• 검색 결과가 없습니다.

APin APin APin APin expression expression expression expression during during during during amelogenesisamelogenesisamelogenesisamelogenesis

N/A
N/A
Protected

Academic year: 2022

Share "APin APin APin APin expression expression expression expression during during during during amelogenesisamelogenesisamelogenesisamelogenesis"

Copied!
41
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

2 2

20 0 00 0 07 7 7년 년 년 2 2 2 월 월 월 박

박사 사 사학 학 학위 위 위논 논 논문 문 문

APin APin APin

APin expression expression expression expression during during during amelogenesis during amelogenesis amelogenesis amelogenesis

조 조선 선 선대 대 대학 학 학교 교 교 대 대 대학 학 학원 원 원

치치의의의공공공학학학과과과

이 이 이 창 창 창 섭 섭 섭

(2)

APin APin APin

APin expression expression expression expression during during during amelogenesis during amelogenesis amelogenesis amelogenesis

법랑질 법랑질 법랑질

법랑질 형성과정 형성과정 형성과정 형성과정 중에 중에 중에 Apin중에 ApinApin의 Apin의 의 발현의 발현발현발현

2

2 20 0 00 0 07 7 7년 년 년 2 2 2월 월 월 일 일 일

조 조선 선 선대 대 대학 학 학교 교 교 대 대 대학 학 학원 원 원

치치의의의공공공학학학과과과

이 이 이 창 창 창 섭 섭 섭

(3)

APin APin APin

APin expression expression expression expression during during during amelogenesis during amelogenesis amelogenesis amelogenesis

지지도도도교교교수수수 김김김 흥흥흥 중중중

이 이

이 논논논문문문을을을 치치치의의의학학학 박박박사사사학학학위위위신신신청청청 논논논문문문으으으로로로 제제제출출출함함함...

2 2 20 0 00 0 06 6 6년 년 년 1 1 10 0 0월 월 월 일 일 일

조 조선 선 선대 대 대학 학 학교 교 교 대 대 대학 학 학원 원 원

치치의의의공공공학학학과과과

이 이 이 창 창 창 섭 섭 섭

(4)

이 이 이창 창 창섭 섭 섭의 의 의 박 박 박사 사 사학 학 학위 위 위 논 논 논문 문 문을 을 을 인 인 인준 준 준함 함 함

위 위

위원원원장장장 조조조선선선대대대학학학교교교 교교교 수수수 이이이 상상상 호호호 인인인 위위위 원원원 전전전북북북대대대학학학교교교 교교교 수수수 조조조 의의의 식식식 인인인 위위위 원원원 조조조선선선대대대학학학교교교 교교교 수수수 박박박 주주주 철철철 인인인 위위위 원원원 조조조선선선대대대학학학교교교 교교교 수수수 김김김 도도도 경경경 인인인 위위위 원원원 조조조선선선대대대학학학교교교 교교교 수수수 김김김 흥흥흥 중중중 인인인

2

2 20 0 00 0 06 6 6년 년 년 1 1 12 2 2월 월 월 일 일 일

조 조 조선 선 선대 대 대학 학 학교 교 교 대 대 대학 학 학원 원 원

(5)

T T TA A AB B BL L LE E E O O OF F F C C CO O ON N NT T TE E EN N NT T T

TTTAAABBBLLLEEE OOOFFF CCCOOONNNTTTEEENNNTTT...i

LLLIIISSSTTT OOOFFF FFFIIIGGGUUURRREEESSS...ii AAABBBSSSTTTRRRAAACCCTTT...iii ⅠⅠⅠ...IIINNNTTTRRROOODDDUUUCCCTTTIIIOOONNN...1

ⅡⅡⅡ...MMMAAATTTEEERRRIIIAAALLLSSS AAANNNDDD MMMEEETTTHHHOOODDDSSS...3

ⅢⅢⅢ...RRREEESSSUUULLLTTTSSS...9

ⅣⅣⅣ...DDDIIISSSCCCUUUSSSSSSIIIOOONNN...13

ⅤⅤⅤ...RRREEEFFFEEERRREEENNNCCCEEESSS...17

ⅥⅥⅥ...FFFIIIGGGUUURRREEE LLLEEEGGGEEENNNDDDSSS...22

ⅥⅥⅥ...FFFIIIGGGUUURRREEESSS...25 AAABBBSSSTTTRRRAAACCCTTT iiinnnKKKOOORRREEEAAANNN

(6)

L

L LI I IS S ST T T O O OF F F F F FI I IG G GU U UR R RE E ES S S

FFFiiiggg...111.Low magnificationmicrographsshowingAPinexpressionduring ameloblastdifferentiationinthemandibularincisor(1doldrat)...25

FFFiiiggg...222.Highmagnificationmicrographsofincisortissuesectionsfrom

16doldrats...26.

FFFiiiggg...333.RT-PCR analysisofmRNA expressionforenamelmatrixproteins andenzymesduringALC differentiationinvitro...27

FFFiiiggg...444.RT-PCR andreal-timePCR analysisoftheeffectofAPin

over-expressionandinactivation...28

FFFiiiggg...555.SubcellularlocalizationofAPinproteinbyimmunofluorescenceand theirsecretionintoculturemedia...29

(7)

A A

ABBBSSSTTTRRRAAACCCTTT APin

APin APin

APin expression expression expression during expression during during during amelogenesisamelogenesisamelogenesisamelogenesis

L L

Leeeeee,,,CCChhhaaannnggg---SSSeeeoooppp A

A

Adddvvviiisssooorrr:::PPPrrrooofff...KKKiiimmm,,,HHHeeeuuunnnggg---JJJoooooonnnggg,,,DDD...DDD...SSS...,,,PPPhhh...DDD... DDDeeepppaaarrrtttmmmeeennntttooofffDDDeeennntttaaalllEEEnnngggiiinnneeeeeerrriiinnnggg,,, GGGrrraaaddduuuaaattteeeSSSccchhhoooooolllooofffCCChhhooosssuuunnnUUUnnniiivvveeerrrsssiiitttyyy

Thisinvestigated theexpression and localization ofAPin cDNA,which was previously identified and cloned from a ratodontoblastcDNA library,during ameloblast differentiation in rat incisors using hybridization and immunohistochemistry. The subcellular localization of APin varied during ameloblast differentiation but was stage-specific. APin mRNA was not expressed in the preameloblasts, was weakly expressed in the secretory ameloblastsandstronglyexpressedinthematurationstageameloblastsaswell as in the junctional epithelium attached to the enamelof molars.In the maturation stage ameloblasts,APin protein was strongly expressed in the supranucleararea(Golgicomplex)ofthesmooth-endedameloblastsaswellas in both the supranuclear area and the ruffle end of the ruffle-ended ameloblasts.During theameloblast-lineagecellculture,APin wasexpressedat alow levelintheearlystages,butatahighlevelinthelatestageofculture,

(8)

which was equivalentto the maturation stage.APin protein was efficiently secretedfrom transfectedcellsin culture.Furthermore,itsover-expression and inactivation caused an increase and decrease in matrix metalloproteinase-20 (MMP-20) and tuftelin expression, respectively. These findings indicate a functionalroleforAPininthemineralizationandmaturationoftheenamelthat ismediatedbytheexpressionofMMP-20andtuftelin.

