저작자표시

저작자표시-비영리-변경금지 2.0 대한민국

이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게

l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. 다음과 같은 조건을 따라야 합니다:

l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건 을 명확하게 나타내어야 합니다.

l 저작권자로부터 별도의 허가를 받으면 이러한 조건들은 적용되지 않습니다.

저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다.

이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다.

Disclaimer

저작자표시. 귀하는 원저작자를 표시하여야 합니다.

비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.

변경금지. 귀하는 이 저작물을 개작, 변형 또는 가공할 수 없습니다.

이학 석사학위 논문

DFNA5에 의한 세포고사 엑소좀의 생합성에 관여하는 ESCRT

복합체의 활성 기전

아 주 대 학 교 대 학 원 의생명과학과

김 연 지

DFNA5에 의한 세포고사 엑소좀의 생합성에 관여하는 ESCRT

복합체의 활성 기전

지도교수 최용준

이 논문을 이학 석사학위 논문으로 제출함.

2021년 2월

아 주 대 학 교 대 학 원 의생명과학과

김연지

김연지의 이학 석사학위 논문을 인준함.

심사위원장 최 용 준 인

심사위원장 권 명 희 인

심사위원장 김 경 민 인

아 주 대 학 교 대 학 원

2021년 1월 7일

i -국문요약-

DFNA5에 의한 세포고사 엑소좀의 생합성에 관여하는 ESCRT 복합체의 활성 기전

세포의 고사 과정 중 분비되는 엔도좀 (endosome)기원의 세포밖 소포체 (Extracellular vesicle: EV)인 세포고사 엑소좀 (apoptotic exosome: ApoExos)은 엑소좀의 특징을 가지며, 손상연관분자유형 (damage-associated molecular patterns: DAMPs)으로서 염증반응을 유도한다. Gasdermin (GSDM) family중 DFNA5 (GSDME)는 아포토시스 (apoptosis)에서 케스페이즈-3 (caspase-3)의 활성으로 잘린 N-말단 단면이 세포막에 구멍을 형성하고, 파이롭토시스 (pyroptosis)를 일으킨다. 본 연구에서는 DFNA5에 의한 ApoExo합성 증가에서 endosomal-sorting required for transport (ESCRT) 복합체의 역할을 규명하고자 하였다. 케스페이즈의 활성으로 잘려 나온 DFNA5의 N-말단 도메인은 엔도좀의 외막에 구멍을 형성하고, 이 구멍을 통해 외부로부터 세포질 내부로 칼슘 이온이 유입된다. 국소적으로 세포질 내에 증가한 칼슘 이온은 DFNA5에 의한 ApoExo의 생합성 증가에 결정적인 역할을 하며, 칼슘에 의해 활성화되는 단백질인 annexin, penta-EF hand 단백질 (gracalcin과 sorcin) 및 ESCRT-

Ⅲ를 엔도좀 막으로 불러 모아 복합체를 형성한다. 이렇게 형성된 복합체는 엔도좀 막을 방출시켜 내강소낭 (intraluminal vesicle) 합성에 관여할 것으로 생각된다. 그러므로 DFNA5에 의한 칼슘 이온 증가와 annexin, penta-EF hand 단백질, 마지막으로 ESCRT-Ⅲ를 이루는 분자적 기전을 규명하는 추가적인 연구가 필요하다.

핵심어: 세포고사 엑소좀, 케스페이즈, DFNA5, ESCRT 복합체

ii 차례

국문요약 ⅰ 차례 ⅱ 그림 차례 ⅳ 표 차례 ⅴ

Ⅰ. 서론 1

Ⅱ. 재료 및 방법 6

A. 세포, 항체 및 시약 6

B. In-fusion cloning 6

C. Lentiviral vector transfection 7

D. Western blot 7

E. Apototic exosome (ApoExo) 확인 8

F. Immunoprecipitation (IP) 8

G. 공초점 현미경 (confocal microscopy) 9

Ⅲ. 결과 11

A. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs) 의 형성을 촉진한다 (1). 11

B. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs) 의 형성을 촉진한다 (2). 13

C. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs) 의 형성을 촉진한다 (3). 15

D. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs) 의 형성을 촉진한다 (4). 17

E. ESCRT 복합체는 apoptotic exosome의 발생에 관여한다. 19 F. DFNA5에 의한 ApoExo 발생을 위해 ESCRT 복합체가 필요하다 (1). 21 G. DFNA5에 의한 ApoExo 발생을 위해 ESCRT 복합체가 필요하다 (2). 24

iii

H. 세포 내 칼슘 이온의 증가는 apoptotic exosome발생에 관여한다. 26

I. DFNA5에 의한 apoptotic exosome 발생에 annexin이 관여한다 (1). 28 J. DFNA5에 의한 apoptotic exosome 발생에 annexin이 관여한다 (2). 30 K. Apoptotic exosome 발생에 penta-EF hand 단백질이 관여한다 (1).33 L. Apoptotic exosome 발생에 penta-EF hand 단백질이 관여한다 (2).35 M. Apoptotic exosome 발생에 penta-EF hand 단백질이 관여한다 (3).36 Ⅳ. 고찰 38

