboa D, Pastor-Benito S, Willits MG, Lawrence D, Van den Eede G. 2009.
Validity assessment of the detection method of maize event Bt10 through investigation of its molecular structure. J. Agric. Food Chem. 57: 3156-3163.
13. Qin Y, Ahn HI, Kweon SJ, Baek SH, Shin KS, Woo HJ, Cho HS, Lee JH, Lim MH. 2013. Molecular characterization of transgenic rice producing resveratrol.
Plant Breed. Biotech. 1: 406-415.
14. Querci M, Paoletti C, Van den Eede G. 2007. Collection of biosafety reviews (Vol. 3). From sampling to quantification: Developments and harmonization of procedures for GMO testing in the European Union, pp.
7-41. International Centre for genetic Engineering and Biotechnology, Italy.
15. Shin KS, Lee JH, Lim MH, Woo HJ, Qin Y, Cho HS.
2013. PCR detection methods for disease resistant genetically modified rice. Korean J. Intl. Agri. 25:
298-306.
16. Shin KS, Lee SM, Lim SH, Woo HJ, Cho HS, Lee KR, Lee MC, Kweon SJ, Suh SC. 2009. Molecular biological characteristics and analysis using the specific markers of leaf folder-resistant GM rice. J. Plant Biotechnol. 36:
115-123.
17. Su C, Xie J, Wang X. 2011. Integrated structure and event-specific real-time detection of transgenic cry1Ac/SCK rice Kefeng 6. Eur. Food Res. Technol. 232:
351-359.
18. Taverniers I, Windels P, Vaïtilingom M, Milcamps A, Van Bockstaele E, Van den Eede G, De Loose M. 2005.
Event-specific plasmid standards and real-time PCR methods for transgenic Bt11, Bt176, and GA21 maize and transgenic GT73 canola. J. Agric. Food Chem. 53:
3041-3052.
19. Yang L, Xu S, Pan A, Yin C, Zhang K, Wang Z, Zhou Z, Zhang D. 2005. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence. J. Agric. Food Chem.
53: 9312-9318.
20. Zhang D, Guo J. 2011. The development and standardization of testing methods for genetically modified organisms and their derived products. J.
Integrative Plant Biology 53: 539-551.