Keywords:APin,enamel,ameloblastdifferentiation,enamelmaturation

(9)

Ⅰ...IIINNNTTTRRROOODDDUUUCCCTTTIIIOOONNN

Enamelformationisacomplex andwell-coordinatedbiologicalprocessinvolving two major steps,secretion and maturation.During the secretory stage,tall columnar ameloblasts actively synthesize and secrete the enamel matrix proteins through Tomes'processes.These proteins include amelogenin (1,2), ameloblastin (3,4),enamelin (2),and tuftelin (5,6).Non-amelogenin enamel proteins, such as ameloblastin, enamelin, and tuftelin, are believed to be nucleatorsofhydroxyapatitecrystalformation during enamelmineralization (7, 8,9).In addition,MMP-20(enamelysin),which playsan importantrolein the degradationofamelogenin,issynthesizedandsecreted(10,11).Theamelogenin degradation induced by MMP-20 is believed to be essentialfor the axial growthofenamelcrystals(12,13).During thematuration stage,low columnar ameloblastsbecomelessactiveinthesynthesisandsecretionofenamelmatrix proteins.However,they synthesize and secrete Kallikrein-4 (KLK4),which degradesenamelproteinstopromoteenamelcrystalthickening (14,15).During this stage,ameloblasts develop eithera ruffle- orsmooth-end thatplays an importantrole in the mineralization and maturation ofenamelby removing water and the enamelmatrix degradation products as wellas transporting calcium (16,17).Although therehavebeen advancesin ourunderstanding of enamelformation,further studies willbe needed to better understand the precisemechanism ofenamelmineralizationandmaturation.

ThecloningofOD-314cDNA from aratodontoblastcDNA libraryandits expression in odontoblasts was previously reported (18). The cDNA was subsequently found to codefortheAPin protein,which wasrecently isolated as a secreted component of the amyloid deposits of a human calcifying

(10)

epithelialodontogenictumor(CEOT)(19). wasalsoreportedtobeoneof the genes strongly expressed in gastric cancerby the serialanalysis ofthe gene expression (SAGE) data (20).Recently,APin was identified from the secretomeprofileoftheratenamelorgan basedon asignaltrapmethodology, as wellas an acidic protein rich in glutamine and proline thatis strongly expressedinmaturationstageameloblasts(21).

hybridization(ISH)andimmunohistochemistry (IH)wereperformed inordertomorepreciselydefinethetemporo-spatialexpressionofAPinduring ameloblastdifferentiation.Inaninitialstepofinvestigating theroleofAPinin enamelformation,thisstudyexaminedtheeffectsofAPinover-expressionand inactivation on the expression of the enamel matrix protein mRNA in ameloblast-lineage cells (ALC) (22) using a reverse transcriptase polymerase chain reaction (RT-PCR), real-time PCR, and Western blot analysis.These studies show thatAPin is strongly expressed in maturation stage ameloblasts and that its expression is linked to the expression of MMP-20 and tuftelin, which are involved in enamel mineralization and maturation.

(11)

Ⅱ...MMMAAATTTEEERRRIIIAAALLLSSS AAANNNDDD MMMEEETTTHHHOOODDDSSS

Allexperimentalprocedures involving the use ofanimals were reviewed and approved by theAnimaland Human SubjectsResearch CommitteeatChosun UniversityofKorea.

SSSeeeqqquuueeennnccciiinnngggaaannndddssseeeqqquuueeennnccceeecccooommmpppaaarrriiisssooonnnooofffttthhheeeOOODDD---333111444ccclllooonnneee

The RNA from the odontoblasts/pulp cells of rat mandibular incisors was isolatedusing TRIzol(Invitrogen,Carlsbad,CA,USA)andconvertedtocDNA by reversetranscription (18).Thefulllength OD-314cDNA wasobtained by determining the 5'and 3'unidentified sequences using a RACE kit(Roche, Mannheim, Germany), employing 2 µg of the total RNA from the odontoblasts/pulpcellsasatemplate.ThegenespecificprimersusedforRACE were GSP1 (5'-CCACATAGGACATAGGACTAGCCTGCTG) and GSP2 (5'-GCAATTTCAGAGCGCCTTCAACTCCTGG). The 5'- and 3'-RACE products were ligated into pCR2.1-TOPO (Invitrogen) and sequenced with M13F (-47)and M13R (-48)primers.Theresulting sequenceswerecompared withthesequencesintheDNA databasesusingBLAST (NCBI).

HHHiiissstttooolllooogggyyy,,, hhhyyybbbrrriiidddiiizzzaaatttiiiooonnn(((IIISSSHHH)))aaannndddiiimmmmmmuuunnnooohhhiiissstttoooccchhheeemmmiiissstttrrryyy(((IIIHHH))) Sprague-Dawley rats (1, 16 and 41 d old) were perfused with 4%

paraformaldehyde in PBS. The mandibles were removed, decalcified and processed forembedding in paraffin.Six-µm thick mesio-distalserialsections ofthe mandibularincisors (1 and 16 d old rats)and molars (41 d old rats) were cut,de-paraffinized and stained with hematoxylin and eosin (H&E)for histology,orweresubjectedtoeitherISH orIH.

(12)

ForISH,the digoxygenin (DIG)-labeled APin sense and antisense cRNA probes were prepared from the OD-314 cDNA using a T7/Sp6 DIG RNA labelingkit(Roche),asdescribedpreviously(23).

ForIH,theAPin specificantibodieswereobtained by affinity purification ofthe APin antisera thathad been produced by immunizing rabbits with a synthetic peptide (Peptron,Seoul,Korea),STSPKPDTGNF,corresponding to thesequence,of241through to251ofthe278-residueratAPin.Thetitreof the APin antibodies was determined using an enzyme-linked immunosorbent assay (ELISA) before being used for Western blotting and immunohistochemistry.To localize APin,a biotin-labeled goatanti-rabbitIgG (1:200)wasusedtobind totherabbitanti-ratAPin antibody (0.2µg/ml)and the biotin was detected using the ABC kit(Vector,Burlingame,CA,USA).