Ⅴ. 결론 42

참고문헌 43

영문요약 49

iv 그림차례

Figure 1. Schematic diagram of DFNA5 constructs. 12 Figure 2. DFNA5 promotes formation of multivesicular bodies (MVBs) in apoptotic cell (1). 14 Figure 3. DFNA5 promotes formation of multivesicular bodies (MVBs) in apoptotic cell (2). 16 Figure 4. DFNA5 promotes formation of multivesicular bodies (MVBs) in apoptotic cell (3). 18 Figure 5. ESCRT complex is associated biogenesis of apoptotic exosome. 20 Figure 6. Recruitment of ESCRT complex is prerequisite for DFNA5-mediated increase of ApoExo biogenesis (1). 22 Figure 7. Recruitment of ESCRT complex is prerequisite for DFNA5-mediated increase of ApoExo biogenesis (2). 25 Figure 8. Increase of Ca²⁺ is required for biogenesis of apoptotic exosome. 27 Figure 9. Annexin dependency of DFNA5-mediated increase in ApoExo’s biogenesis (1). 29 Figure 10. Annexin dependency of DFNA5-mediated increase in ApoExo’s biogenesis (2). 31 Figure 11. Penta-EF hand proteins are associated with biogenesis of apoptotic exosome (1). 34 Figure 12. Penta-EF hand proteins are associated with biogenesis of apoptotic exosome (2). 35

v

Figure 13. Penta-EF hand proteins are associated with biogenesis of apoptotic exosome (3). 37 Figure 14. Schematic illustration summarizing gasdermin-mediated biogenesis of apoptotic exosomes. 41

표 차례

Table 1. DNA primer for cloning 10

- 1 -

Ⅰ. 서론

Apoptosis

Apoptosis는 caspase에 의해 발생되는 다세포 생물의 계획된 세포사멸이다. Apoptosis 발생시 DNA분절화가 발생하며, 세포가 작게 응축된다. DNA 조각과 응축된 세포 내 소기관들은 세포의 원형질막과 함께 apoptotic body로 방출되고, 포식세포에 의해 제거된다 ¹. 내재적 요인에 의한 apoptosis 발생에서 주요 인자인 Bcl-2 family 단백질은 proapoptotic BH3 only (Bid, Bim, Bad, Noxa), antiapoptotic Bcl-2 및 proapoptotic 단백질 (Bax와 Bak)으로 구성된다. 스트레스 등의 자극에 의해 BH3 only 단백질의 증가로 Bcl-2가 억제되면 Bax/Bak이 활성 되며, Bax와 Bak은 미토콘드리아 외막에 구멍을 만들어 cytochrome C를 세포질로 방출시킨다. Cytochrome C는 apoptotic protease activating factor 1(APAF1) 및 procaspase-9과 함께 거대복합체인 apoptosome을 형성하고, procaspase-9은 자가 절단으로 활성화된 caspase-9이 pro- caspase-3를 활성화시켜 apoptosis를 일으킨다 ². 외재적 요인에 의한 apoptosis는 FAS (CD95)와 TNF-related apoptosis inducing ligand (TRAIL)같은 tumor necrosis factor (TNF) 사멸 수용체에 사멸 리간드 (TNF-α, FAS 및 TRAIL)가 결합하면, Fas-associated death domain (FADD) 또는 TNFR-associated death domain (TRADD)와의 상호작용을 통해 death-inducing signaling complex (DISC)가 형성된다.

DISC에 의해 활성화된 procaspase-8과 procaspase-10은 caspase-3, caspase-6 및 caspase-7을 활성화시켜 apoptosis를 발생시킨다 ^2,3. Apoptosis 과정의 세포가 대식세포에 의해 제거되지 않을 때 연속적인 반응으로 secondary necrosis가 발생하며, 세포막이 붕괴되고 세포 내 구성 요소 들이 유출되어 면역반응과 염증반응이 일어난다 ⁴.

- 2 - Exosome

Exosome은 골지체에 의한 sorting과 세포막의 endocytosis에 의해 형성된 endosome으로부터 발생한다. Intraluminal vesicles (ILVs)를 포함한 multivesicular bodies (MVBs)의 maturation 과정으로 MVBs의 외막이 세포막과 융합해 세포 밖으로 ILVs가 방출되면, 이를 exosome이라고 한다. Exosome은 1.13-1.21 g/mL의 밀도와 지름 30-150 nm의 크기를 가지며, 다양한 단백질, DNA, mRNA 및 microRNA 등을 포함하기 때문에 세포로 전달되었을 때 생리적 변화를 일으키고 신호 전달을 하는 intercellular communication에서 중요한 역할을 담당한다 ⁵. ILVs의 형성은 endosomal-sorting required for transport (ESCRT)- dependent 또는 ESCRT-independent 기전에 의해 형성된다 ⁶. ESCRT 복합체는 ESCRT-0, ESCRT-Ⅰ, ESCRT-Ⅱ 및 ESCRT-Ⅲ로 구성되는데, ESCRT-0는 유비퀴틴화된 세포막 단백질을 인식하고, ESCRT-Ⅰ, ESCRT-Ⅱ 및 ESCRT-Ⅲ 복합체를 불러모아 endosomal 세포막의 budding을 유도한다. VPS4B는 budding 되는 세포막을 scission시켜 ILVs으로 방출하며, ESCRT-Ⅲ 복합체의 recycle에 중요한 역할을 한다 ⁷. 또한 ESCRT 관련 단백질인 Alix는 ESCRT-Ⅲ 복합체와 syndecan과 syntenin의 결합을 매개 해 ILVs 형성에 관여한다 ⁸. 이외에도 ceramaide 또는 tetraspanin이 관여하는 ESCRT-independent 기전이 있다⁹.

Apoptotic Exosomes

Apoptotic bodies, microvesicles 및 exosome의 extracellular vesicles (EVs)은 인체의 생리학적 현상 뿐만 아니라 질환의 진행 과정에서 intercellular communication에 필수적인 역할을 한다 ^10,11. EVs는 정상 또는 스트레스 상태의 살아있는 세포에서 분비된다고 알려져 있지만, 최근 연구에서는 죽어가는 세포에서의 EVs의 발생이 확인되고 있다 ¹².