Rabbit preimmune serum was used as a control and the sections were counterstainedwithhematoxylin.

CCCeeellllllcccuuullltttuuurrreeeaaannndddRRRTTT---PPPCCCRRR

ImmortalizedALCswerekindlyprovidedbyDr.T.Sugiyama(AkitaUniversity SchoolofMedicine,Akita,Japan)and cultured as previously described (22).

Theywereculturedfor3dontypeIcollagen-coatedculturedishescontaining MEM supplementedwith10% FBS,antibiotics(Invitrogen)and10ng/mlofthe recombinanthumanEGF (Sigma-Aldrich,St.Louis,MO,USA)(growthmedia).

In order to investigate the expression of the enamelmatrix proteins and enzymes during ameloblastdifferentiation,the confluentALCs (day 0)were cultured forup to 4wk in high-glucoseDMEM supplemented with thesame components(differentiationmedia).

ForRT-PCR analysis,the totalRNA from the ALCs was isolated using

(13)

TRIzol(Invitrogen)and used forcDNA synthesisand PCR amplification.The

Primer sequences used were: :

5'-ccagcaggctagtcctatgtcctatgtgg/5'-cgcgtcgacatgagatcagtg, : 5'-ccagagcatgataaggcagc/5'-gaactggcatcattggttgc, : 5'-aaaaggagaaggtccagaag/5'-tgcggaaggatagtaagtgt, : 5'-gacctatgccatgatgcctg/5'-cgctgataacggctgagtgt, : 5'-acaaaccctttataggagcc/5'-aattaaaatttgggcctacc, : 5'-agctgtgagcaactgatgactgga/5'-acagctagagccaagaacacacct, : 5'-aggagatgaggcagggaaga/5'-gttcccctgctctggcttac, and : 5'-accacagtccatgccatcac/5'-tccaccaccctgttgctgt(forward/reverse). was used as the reference gene fornormalization.The following PCR conditions were used:denaturation at 94℃ for 5min,followed by 35 cycles each of denaturation at94℃ for30s,primerannealing at60℃ for30s,and product extensionat72℃ for30s,withafinalextensionat72℃ for7min.ThePCR products were electrophoresed on a 1.5% agarose gel,stained with ethidium bromideandvisualizedunderUV light.

CCCooonnnssstttrrruuuccctttiiiooonnnooofffAAAPPPiiinnn---eeexxxppprrreeessssssiiinnngggaaannndddAAAPPPiiinnnsssiiiRRRNNNAAA---eeexxxppprrreeessssssiiinnngggppplllaaasssmmmiiiddd The coding portion of APin was PCR amplified from the rat fulllength OD-314cDNA (APincDNA)asatemplate.ThePCR productwasclonedinto the EcoRIsite in the sense orientation ofpcDNA3 (Invitrogen),a eukaryotic expression vector.Thepotentcytomegaloviruspromoter(pCMV)wasinserted intotheHindIIIsiteofpcDNA3.ExpressionofAPinwasdrivenbythepCMV intheALCs.

Based on the chosen 19-nucleotide APin siRNA sequence (5'-AAGTGCCTCAAGATCAAAC)usingthe"siRNA TargetFinderanddesign

(14)

Tool" (Ambion, Austin, TX, USA), APin siRNA-expressing plasmid was prepared using the p 1.0-U6 siRNA expression vector (Ambion) accordingtothemanufacturer'sinstructions.

TTTaaannnsssfffeeeccctttiiiooonnnaaannndddrrreeeaaalll---tttiiimmmeeePPPCCCRRR

The ALCs were plated (2 × 1055cells/60-mm dish)and cultured for24 h.

Then thecellsshowed approximately 50-60% cellconfluence.TheCellswere transientlytransfectedwith2µgofthepCMV drivenAPin-expressingplasmid, U6-APin siRNA-expressing plasmid,and the controlempty vector (Mock).

Transfections were performed using the Lipofectamine Plus (Invitrogen) according to the manufacturer's protocol.The experiments were performed threetimesinduplicate.

At6 h aftertransfection,thecells wereincubated for42 h in a growth mediasupplementedwith5% FBS.At48haftertransfection,theexpressionof the mRNAs for

and were assessed by RT-PCR using the same primer and PCR conditionsasdescribedabove.

For real-time PCR, specific primers of and weredesignedbasedon ratmRNA sequences.ThePrimersequences used were: :5'- aacactagagagctttgctgggct/5'- agatggtgtctgctgctgtgagaa,

:5'- agcagaacagagtaatgtggccct/5'- tgacagtcagcgttcttgatccga, : 5'- tgtctaagctcaaggtgccctgtt/5'- taagttgtccatgtgggtgctgga,and : 5'- tccagaacatcatccctgcctcta/5'- acaaagtggtcgttgagggcaatg (forward/reverse).

Setting these primers as a guide ofCybergreen Premix Sol(Bioneer,Seoul, Korea),theexpression quantity of and were confirmed by Exicycler(Bioneer).Significance ofthe observed △△Ctvalues

(15)

wasconfirmedstatistically by two-tailedStudent'st-test.Therelativeamount ofeach mRNA wasdetermined at50% levelsofPCR product,andnormalized withuseoftherelativeamountofGAPDH mRNA.

FFFllluuuooorrreeesssccceeennnccceeemmmiiicccrrrooossscccooopppyyyaaannndddWWWeeesssttteeerrrnnnbbblllooottttttiiinnnggg

The pCMV driven APin-expressing plasmid was transfected into C2C12 cells withtheLipofectaminePlus(Invitrogen)asdescribedabove,insix-wellculture platesforWesternblotsorLab-Tekchamberedcoverglasses(Nunc,Rochester, NY,USA)forfluorescencemicroscopy.Cellsweretreatedwith0.1% DMSO as vehiclealoneor10µg/mlbrefeldinA (Sigma-Aldrich).

For fluorescence microscopy, the cells were fixed with 4%

paraformaldehydein PBS for10min,permeabilizedwithTritonX-100inPBS, and quenched with NH4Cl(50mM)in PBS.Cellswereincubated for1h with theanti-APin antibody,washed with PBS,and then incubated for1h with a fluorescent-labeled secondary antibody (Vector).Thecellswerecounterstained withPI(propidium iodide)tovisualizethenucleus.Afterrinsing,thecellswere examinedwithfluorescencemicroscope(Olympus,Tokyo,Japan).