- 3 -

죽어가는 세포에서 분비된 endosome 기원의 EVs인 apoptotic exosomes (ApoExos)은 caspase-3와 caspase-9에 의해 분비가 조절되기 때문에 apoptosis 과정에서 발생한다. 또한 exosome의 특징을 가지며, damage associated molecular patterns (DAMPs)로서 염증반응을 유도한다.

ApoExo는 S1P/S1PR 신호에 의한 세포막의 endocytosis를 통해 발생된다. 그러므로 기존의 exosome 마커로 잘 알려진 tetraspanin 중 하나인 CD63 이외에도 sphingosine-1-phosphatate receptor 1/3 (S1PR1/3)를 마커로 갖는다 ^13,14.

Gasdermin

Gasdermin (GSDM) family는 세포막에 구멍을 형성하는 단백질로, GSDMA, GSDMB, GSDMC, GSDMD, DFNA5 (GSDME) 및 DFNB59 (PJVK)로 구성된다. GSDM의 N-terminal domain과 C-terminal domain은 linker domain으로 연결되어 있으며, 구멍을 형성하는 N- terminal domain은 caspase에 의해 자가억제의 기능을 가진 C- terminal domain이 잘리면 활성 되는 것으로 밝혀졌다. GSDM의 잘려 나온 N-terminal fragment는 세포막에 구멍을 형성하여 pyroptotic cell death와 염증반응을 유발한다 ¹⁵. 특히 GSDMD는 proinflammatory caspases (쥐의 경우 caspase-1, caspase-11/사람의 경우 caspase-1, caspase-4, caspase-5)에 의해 잘리고, IL-1β와 IL-18같은 proinflammatory cytokine의 방출과 pyroptotic cell death를 일으킨다 ^16,17. GSDMD는 caspase-8 ^18,19과 neutrophil elastase ^20,21에 의해서도 활성화될 수 있으며, apoptosis과 NETosis에서 pyroptosis로의 전환 과정의 주요 원인이 될 것으로 생각된다. Apoptosis 과정의 세포에서 caspase-3에 의해 잘려진 DFNA5의 N-terminal fragment는 세포막에 구멍을 형성하고, pyroptosis로의 전환을 일으킨다 ^22,23. 그러므로 DFNA5가

- 4 -

높은 수준으로 존재할 시에는 caspase-3에 의해 pyroptosis가 진행되며, 반대로 DFNA5의 음성인 세포에서는 apoptosis가 발생한다²⁴. 쥐의 경우 DFNA5가 낮은 수준으로 존재해 apoptosis발생시 pyroptosis로 전환되지 않는 경향이 있다. ¹⁹ 즉 apoptosis에서 pyroptotic cell death로의 전환은 세포유형에 따른 DFNA5의 수준에 의존할 것으로 사료된다.

칼슘 이온에 의한 손상된 세포막의 복구 기전

기계적 스트레스에 의해 세포막 붕괴가 발생할 때, 칼슘 이온이 세포 내로 유입된다. 칼슘은 세포 생존과 항상성을 위해 세포골격 재구성 및 exocytosis를 통한 손상 받은 세포막을 방출시켜 세포막을 복구 한다

25,26. 그 기전을 간략히 기술하면, 손상된 세포막을 통한 세포 내 칼슘 이온의 유입은 세포 내막에 활성화된 annexinA7 (ANXA7)을 불러 오고 apoptosis linked gene 2 (ALG-2) 및 ALG2-interacting protein X (ALIX)가 ANXA7과 함께 복합체를 이루며, 마지막으로 ESCRT-Ⅲ가 결합해 손상된 세포막을 budding시켜 수선한다 ²⁷.

Annexin Family

Annexin(ANX) family 단백질은 칼슘 의존성 세포막 결합 단백질이다

28. 사람의 annexin은 A1-A13으로 구성되며, 다양한 조직에서 발현한다.

아미노산 서열이 반복되는 네 개의 annexin core domain을 가지며 칼슘 이온이 붙은 형태로 세포막에 결합한다. 또한 다양한 길이를 가진 N- terminal domain은 세포 내 단백질과 상호작용을 매개한다. Annexin family는 항 염증반응, 이온채널형성, 소포수송 및 exocytosis등 다양한 세포 내 생리현상에서 중요한 역할을 담당한다 ²⁹. AnnexinA2의 경우 칼슘과 결합한 형태로 cholesterol이 풍부한 세포막에 모여 세포골격을

- 5 -

구성하는 단백질인 액틴 (actin)의 polymerization을 촉진해 MVBs 형성에 관여한다고 알려져 있다 ³⁰.

Penta-EF-hand(PEF) 단백질

Penta-EF-hand(PEF) 단백질은 칼슘 이온과 결합할 수 있는 5개의 반복되는 helix-loop-helix 구조의 EF-hand motifs를 가진다 ³¹. PEF 단백질은 α1부터 α8까지 총 8개의 α helix가 loop으로 연결되어 있는데 α4와 α7은 각각 EF2-EF3와 EF4-EF5를 형성에 관여한다 ³². Gly/Pro 아미노산이 풍부한 N-terminal domain은 칼슘 신호에 의해 세포막 또는 다른 단백질과 상호작용한다. ALG-2, peflin, grancalcin 및 sorcin으로 구성된 PEF 단백질은 exocytosis의 분열 및 조절, 칼슘 채널의 조절을 통해 소포체 및 미토콘드리아로의 칼슘 축적 등에 관여한다 ^33-35.