Western blotting analysiswasperformed toanalyzeAPin expression.The proteinswereextractedfrom thecelllysatesafterthecellshadbeenlysedina NP-40lysisbuffer(50mM Tris-Cl,pH 7.4,150mM NaCl,1% NP-40,2mM Na3VO4,2 mM Na4P2O7,50 mM NaF,2 mM EDTA,pH 7.4,10 µg/ml leupeptin, and aprotinin). The conditioned media were also collected and centrifuged at14,000 RPM for5 min at4℃ to removedead celldebris.The supernatantwereprecipitatedfor1h on icewith 10% trichliroaceticacid.The precipitated proteinswerelysed with lysisbufferasdescribed above.Samples were loaded on a denaturing 10-20% Tris-HCl polyacrylamide gel and

(16)

transferred to nitrocellulose membranes. APin was detected using the anti-rabbitAPin antibody (1:1500),goatanti-rabbit-IgG (1:10,000),and ECL detectionsystem (Amersham PharmaciaBiotech.,Piscataway,NJ,USA).

(17)

ⅢⅢⅢ...RRREEESSSUUULLLTTTSSS

SSSeeeqqquuueeennnccceeeaaannnaaalllyyysssiiisssoooffffffuuullllll---llleeennngggttthhhcccDDDNNNAAA ooofffrrraaatttOOODDD---333111444((( )))ccclllooonnneee

Thefull-lengthratOD-314cDNA hadan identicalnucleotidesequencetothat oftherat (Genebankaccessionno.DQ198380).Thecloned1191bpcDNA contained the entire 834 bp open reading frame,the 47 bp of 5' untranslatedregionandthe310bpof3'untranslatedregion(datanotshown).

Theopenreadingframeencodeda278-residueprotein.

EEExxxppprrreeessssssiiiooonnn ooofffAAAPPPiiinnn mmmRRRNNNAAA aaannnddd ppprrrooottteeeiiinnn ddduuurrriiinnnggg aaammmeeelllooobbblllaaassstttdddiiiffffffeeerrreeennntttiiiaaatttiiiooonnn

The continuously erupting mandibular incisors of the rat exhibited the sequential differentiation of ameloblasts: presecretory ameloblasts in the proximalregion,mature and postmaturation stage ameloblasts in the distal region, and secretory ameloblasts between them (Fig. 1A, C). ISH was performed with an APin-specific cRNA probe to determine if the APin transcriptappearsduring ameloblastdifferentiation.APinmRNA wasexpressed weakly in the secretory ameloblasts (Fig. 1B, 2G) but strongly in the maturation ameloblasts(Fig.1B,2H,I)andthejunctionalepithelium (Fig.2J), which originated from post-maturation stage ameloblasts.However,no APin mRNA wasexpressedinthepreameloblastsandpapillarycells(Fig.1A).

IH was carried out using affinity purified rabbit APin antibodies to determine the subcellular location of APin protein during ameloblast differentiation.Interestingly,thesubcellularlocalization ofAPin wasvariedbut wasstage-specificduringameloblastdifferentiation.APinwasnotexpressedin preameloblasts,weakly expressed in secretory ameloblasts (Fig.1C,2D),and

(18)

strongly expressed in the maturation (Fig. 2E, F), post-maturation stage ameloblasts(Fig.1C)andjunctionalepithelium boderingtheenamelofthefirst mandibularmolar(Fig.2L).In thesecretory ameloblasts,APin wasexpressed weakly in the cytoplasm and Tomes'processes,butstrongly on the enamel matrix deposited adjacentto theTomes'processes(Fig.2D).Thelocalization ofAPin in thematuration stageameloblastswasmoresignificant,with APin being detected strongly in the supranuclear region (Golgicomplexes)ofthe smooth-endedameloblasts(Fig.2E)aswellasinboththesupranuclearregion andtheruffleendoftheruffle-endedameloblasts(Fig.1C,2F).

AAAPPPiiinnnaaannndddeeennnaaammmeeelllmmmaaatttrrriiixxxgggeeennneeeeeexxxppprrreeessssssiiiooonnnddduuurrriiinnngggAAALLLCCC dddiiiffffffeeerrreeennntttiiiaaatttiiiooonnn

In order to determine the expression of APin,enamelmatrix proteins and enzymes during ALC differentiation ,the cells were cultured in the differentiationmedium forupto4wkandtheirlevelofmRNA expressionwas assessed by RT-PCR. The selective and time-dependent induction of the enamelmatrix proteinsand enzymeswasobserved during ALC differentiation (Fig.3A).APin and KLK4 mRNA expression gradually increased,whereas amelogenin,enamelin,andtuftelin mRNA transcription gradually decreased with cell differentiation (Fig.3A).The expression of MMP20 mRNA increased slightly from the beginning ofthe culture to 7 d,and decreased thereafter.

However,ameloblastin mRNA expression remained unchanged throughoutthe culture period.A similar APin protein expression pattern was observedby westernblotusingapolyclonalanti-rabbitAPinantibody(Fig.3B).

(19)

EEEffffffeeeccctttooofffAAAPPPiiinnn ooovvveeerrr---eeexxxppprrreeessssssiiiooonnn aaannnddd iiinnnaaaccctttiiivvvaaatttiiiooonnn ooonnn eeennnaaammmeeelllmmmaaatttrrriiixxx gggeeennneee eeexxxppprrreeessssssiiiooonnn

In an attemptto understand the function ofAPin in enamelformation,the effect of APin over-expression and inactivation on the expression of the mRNAsoftheenamelmatrix proteinsandenzymes wasexaminedby RT-PCR and real-time PCR. APin expression increased and decreased markedly after its over-expression and inactivation,respectively (Fig.4A).

Over-expression ofAPin in theALCsslightly up-regulated theexpression of tuftelin and MMP-20 mRNA, whereas their expression was markedly down-regulated by its inactivation (Fig.4A).However,the expression ofthe otherenamelmatrix proteinsandenzymesremainedunchangedwhentheAPin waseitherup-ordown-regulated(Fig.4A).

Real-timePCR wasalso performed to confirm therelativelevelofAPin, tuftelin and MMP-20expression afterover-expression andinactivation ofAPin.

APinmRNA wasdetectedafter2cyclesofPCR inover-expressiongroupand 17 cycles in inactivation group.In controland Mock group,the expression started after7-8cyclesofPCR (Fig.4B).ThedifferencesofCtvalueswere detected (data notshown).Consequently,over-expression ofAPin in ALCs up-regulated the expression of tuftelin and MMP-20, whereas siRNA inactivationofAPinmarkedlydecreasedtheirexpressions.