이전의 우리 팀의 결과는 gasdermin family 단백질들 GSDMA, GSDMC, GSDMD 및 DFNA5가 ApoExo의 생합성에 관여할 것이라는 증거를 제시하였다. 이에 따라 본 연구에서는 gasdermin 중 하나인 DFNA5가 ApoExo의 생합성을 증가시키는 분자적 기전을 조사하고자 하였다.

- 6 -

Ⅱ. 재료 및 방법

A. 세포, 항체 및 시약

HeLa 세포주는 10% heat-inactivated FBS, 100 U/ml penicillin, 2 mM L-glutamine, 및 100 μg/ml streptomycin 이 포함된 minimal essential medium (MEM, Gibco, Australia)을 사용하였으며, 293T 세포주는 10% heat-inactivated FBS, 100 U/ml penicillin, 2 mM L- glutamine, 100 mg/L sodium pyruvate 및 100 μg/ml streptomycin이 포함된 Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Australia)을 사용해 37℃, 5% CO₂ humidified incubator에서 배양하였다. 항체는 다음과 같이 준비하였다. Anti-GAPDH, V5, AnnexinA7, Grancalcin, ALG2, CD63, S1PR3 (Santa Cruz, CA), anti- AnnexinA2 (Cell signaling technology), anti-Peflin (Novusbio, Colorado), anti-Sorcin (Invitrogen), anti-CHMP2A, CHMP4B (Genetex), anti- Tublin, Flag, Flag-agarose 및 S1PR1 (Sigma-Aldrich, Yongin, Korea).

B. In-fusion cloning

CloneAMP Hi-Fi PCR premix (Clontech, Mountain view, California) 25 μl, 10 μM forward와 reverse primer 1.5 μl, DNA template 10 ng 및 DDW 21 μl의 mixture를 98℃ 10초, 55℃ 15초 및 72℃ 20초의 조건으로 35 cycle의 PCR을 수행하였다. 제한효소로 자른 선형화된 vector 1 μl, PCR 단편 1 μl, DDW 1 μl 및 in-fusion premix

- 7 -

(Clontech, Mountain view, California) 1 μl의 mixture를 50℃에서 30분 동안 in-fusion cloning 반응을 수행하였다.

C. Lentiviral vector transfection

Lentiviral construct의 oligo를 phosphorylation후 BsmBI로 자른 LentiCRISPR/cas9 V2에 ligation시켰다. Transformation을 통해 plasmid DNA를 얻었다. 10% FBS가 포함된 DMEM에서 배양한 293T 세포에 pCMV-VSV-G, pGag/pol 및 lentiviral plasmid 혼합물을 lipofectamine 2000 (Invitrogen, Carlsbad, California)을 이용해 transfection하였다.

이틀 후 바이러스 입자를 수확해 HeLa 세포에 처리하고 2주간 puromycin (2 μg/ml)으로 selection 하여 세포주를 얻었다.

D. Western blot

Knock-out된 HeLa 세포는 trypsin EDTA (T/E)를 사용해 수확하고, 시간 별로 staurosporine (1 μM)을 처리해 apoptosis를 유도한 세포는 cell scraper을 사용해 수확하였다. 그리고 4℃, 1500 rpm, 5분 동안 원심분리 하여 얻은 세포 침전물 (pellet)을 phosphate-buffered saline (PBS, pH 7.4)로 두 번 세척하였다. Protease 억제제가 포함된 RIPA buffer (20 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 1 mM NaF 및 1 mM Na3VO4)로 lysis 후 30분 동안 얼음에서 incubation하고 13000 rpm, 20분 동안 원심분리 해 전체 세포 추출물 (lysate)를 얻었다. Bradford assay로 정량 해 western blot 샘플을 만들어 SDS-PAGE gel에 걸었으며, polyvinylidene fluoride (PVDF) membrane을 이용해 150 mA의 전류로 2시간동안 electro-

- 8 -

transfer 하였다. Membrane은 0.5% bovine serum albumin에 30분 blocking되었으며, 실온에서 1시간 동안 peroxidase-conjugated secondary antibodies (Piere, Rokford, Ⅰllinois)를 사용해 incubation후 0.1% PBS-T (PBS, 0.1% Tween20, pH 7.4)를 사용하여 세척하였다. Secondary antibody에 결합한 horseradish peroxidase에 의해 산화된 luminal이 발광하여 hyper film에 단백질 밴드가 검출되는 원리를 이용한 enhanced chemiluminescence (Amersham Biosciences, Seongnam, Korea)를 사용하여 단백질을 검출하였다.

E. Apoptotic exosome-like vesicle (AEV) 확인 -초고속 원심 분리기를 이용한 AEV 분리

Staurosporine (1 μM)을 각 세포에 처리하고 16시간 동안 incubation후, conditioned media를 4℃에서 300 ×g, 10분 그리고 2000 ×g, 20분 원심분리 후 세포 내 조각들과 apoptotic body를 제거하였다. 마지막으로 30,000 rpm, 70분 동안 초고속 원심분리 해 얻은 세포 침전물 (pellet)은 세포 개수에 맞춰 RIPA buffer를 이용해 western blot 하였다.

-Nanoparticle tracking analysis (NTA)

Nanoparticle tracking analysis (NTA)를 사용해 exosome의 크기 분포와 수를 측정하였다.

F. Immunoprecipitation (IP)

DFNA5(Flag)-Blast-CHMP4B-V5와 DFNA5-3xFlag-CHMP4B- V5에 시간 별로 staurosporine (1 μM)을 처리해 scraper로 샘플을

- 9 -

수확 후 4℃, 1500 rpm, 5분 동안 원심분리 하여 얻은 세포 침전물 (pellet)을 PBS로 두 번 세척하였다. Protease 억제제와 칼슘이 포함된 ca²⁺ RIPA buffer (20 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 1 mM NaF, 1 mM Na3VO4및 0.5 mM CaCl2)로 lysis 후, 30분 동안 얼음에서 incubation하고 13000 rpm, 20분 동안 원심분리해 전체 세포 추출물 (lysate)를 얻었다.