SSSuuubbbccceeelllllluuulllaaarrrlllooocccaaallliiizzzaaatttiiiooonnnooofffAAAPPPiiinnnppprrrooottteeeiiinnnaaannndddttthhheeeiiirrrssseeecccrrreeetttiiiooonnn iiinnncccuuullltttuuurrreeemmmeeedddiiiaaa

ImmunofluorescencewasperformedaftertransfectionwiththeAPin-expressing plasmid into C2C12 cells.APin protein was clearly localized to crescentlike structuresmostlyinthecytoplasm (Fig5A).Therelativetransfectionefficiency

(20)

wasapproximated visually and wasconfirmed by a second investigator.APin wasbarely expressed in normalC2C12cells.A conservativeestimateshowed thatatleast60% ofC2C12cellswereAPin-positivewhentransfectedwiththe APin-expressingplasmid(datanotshown).

Western blotting was performed to investigate the secretion ofAPin in culturemedia.Theprotein detectedby Westernblotting inthemediamigrated near their predicted molecular weight,around 30 kDa.When brefeldin,an inhibitorofprotein secretion,wasadded,theAPin protein wasnotdetectedin theconditionedmediaoftransfectedcells(Fig5B).ExpressionofAPinshowed a strong signal,around 30.6 kDa,in the totalcelllysate.Interestingly,when bredfeldinwasadded,thereweretwosignalsofAPinprotein,around30.6and 30kDa,inthecelllysate(Fig5B).

(21)

Ⅳ...DDDIIISSSCCCUUUSSSSSSIIIOOONNN

Inapreviousstudy,wedocumentedthepotentiallyodontoblast-specific/enriched ratcDNA clones obtained by suppression subtractive hybridization (18).The expression ofoneoftheclones,OD-314,in an odontoblasticcellculturewas verified by Northern blotting and wasfurthercharacterized (18).TheOD-314 clone showed abundant transcripts in odontoblast/pulp cells by Northern blotting.A predominanttranscriptat˜ 1.2kbandamuchfaintertranscriptat

˜2.2 kb in size were detected.These transcripts showed a pattern similarto thatdescribed forthe EO-009 in the ratincisorenamelorgan (21).In this study,the nucleotide and deduced amino acid sequencing ofthe full-length OD-314 cDNA revealed that itwas identicalto the sequencing ofthe rat EO-009cDNA encoding a 278-residue protein.A portion of deduced human EO-009 protein (residues127-279),conserved in ratand mouse,wasidentical to a protein named APin (21).Consequently,wenow refertheOD-314,gene productas .Althoughtheanalysisofthededucedaminoacidsequenceof thefulllength (EO-009)revealedthepresenceofasignalingpeptide(21), theAPinprotein from CEOT-associatedamyloiddoesnothaveasignalpeptide atits N terminus (19).Therefore,itwas postulated thata 153-amino acid APinproteinwasderivedfrom alongersecretedprecursorprotein(21).

In preliminary studiesweobserved expression ofAPin in ameloblastsand thattheexpressionwasmuchhigherinmaturationstageameloblastscompared toodontoblasts(datanotshown).Thisstudy showedthepresenceofAPin in the enamelmatrix deposited adjacent to the Tomes' processes during the secretory stage.These findings collectively indicate thatAPin is a secretory protein thatissynthesizedandsecretedby secretory ameloblasts.Interestingly,

(22)

among the oralmucosa examined,only the junctionalepithelium expressed APin. This unique APin expression in the junctional epithelium and maturation/postmaturationstageameloblastssupportsthenotion thattheorigin of the junctional epithelium is the reduced enamel epithelium (24, 25).

Therefore,APin,alongwithamelotin(26)canberegardedasamarkerforthe junctionalepithelium to differentiate itfrom the sulcular,gingivaland other epithelia in the oral mucosa.It would be interesting to determine if the junctionalepithelium,unlikeotherepithelia,hasany otheruniquefunction(s)in maintainingtheenamelsurface.

WhentheALCswereculturedforupto4wkinthedifferentiationmedia, they differentiated and sequentially expressed the enamelmatrix proteins and enzymesasshown during ameloblastdifferentiation .Theability ofthe ALCstoexpressseveralameloblastspecificgenes indicatesthatALCs are relatively undifferentiated and undergo differentiation under the culture conditions.Therefore,ALCs are an invaluable cellline thatcan be used to examine the regulatory mechanisms ofameloblastdifferentiation and enamel matrix formation (22).WefoundthatAPin wasexpressedfirstby ALCsat4 d with thehighestlevelat28d,which isequivalenttothematuration stage.

Over-expression ofAPin in theALCsslightly up-regulated theexpression of tuftelin and MMP-20 mRNA, whereas their expression was markedly down-regulatedby itsinactivation.Itstrongly suggeststhatAPin regulatethe expression ofMMP-20andtuftelin.However,in both cases,theexpression of the other enamel matrix proteins remained unchanged. In this study, APin-expressing plasmid was transiently transfected into ALCs showing 50-60% cellconfluence,and the expression of APin and the other enamel matrix proteinswereevaluated at48 h aftertransfection,which isequivalent

(23)

to theconfluentstage(day 0)during ALCsdifferentiation.Itimpliesthatthe cellscouldnotreachthedifferentiationtoexpresstheenamelmatrixgeneyet.

In this study,we investigated if APin was in fact secreted from the culturedcells.MousemyogenicC2C12cellswerechosenduetotheabsenceof endogenous APin mRNA expression,as determined by RT-PCR (data not shown).Thecells transfected with theAPin-expressing plasmid showed high levelofpeptidein thecytolsol,asobserved by fluorescencemicroscope.After transfectiontheproteinsdetectedbyWesternblottinginthecelllysateandthe media migrated at their predicted molecular weights,i.e.30.6 and 30 kDa, respectively.The protein detected in the celllysate had a slightly slower migration behavioras compared to thatobserved in the culture media.This suggeststhesecreted APin waspost-translationally modified.However,itwill beofgreatimportancetoexactlydetermineifthesetwoAPinproteinproducts show differentlocationseitherintheextracellularenamelmatrixasasecretory protein orin theintracellularlocationssuch asthesupranucleararea and the ruffleend.

Enamelmineralization and maturation are achieved through two major steps. During the secretory stage, ameloblasts secret MMP-20, which is involved in an extracellular enzymatic cleavage of amelogenin into small peptidespriorto theirremovalby endocytosis(27,28).Oneapparentfunction ofproteolysisduring thesecretory stageistoproducethespacefortheaxial crystallitegrowth (29).Thisisfacilitatedfurtherby theremovalofwaterand enamelmatrix degradation productsduring thematuration stage,allowing the mineralization andmaturation oftheenamelcontinueuntilenamelformation is completed. The maturation ameloblasts also synthesize and secrete KLK4, which degrades the remaining enamel matrix degradation products (15),

(24)

contributing to crystallite thickening and hardening of the enamel (14).

Furthermore, maturation stage ameloblasts cycle between ruffle- and smooth-ended phenotypes,which both have well-developed Golgicomplexes containing numerousGolgicisternae,lysosomesand multivascularbodies(16).

The ruffleend,a zone ofinfolded cellmembrane,is characteristically formed duringphasesofcalcium transportandwhentheresorptionofdegradedenamel matrix occurs(30,31).Thelocalization ofAPin in theruffleend,butnoton thesmoothend,ofmaturation ameloblastsindicatesthatAPinmay functionin these processes. Although the staining in the ruffle end may represent degraded APin being internalized, as observed for degraded amelogenin products,amelogenin is notfound in the supranuclear area (32).Thus,the intense staining forAPin in the supranucleararea togetherwith the strong signalforAPin mRNA in the maturation ameloblasts indicates thatAPin is highly expressed in thesecellsand asaconsequencethestaining ofAPin in theruffleendismorelikelytorelatetoafunctionincalcium transport,which is associated with the presence ofruffle-ended ameloblasts (33,34,35).This notion is supported by the ability ofrecombinantAPin to bind to EF-hand calcium binding proteinsparvalbumin (unpublished data)using protoarray.The EF-hand calcium-binding protein parvalbumin could buffercalcium specifically inthecellsproducingmineralizedenamelanddentineduringthelaterstagesof toothdevelopment(36).

In summary,although further studies willbe needed to understand the precise function ofAPin in amelogenesis,these results suggestthatAPin is involved in the mineralization and maturation of the enamel,possibly by regulate the expression of MMP-20 and tuftelin and/or aiding in the transportingcalcium duringthematurationstage.

(25)

ⅤⅤⅤ...RRREEEFFFEEERRREEENNNCCCEEESSS

1.Gibson CW,Yuan ZA,HallB,Longenecker G,Chen E,Thyagarajan T, Sreenath T,WrightJT,Decker S,Piddington R,Harrison G,KulkarniAB.

Amelogenin-deficientmicedisplayanamelogenesisimperfectaphenotype.JBiol Chem 2001;276:31871-31875.

2.Hu JC,Sun X,Zhang C,Simmer JP.A comparison of enamelin and amelogenin expression in developing mousemolars.EurJOralSci2001;109:

125-132.

3.Fukumoto S,Kiba T,HallB,Iehara N,Nakamura T,Longenecker G, Krebsbach PH,NanciA,KulkarniAB,Yamada Y.Ameloblastin is a cell adhesion molecule required for maintaining the differentiation state of ameloblasts.JCellBiol2004;167:973-983.

4.Krebsbach PH,Lee SK,MatsukiY,Kozak CA,Yamada KM,Yamada Y.

Full-lengthsequence,localization,andchromosomalmapping ofameloblastin.A noveltooth-specificgene.JBiolChem 1996;271:4431-4435.

5. Bashir MM, Abrams WR, Rosenbloom J. Molecular cloning and characterizationofthebovinetuftelingene.ArchOralBiol1997;42:489-496.

6.Deutsch D,Palmon A,Fisher LW,Kolodny N,Termine JD,Young MF.

Sequencing ofbovineenamelin("tuftelin")anovelacidicenamelprotein.JBiol Chem 1991;266:16021-16028.

7.Deutsch D,DafniL,Catalano-Sherman J,Young MF,Fisher LW.The enamelin(tuftelin)gene.IntJDevBiol1995;39:135-43.

8.StephanopoulosG,GarefalakiM-E,Lyroudia K.Genesand related proteins involvedinamelogenesisimperfecta.JDentRes2005;84:117-1126.

9.WrightJT,HartPS,Aldred MJ,Seow K,Crawford PJ,Hong SP,Gibson

(26)

CW, Hart TC. Relationship of phenotype and genotype in X-linked amelogenesisimperfecta.ConnectTissueRes2003;44(Suppl):72S-78S.

10.BartlettJD,Beniash E,Lee DH,Smith CE.Decreased mineralcontentin MMP-20nullmouseenamelisprominentduring thematuration stage.JDent Res2004;83:909-913.

11.Caterina JJ,Skobe Z,ShiJ,Ding Y,Simmer JP,Birkedal-Hansen H, BartlettJD.Enamelysin(Matrix Metalloproteinase20)-deficientmicedisplay an amelogenesisimperfectaphenotype.JBiolChem 2002;277:49598-49604.

12.Hu JC,Sun X,Zhang C,Liu S,BartlettJD,SimmerJP.Enamelysin and kallikrein-4 mRNA expression in developing mouse molars.Eur J OralSci 2002;110:307-315.

13.Takata T,Zhao M,Uchida T,Wang T,AokiT,BartlettJD,NikaiH.

Immunohistochemicaldetection and distribution of enamelysin (MMP-20) in humanodontogenictumors.JDentRes2000;79:1608-1613.

14. Simmer JP, Hu JC. Expression, structure, and function of enamel proteinases.ConnectTissueRes2002;43:441-449.

15.HartPS,HartTC,Michalec MD,Ryu OH,Simmons D,Hong S,Wright JT. Mutation in kallikrein 4 causes autosomal recessive hypomaturation amelogenesisimperfecta.JMedGenet2004;41:545-549.

16. Nanci A, Slavkin HC, Smith CE. Application of high-resolution immunocytochemistry tothestudy ofthesecretory,resorptive,anddegradative functionsofameloblasts.AdvDentRes1987;1:148-161.

17.Takano Y.Enamelmineralization and the role ofameloblasts in calcium transport.ConnectTissueRes1995;33:127-137.

18.Dey R,Son HH,Cho MI. Isolation and partialsequencing ofpotentially odontoblast-specific/enriched rat cDNA clones obtained by suppression

(27)

subtractivehybridization.ArchOralBiol2001;46:249-260.

19.SolomonA,MurphyCL,WeaverK,WeissDT,HrncicR,EulitzM,Donnell RL,Sletten K,Westermark G,Westermark P.Calcifying epithelialodontogenic (Pindborg)tumor-associated amyloid consistsofanovelhuman protein.JLab ClinMed2003;142:348-355.