Bradford assay로 정량 후 anti-Flag agarose 10 μl를 넣어 overnight했다. 칼슘 1 mM이 포함된 PBS로 5번 세척 후 2× Loading dye 20 μl를 넣고 얼음에서 20분 동안 incubation 했다. 비드를 제외한 상층액에 1 M DTT를 2 μl 넣어 5분 동안 열처리후 SDS PAGE 샘플을 만들었다.

G. 공초점 현미경 (confocal microscopy)

CD63-eGFP가 과발현된 HeLa 세포주에 staurosporine (1 μM)을 시간 별로 처리 후 공초점 현미경으로 확인하였다. Lab-Tek four-well glass chamber (Thermo scientific)에 넣은 세포를 WGA, Alexa Fluor 594 conjugate (Invitrogen)을 37℃ 10분 처리 후 Hanks’ balanced salt solution (1.0 g/L glucose, 0.011 g/L phenol red, 0.35 g/L NaHCO3)로 두 번 세척하여 4% paraformaldehyde in PBS로 10분 고정시켰다.

마지막으로 DAPI (Sigma-Aldrich)를 처리해 cover glass로 덮은 후 공초점 현미경 (LSM 710 laser, Carl Zeiss)으로 관찰하였다.

- 10 - Table. 1. DNA primer for cloning

Gene Forward sequences(5’to3’) Reverse sequences(5’to3’) DFNA5 N’ CGGCGCCTACTCTAGAGCCACCATGT

TTGCCAAAGCAACC

CTGCCCTCAGCGGCCGCTGAATGTTCT CTGCCTAAAGCA

DFNA5 C’ CATAGAAGATTCTAGAGCCACCATG TT TGCCAAAGCAACCAG G

TTGTAGTCTGCGGCCGCTGAATGTTCT CTGCCTAAAGCA

CD63 CATAGAAGATTCTAGAGCCACCATG

GTGAGCAAG

AGATCCTTCGCGGCCGCCTACATCACC TCGTAGCCACTT

CHMP2A CGGCGCCTACTCTAGAGCCACCATGG ACCTATTGTTCGGGC

GCT TAC CTA GCG GCCGCG TCC CTC CGC AGG TTCTTA

CHMP4B CGGCGCCTACTCTAGAGCCACCATGT CGGTGTTCGGGAAGCTGT

GCTTACCTAGCGGCCGCCATGGATCCA GCCCAGTTCTCCA

Sorcin CGGCGCCTACTCTAGACAGTCTGCAG CATGGAGTC

GGCTTACCAGCGGCCGCAACACTCATG ACACATTGAATGC

Grancalcin CGGCGCCTACTCTAGACTTTGACCAG GACCTGGTAACA

GGCTTACCAGCGGCCGCAATTGCCATA GTGCCCTGCAAA

ALG-2 CGGCGCCTACTCTAGAATGGCCGCCT A CTCTACC

GGCTTACCAGCGGCCGCTACGATACTG AAGACCATGGAC

VPS4B CTCCATTATCTTCATTGATCAAATT GATTCTCTCTGTGG

CCACAGAGAGAATCAATTTGATCAAT GAAGATAATGGAG

CHMP2-180 CGGCGCCTACTCTAGAGCCACCATGG ACCTATTGTTCGGGCG3

GGCTTACCAGCGGCCGCCGACAGCTCA TCTGTTAGGCTA

CHMP3-180 CGGCGCCTACTCTAGAGCCACCATGG GGCTGTTTGGAAAGAC3

GGCTTACCAGCGGCCGCTTTGCCCAAG GCCCCTGCTGTA

Peflin CACCATGGCCAGCTATCCTTA TAGCATCCGAGAAGCTGTCAT Sorcin gRNA CACCGTGCGTTTCCCGGACAAACTC AAACGAGTTTGTCCGGGAAACGCAC Annexin A2 gRNA CACCGGGTCCTTCTCTGGTAGGCGA AAACTCGCCTACCAGAGAAGGACCC Annexin A7 gRNA CACCGAGCCACTACTTGGCACTTGT AAACACAAGTGCCAAGTAGTGGCT C Annexin A2 CGGCGCCTACTCTAGAGACGCTCTCA

GCTCTCGG

GGCTTACCAGCGGCCGCGTCATCTCCA CCACACAGGTA

Annexin A7 CGGCGCCTACTCTAGAGGGGTCAGAA TGTCATACCCA

GGCTTACCAGCGGCCGCCTGGCCCACA ATAGCCAGAAG

- 11 -

Ⅲ. 결과

A. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs)의 형성을 촉진한다 (1).

DFNA5는 세포막에 구멍을 형성하는 N-terminal fragment와 C- terminal fragment을 가지며 각각의 발현을 확인하기 위해 caspase에 의해 잘리는 linker domain인 DMPD270 부위에 eGFP, mCherry 및 Flag tag를 달았으며 [DFNA5(eGFP), DFNA5(mCherry) 및 DNFA5(Flag)], DFNA5의 C-terminal에 Flag tag를 달아 construct를 완성하였다 (DFNA5-Flag) (Fig. 1).

- 12 -

Figure 1. Schematic diagram of DFNA5 constructs. DFNA5 is including of N-terminal membrane translocation domain (MTD), pore-forming N-terminal domain (N-Term), C-terminal domain (C-Term) and linker region of DMPD270 (Linker). eGFP, mCherry and Flag tag sequences were inserted to the caspase cleavage site (DMPD270) for N-terminal detection [DFNA5(eGFP), DFNA5 (mCherry) and DNFA5(Flag)]. Flag tag was inserted at the C- terminal (DFNA5-Flag).