20. Aung PP, Oue N, Mitani Y, Nakayama H, Yoshida K, Noguchi T, BosserhoffAK,YasuiW.Systemic search for gastric cancer-specific genes based on SAGE data: melanoma inhibitory activity and matrix metalloproteinase-10 are novel prognostic factors in patients with gastric cancer.Oncogene2006;25:2546-2557.

21.MoffattP,SmithCE,SooknananR,St-ArnaudR,NanciA.Identificationof secreted and membrane proteins in the rat incisor enamelorgan using a signal-trapscreeningapproach.EurJOralSci2006;114(Suppl):139S-146S.

22.NakataA,KamedaT,NagaiH,IkegamiK,Duan Y,TeradaK,Sugiyama T.Establishmentand characterization ofa spontaneously immortalized mouse ameloblast-lineagecellline.Biochem BiophysResCommun2003;308:834-839.

23.ParkJC,Kim YB,Kim HJ,JangHS,Kim HS,Kim BO,HanKY.Isolation and characterization ofcultured human periodentalligamentfibroblast-specific cDNAs.Biochem BiophysResCommun2001;282:1145-1153.

24.GlavindL,ZanderHA.Dynamicsofdentalepithelium duringtootheruption.

JDentRes1970;49:549-555.

25.SchroederHE,Listgarten MA.Fine structure ofthe developing epithelial attachmentofhumanteeth.MonogrDevBiol1971;2:1-134.

26. Moffatt P, Smith CE, St-Arnaud R, Simmons D, Wright JT, Nanci A.Cloning ofratamelotinandlocalizationoftheproteintothebasallaminaof maturationstageameloblastsandjunctionalepithelium.Biochem J2006;397:in

(28)

press.

27. Tanabe T, Fukae M, Uchida T, Shimizu M. The localization and characterization ofproteinases forthe initialcleavage ofporcine amelogenin.

CalcifTissueInt1992;51:213-217.

28.Fukae M,Tanabe T.Degradation ofenamelmatrix proteins in porcine secretoryenamel.ConnectTissueRes1998;39:123-129.

29.Beniash E,Simmer JP,Margolis HC.The effectofrecombinantmouse amelogenins on the formation and organization ofhydroxyapatite crystals in vitro.JStructBiol2005;149:182-190.

30.Kallenbach E.Fine structure of rat incisor ameloblasts during enamel maturation.JUltrastructRes1968;22:90-119.

31.ReithEJ.Thestagesofamelogenesisasobservedin molarteethofyoung rats.JUltrastructRes1970;30:111-151.

32. Inage T, Shimokawa H, Teranishi Y, Iwase T, Toda Y, Moro I.

Immunocytochemicaldemonstration ofamelogenins and enamelins secreted by ameloblastsduringthesecretoryandmaturationstages.ArchHistolCytol1989;

52:213-229.

33.TakanoY,Crenshaw MA,Reith EJ.Correlation of45Caincorporation with maturationameloblastmorphologyintheratincisor.CalcifTissueInt1982;34:

211-213.

34.Reith EJ,BoydeA.Autoradiographicevidenceofcyclicalentry ofcalcium into maturing enamel of the rat incisor tooth.Arch Oral Biol.1981; 26:

983-987.

35. Salama AH, Zaki AE, Eisenmann DR. Cytochemical localization of Ca2+-Mg2+ adenosine triphosphatase in ratincisorameloblasts during enamel secretionandmaturation.JHistochem Cytochem 1987;35:471-482.

(29)

36.Davideau JL,Celio MR,Hotton D,BerdalA.Developmentalpattern and subcellularlocalization ofparvalbumin in the rattooth germ.Arch OralBiol 1993;38:707-715.

(30)

ⅥⅥⅥ...FFFIIIGGGUUURRREEE LLLEEEGGGEEENNNDDDSSS

FFFiiiggg... 111. Low magnification micrographs showing APin expression during ameloblastdifferentiation in the mandibular incisor (1 d old rat)by

hybridization (1A and B) and immunohistochemistry (1C).(A) Showing the strong APin mRNA expression in the maturation and postmaturation stage ameloblasts (arrow). (B) Showing the weak APin mRNA expression in secretory ameloblasts (S) and the strong expression in smooth-ended (SE) ameloblastsshown intherectangularareashowninFig.1A.(C)Showing the APinproteinlocalizationinsecretoryameloblasts(S)andthestrongexpression inthesmooth-ended(SE)aswellastheruffle-ended(RE)ameloblastsshown inanareamarkedwithtwolinesinFig.1A.Scalebar,20µm.

FFFiiiggg...222. High magnification micrographs ofincisortissuesections from 16 d old ratsafterH&E staining (A,B,C),immunohistochemicallocalization ofthe APin protein (D,E,F),and in situ hybridization ofAPin mRNA (G,H,I)in the secretory (A,D,G),smooth-ended (B,E,H)and ruffle-ended (C,F,I) ameloblasts.(A)Showing the Tome's processes (arrow).The insertin "C"

shows the ruffle-end (arrow) at high magnification.Note the weak APin localization in the cytoplasm and Tomes' processes (arrow) of secretory ameloblasts(D),contrasting thestrong staining intheenamelmatrix deposited adjacenttotheTomes'processes.Thestrong APin staining isevidentin the supranuclearregion (thick arrow)ofsmooth-endedameloblasts(E),aswellas in the supranuclear region (thick arrow) and ruffle-end (arrow) of the ruffle-ended ameloblasts (F).Note the weak APin mRNA expression in the secretory ameloblasts (G) but the strong expression in smooth- (H) and

(31)

ruffle-ended(I)ameloblasts.

ISH ofAPin mRNA (J) and IH ofAPin protein (L) in the junctional epithelium attachedtotheenamelofthemandibularmolars(41doldrat).Note the strong APin mRNA expression in the junctional epithelium of the interdentalareabetweenthefirst(M1)andsecond(M2)mandibularmolars(J), butnotin thecontroltissue(K).APin protein is specifically localized in the junctionalepithelium bordering theenamelofthefirstmandibularmolar(thick arrow),butnotin the sulcular epithelium (arrow,L).AB,ameloblasts;PL, papillarylayer;En,enamel.Scalebar,20µm.

FFFiiiggg...333.RT-PCR analysisofmRNA expression forenamelmatrix proteinsand enzymes during ALC differentiation . (A) Note the strong APin expression at 7 d and thereafter (equivalent to the maturation stage).(B) Western blot analysis of the expression pattern of APin during ALC differentiation .Theexpression oftheAPin protein appearedat4dand continuouslyincreasedthereafter.

FFFiiiggg...444.RT-PCR (A)andreal-timePCR (B,C)analysisoftheeffectofAPin over-expression and inactivation on mRNA expression for enamel matrix proteins and enzymes.The ALC Cells were transiently transfected with the pCMV driven APin-expressing plasmid,U6-APin siRNA-expressing plasmid, and thecontrolvector.(A)APin over-expression and inactivation changesthe expression oftuftelin andMMP-20.(B)Theamplification curvesfortheAPin reactionsincontrol,Mock,over-expression,andinactivationgroup.Therelative amountsoftuftelin (C)and MMP-20(D)mRNA,afternormalization with the amountsoftheGAPDH mRNA.Theresultswererepresentedasmeans± SD

(32)

of three independent transfections. The asterisks (*) indicate the values significantly differentfrom the controls according to the Student's ttest(P

<0.01). Control, normal ALC; Over, APin over-expression; inact, APin inactivation;Mock,ALC expressingemptyvector.

FFFiiiggg...555.SubcellularlocalizationofAPinprotein by immunofluorescence(A)and their secretion into culture media (B). The C2C12 cells were transiently transfected with theAPin-expressing plasmid.(A)Cellswerelabeled with an anti-APinantibodyandexaminedbyfluorescenceaftercounterstainingwithPI.

(B) The celllysates (lanes 1-2) and conditioned media (lanes 3-4) were analyzed forthepresenceofAPin protein by Western blotting.Expression of APin showed astrong signalin "Over"and two signalsin "Over+ Brefeldin A"ofthecelllysates.Apin protein wasdetectedasastrong signalin "Over"

oftheconditioned media,whiletheaddition ofbrefeldin A caused no specific signal in the conditioned media. PI. Propidium iodide; Over, APin over-expression;Over + Brefeldin A,APin over-expression and Brefeldin A treatment.

(33)

ⅥⅥⅥ...FFFIIIGGGUUURRREEESSS

FFFiiiggg...111...

(34)

FFFiiiggg...222...

(35)

FFFiiiggg...333...

(36)

FFFiiiggg...444...

(37)

FFFiiiggg...555...

(38)

A A

ABBBSSSTTTRRRAAACCCTTT iiinnnKKKOOORRREEEAAANNN

법 법

법랑랑랑질질질 형형형성성성과과과정정정중중중에에에 AAAPPPiiinnn의의의 발발발현현현

이 이

이 창 창 창 섭 섭 섭

조 조 조선 선 선대 대 대학 학 학교 교 교 대 대 대학 학 학원 원 원 치 치 치의 의 의공 공 공학 학 학과 과 과 ( ( (지 지 지도 도 도교 교 교수 수 수: : :김 김 김흥 흥 흥중 중 중) ) )

이 연구에서는 흰쥐 절치의 법랑모세포 분과과정 중에 전에 흰쥐 상아모세포 에서부터 분리된 APin의 발현을 hybridization과 면역조직화학적방법 이용 하여 연구하여 다음과 같은 결과를 얻었다.

APin의 세포내 발현(subcellularlocalization)은 법랑모세포 분화과정 중에 다 양하게 나타났다.APin mRNA는 법랑모세포전구세포(preameloblasts)에서는 발현 이 되지 않았고,분비기 법랑모세포(secretoryameloblasts)에서는 약하게 발현되었 으며,구치의 법랑질에 부착된 부착상피(junctionalepithelium)뿐 아니라 성숙기의 법랑모세포(maturation stageameloblasts)에서 강하게 발현되었다.성숙기 법랑모 세포에서 APin 단백질은 ruffle-ended 법랑모세포의 supranuclear area와 ruffle end뿐 아니라 smooth-ended법랑모세포의 supranucleararea(Golgicomplex)에 서 강하게 발현되었다.법랑모세포주(ACL)배양 동안에 APin의 발현은 배양 초기 에는 약하였으나 성숙기에 해당되는 배양의 말기에는 강하게 발현되었다.APin단 백질은 배양한 transfectedcell로부터 효과적으로 분비되었으며,더더욱 그의 과발 현은 matrix metalloproteinase-20과 tuftelin의 발현을 증가시겼고,발현억제는 이

(39)

들의 발현을 감소시켰다.

위의 결과들은 MMP-20과 tuftelin의 발현에 의해 조절되는 법랑질의 석회화 와 성숙에 있어서 APin의 기능적 역할을 암시한다.

Keywords:APin,법랑질,법랑모세포 분화,법랑질 성숙

(40)

저 저 저작 작 작물 물 물 이 이 이용 용 용 허 허 허락 락 락서 서 서

학 과 치의공학과 학 번 20057741 과 정 박사 성 명 한글 :이 창 섭 영문 :Lee,Chang-Seop

주 소 광주광역시 서구 풍암동 현대삼환아파트 102동 201호 연락처 E-MAIL:

논문제목

한글:법랑질 형성과정 중에 APin의 발현 영문:APinexpressionduringamelogenesis

본인이 저작한 위의 저작물에 대하여 다음과 같은 조건아래 조선대학교가 저작물을 이용할 수 있도록 허락하고 동의합니다.

-다 음 -

1.저작물의 DB구축 및 인터넷을 포함한 정보통신망에의 공개를 위한 저작물의 복제, 기억장치에의 저장,전송 등을 허락함

2.위의 목적을 위하여 필요한 범위 내에서의 편집ㆍ형식상의 변경을 허락함.다만, 저작물의 내용변경은 금지함.

3.배포ㆍ전송된 저작물의 영리적 목적을 위한 복제,저장,전송 등은 금지함.

4.저작물에 대한 이용기간은 5년으로 하고,기간종료 3개월 이내에 별도의 의사 표시가 없을 경우에는 저작물의 이용기간을 계속 연장함.

5.해당 저작물의 저작권을 타인에게 양도하거나 또는 출판을 허락을 하였을 경우에는 1개월 이내에 대학에 이를 통보함.

6.조선대학교는 저작물의 이용허락 이후 해당 저작물로 인하여 발생하는 타인에 의한 권리 침해에 대하여 일체의 법적 책임을 지지 않음

7.소속대학의 협정기관에 저작물의 제공 및 인터넷 등 정보통신망을 이용한 저작물의 전송ㆍ출력을 허락함.

동의의여여부부 :::동동의의(((OOO ))) 반반대대((( ))) 2006년 12월

저작자: 이 (서명 또는 인)

조 조

조선 선 선대 대 대학 학 학교 교 교 총 총 총장 장 장 귀 귀 귀하 하 하

(41)

참조

관련 문서