- 13 -

B. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs)의 형성을 촉진한다 (2).

Apoptosis 과정의 세포에서 DFNA5에 의한 exosome의 발생을 확인 하고자 대조군 HeLa와 DFNA5 knock-out (DFNA5 KO)세포에 exosome 마커인 CD63-eGFP을 과발현시켜 세포주를 제작하였다. Staurosporine을 5시간 처리한 세포를 공초점 현미경을 통해 관찰한 결과, DNA 분절화와 함께 CD63이 세포질 내 커다란 multivesicular bodies (MVBs)의 집합체를 형성 하는 HeLa 세포와 다르게 DNFA5 KO 세포에서는 커다란 MVBs가 관찰되지 않았다 (Fig. 2a). HeLa 세포와 DFNA5 KO 세포주를 transmission electromicroscopy (TEM)을 통해 형태를 확인 했을 시, 마찬가지로 HeLa 세포에서 세포질 내 MVBs로 보여지는 큰 vesicle이 형성되었으나 DFNA5 KO된 세포에서는 확인되지 않았다 (Fig. 2b).

마지막으로 각 그룹의 20개의 세포에서 1 μM보다 큰 지름의 vesicle의 수를 확인한 결과 DFNA5 KO된 세포에서 대조군 보다 현저하게 감소하였다 (Fig. 2c).

- 14 -

Figure 2. DFNA5 promotes formation of multivesicular bodies (MVBs) in apoptotic cell (1). HeLa cells, which were infected with CD63-eGFP or DFNA5 knock-out (DFNA5 KO) were treated with saturosporine (1 μM) for 5 h, which were stained with AlexaFlour 594 (WGA) for visualizing the plasma membrane (a). HeLa cells or DFNA5 KO cells were treated with saturosporine (1 μM) for 7 h.

Images of the each group were taken by TEM (b and c). The number of intercellular vesicles was counted with more than 1 μM in diameter from 20 cells of each group (c).

- 15 -

C. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs)의 형성을 촉진한다 (3).

Staurosporine처리 시간에 따른 형태 변화를 확인하기 위해 CD63- eGFP이 과발현된 HeLa와 DFNA5 KO 세포를 공초점 현미경을 통해 관찰하였다. 세포질 내 vesicle의 응집으로 MVBs를 형성하는 대조군 HeLa 세포와 다르게 DFNA KO된 HeLa 세포는 vesicle의 응집이 나타나지 않았다 (Fig. 3).

- 16 -

Figure 3. DFNA5 promotes formation of multivesicular bodies (MVBs) in apoptotic cell (2). HeLa cells, which were infected with CD63-eGFP or DFNA5 knock-out (DFNA5 KO) were treated with staurosporine (1 μM) for the indicated time. The cells stained with AlexaFlour 594 (WGA) for visualizing the plasma membrane, and the images were taken by confocal microscopy.

- 17 -

D. DFNA5는 apoptosis 과정의 세포에서 multivesicular bodies (MVBs)의 형성을 촉진한다 (4).

Caspase에 의해 잘리는 DFNA5의 linker domain을 기준으로 N- terminal과 C-terminal domain에 각각 Flag tag를 장착한 과발현 세포주를 제작했으며, staurosporine 처리 후 면역 침강반응 (immunoprecipitation)을 진행하였다. DFNA5의 잘려나온 N-terminal fragment (30 kDa)는 시간에 따라 발현이 증가 하였고, C-terminal fragment (20 kDa)의 경우 빠르게 발현이 감소하였다 (Fig. 4a). 또한 DFNA5와 CD63은 세포 내 MVBs 형성시 함께 위치하는 것을 공초점 현미경을 통해 확인하였다 (Fig. 4b). 이 결과는 apoptosis 과정의 세포에서 DFNA5의 full-length 또는 잘린 N-terminal fragment가 ApoExo를 생성하는 세포 내 MVBs 형성에 관여함을 보여준다.

- 18 -

Figure 4. DFNA5 promotes formation of multivesicular bodies (MVBs) in apoptotic cell (3). Prepared HeLa cells infected with DFNA5 tagged with N-terminal [DFNA5(Flag)] or C-terminal [DFNA5-Flag], which was treated with staurosporine (1 μM).

Immunoprecipitation of DFNA5 was detected by western blot.

Arrows or arrowheads represent DFNA5 of full-length and cleaved form individually. Asterisks indicate immunoglobulin (Ig) light chains (a). HeLa cells, which were infected with eGFP-CD63 and internal mCherry tagged DFNA5 [DFNA5 (mCherry)] were treated with staurosporine (1 μM) for 5 h. Images were taken by confocal microscopy (b).

- 19 -

E. ESCRT 복합체는 apoptotic exosome의 발생에 관여한다.

DFNA5에 의한 MVBs 형성 시 ESCRT 복합체가 관여하는지를 확인하기 위해 VPS4B (VPS4BE235Q)와 ESCRT-Ⅲ 복합체의 구성원인 CHMP2A 및 CHMP3 (CHMP2A-180 및 CHMP3-179)의 dominant negative mutant를 과발현한 HeLa 세포주를 제작하였으며 (Fig. 5a, 위 패널 및 5c, 위 패널), 대조군 세포주에 비해 과발현한 세포주에서 ApoExo의 생성이 감소함을 western blot (Fig. 5a, 아래 패널 및 5c, 아래 패널)과 NTA (Fig. 5b 및 5d)를 통해 확인하였다.

- 20 -

Figure 5. ESCRT complex is associated biogenesis of apoptotic exosome. HeLa cells, which were infected with empty vector and VPS4B (VPS4B E235Q) mutant (a, upper panel) were treated with staurosporine (1 μM) for 24 h. Purified apoptotic exosomes were analyzed by western blot (a, lower panel) and NTA (b). HeLa cells, which were infected with empty vector or CHMP2A/CHMP3 (CHMP2A-180/CHMP3-179) deleted mutant (c, upper panel) were treated with staurosporine (1 μM) for 24 h. Purified apoptotic exosomes were analyzed by western blot (c, lower panel) and NTA (d).

- 21 -

F. DFNA5에 의한 ApoExo 발생을 위해 ESCRT 복합체가 필요하다 (1).

ESCRT 복합체의 dominant negative mutant (CHMP2A-180 및 CHMP3-179)을 과발현한 HeLa 세포주에 DFNA5를 함께 발현시키면 (Fig. 6a, 위 패널) dominant negative mutant에 의한 ApoExo의 생성 감소가 약간 회복되었으나, DFNA5만 과발현된 세포만큼은 회복되지 않았다 (Fig, 6a, 아래 패널 및 6b). 또한 DFNA5와 ESCRT-Ⅲ 복합체의 구성원인 CHMP2A 및 CHMP4B는 세포 내 MVBs에서 함께 위치하는 것을 공초점 현미경으로 확인하였다 (Fig 6c 및 6d). 이 결과는 DFNA5가 매개하는 ApoExo 생성 증가가 ESCRT-Ⅲ 복합체를 경유한 MVBs에서의 intraluminal vesicles (ILVs)를 형성할 가능성을 시사한다.

- 22 -

Figure 6. Recruitment of ESCRT complex is prerequisite for DFNA5-mediated increase of ApoExo biogenesis (1). CHMP2A or CHMP3 overexpressed mutant HeLa cells were infected with empty

- 23 -

vector or DFNA5. Expression of CHMP2A and CHMP3 was analyzed by western blot (a, upper panel). Purified apoptotic exosomes from staurosporine-treated (1 μM) cells for 24 h were analyzed by western blot (a, lower panel) and NTA (b). HeLa cells, which were infected with internal eGFP tagged DFNA5 [DFNA5(eGFP)] and C- terminal mCherry tagged CHMP2A were treated with solvent or staurosporine (1 μM) for 5 h. DFNA5(eGFP) cells were treated with staurosporine (1 μM) for 5 h and stained with CHMP4B antibody. Images were taken by confocal microscopy (c, d).

- 24 -

G. DFNA5에 의한 ApoExo 발생을 위해 ESCRT 복합체가 필요하다 (2).

DFNA5(Flag)와 CHMP4V-V5 가 함께 과발현된 HeLa 세포주에 시간 별로 staurosporine 처리 후 면역 침강반응을 진행하였다. Apoptosis 과정 세포에서 ESCRT-Ⅲ 복합체의 구성원인 CHMP4B는 칼슘 이온이 첨가된 lysis buffer을 사용하였을 때 DFNA5의 full-length 및 N- terminal fragment와 함께 면역 침전되었다 (Fig. 7). 이 결과는 DFNA5에 의해 매개되는 MVBs의 형성시 칼슘 의존적으로 DFNA5가 ESCRT와 접합함을 보여준다.

- 25 -

Figure 7. Recruitment of ESCRT complex is prerequisite for DFNA5-mediated increase of ApoExo biogenesis (2). HeLa cells, which were infected with V5-tagged CHMP4B and internal Flag tagged DFNA5 were staurosporine (1 μM) for the indicated time.

DFNA5 was immunoprecipitated with anti-Flag agarose and western blotted with anti-V5 or anti-Flag from the lysate or calcium ion containing lysate. Arrow and arrowhead represent full-length and cleaved N-terminal fragments of DFNA5, sharp indicates with V5 tagged CHMP4B and asterisks denote heavy and light chain of Ig.

- 26 -

H. 세포 내 칼슘 이온의 증가는 apoptotic exosome발생에 관여한다.

칼슘 이온에 의해 DFNA5와 ESCRT-Ⅲ 복합체가 상호작용하는 현상을 염두에 두고, DFNA5의 N-terminal fragment에 의한 MVB 지질막의 구멍 형성은 세포질 내로 칼슘 이온을 유입시킴으로써 ESCRT를 불러와 ILVs의 형성에 관여하였을 가능성을 검증하고자 하였다. 이 가능성은 세포막 손상에 의한 세포질 내 칼슘 농도의 증가는 ESCRT-Ⅲ 복합체를 모아 손상된 세포막을 budding시켜 손상된 세포막을 수선한다는 최근의 보고와 일치한다 ³⁶. 대조군 HeLa 세포, DFNA5 과발현 또는 DFNA5 KO된 HeLa 세포에 staurosporine과 함께 calcium ion chelator인 BAPTA-AM 처리시 ApoExo의 생성이 모두 감소하였으며, staurosporine과 calcium ionophore인 A23187을 함께 처리시 DFNA5 과발현 세포를 제외한 대조군과 DFNA5 KO 세포에서 ApoExo의 생성이 증가하였다 (Fig. 8a 및 8b). 이를 통해 칼슘은 ApoExo의 발생에 필수적이지만 DFNA5에 의해 형성된 구멍을 통한 미세한 조절이 요구됨을 알 수 있었다.

- 27 -

Figure 8. Increase of Ca²⁺ is required for biogenesis of apoptotic exosome. DFNA5 overexpressed or DFNA5 KO HeLa cells were treated with staurosporine (1 μM) for 24 h with solvent, BAPTA- AM (50 μM) or A23187 (1 μg/ml). Purified apoptotic exosomes were analyzed by western blot (a) and NTA (b).

- 28 -

I. DFNA5에 의한 apoptotic exosome 발생에 annexin이 관여한다 (1).

손상된 세포막의 수선에 있어서 칼슘 의존성 단백질인 annexinA2 (ANXA2)와 annexinA7 (ANXA7)이 ESCRT-Ⅲ 복합체를 불러와 손상된 세포막의 budding과 제거를 유도한다는 보고가 있다 ^27,37. 그러므로 gasdermin에 의해 촉발된 MVBs 주변 세포질의 칼슘 이온 증가로 활성화된 annexin family 단백질이 ApoExo 형성을 촉진할 것으로 생각하였다. 이 가능성을 검증하기 위해 staurosporine을 24시간 처리 후 conditioned media (C’Media), exosome 조각들을 제거한 conditioned media [C’Media Exo(-)] 및 apoptotic exosome에서 western blot을 통해 확인한 결과 exosome에서 ANXA2가 ANXA7보다 더 두드러지게 발현됨을 확인하였다 (Fig. 9a). 또한 ANXA2 KO 또는 ANXA7 KO 세포 (Fig. 9b)에서 ApoExo의 발생이 감소함을 western blot (Fig. 9c)과 NTA (Fig. 9d)를 통해 확인하였다.

- 29 -

Figure 9. Annexin dependency of DFNA5-mediated increase in ApoExo’s biogenesis (1). Total cellular lysate (Stau), the assembled conditioned media (C’Media), the conditioned media depleted in exosomal fractions [C’Media Exo(-)], the apoptotic exosome (Exo) were prepared from HeLa cells treated with staurosporine (1 μM) for 24 h and analyzed by western blot with control cell lysate (Control) (a). HeLa cells, which were infected with ANXA2 and ANXA7 knock-out (ANXA2 KO and ANXA7 KO) were confirmed by western blot (b). ANXA2 KO and ANXA7 KO cells were treated with saturosporine (1 μM) for 24 h. Purified apoptotic exosomes were analyzed by western blot (c) and NTA (d).

- 30 -

J. DFNA5에 의한 apoptotic exosome 발생에 annexin이 관여한다.

ANXA2 KO 또는 ANXA7 KO HeLa 세포에서 DFNA5(eGFP)의 과발현은 (Fig. 10a, 위 패널) ApoExo의 생성을 약간 회복시켰으나, DFNA5만 과발현된 세포의 ApoExo 수준으로는 회복되지 않았다 (Fig, 10a, 아래 패널 및 10b). 이 결과를 통해 annexin family 단백질인 ANXA2와 ANXA7이 DFNA5가 매개하는 ApoExo 생성증가의 down stream으로 작용함을 알 수 있었다. DFNA5(Flag)에 ANXA2-V와 ANXA7-V5가 각각 과발현된 HeLa 세포주를 제작하고, 시간별로 staurosporine 처리 후 면역 침강반응을 진행하였다. Apoptosis 과정의 세포에서 ANXA2와 ANXA7은 칼슘 이온이 첨가된 lysis buffer에서 DFNA5의 full-length및 N-terminal fragment와 함께 면역 침전되었다.

그러므로 칼슘 이온 의존적으로 DFNA5에 의해 매개되는 MVBs의 형성 시 annexin family (ANXA2와 ANXA7)가 함께 작용함을 알 수 있었다.

- 31 -

Figure 10. Annexin dependency of DFNA5-mediated increase in ApoExo’s biogenesis (2). ANXA2 or ANXA7 KO HeLa cells were infected with empty vector or DFNA5-eGFP cDNA. Knock-out of ANXA2 and ANXA7 was confirmed by western blot (a, upper panel).

Purified apoptotic exosomes from staurosporine-treated (1 μM) cells for 24 h were analyzed by western blot (a, lower panel) and NTA (b). HeLa cells overexpressing DFNA5(Flag) were infected

- 32 -

with V5-tagged annexinA2 or annexinA7, which treated staurosporine (1 μM) for the indicated time. Immunoprecipitation of DFNA5 was detected by western blot with anti-V5 or anti-Flag from the lysate or calcium ion containing lysate. The arrow and arrowhead represent ANXA2 and ANXA7, and asterisks indicate the heavy and light chain of Ig (c).

- 33 -

K. Apoptotic exosome 발생에 penta-EF hand 단백질이 관여한다 (1).

손상된 세포막을 통한 칼슘 이온의 유입으로 ANXA7이 apoptosis linked gene 2 (ALG-2) 및 ALG2-interacting protein X (ALIX)을 유인하고, ESCRT-Ⅲ와 함께 복합체를 이뤄 손상된 세포막을 외부로 budding시킨다고 알려져 있다 ²⁷. 그러므로 ApoExo의 발생에 penta- EF hand 단백질이 linker로서 관여할 가능성을 검증하고자 하였다. 이를 위해 우선 penta-EF hand 단백질인 ALG-2, peflin, grancalcin 및 sorcin을 HeLa 세포주에 각각 과발현시켰다 (Fig. 11 a, c, e 및 g, 위 패널). ALG-2와 peflin의 과발현시 ApoExo의 생성이 감소함을 western blot (Fig. 11a 및 c, 아래 패널)과 NTA (Fig. 11b 및 11d)를 통해 확인하였으며, sorcin과 grancalcin의 과발현시에는 ApoExo의 생성이 증가 하는 것을 마찬가지로 western blot (Fig. 11e 및 g, 아래 패널)과 NTA (Fig, 11f 및 10h)로 확인하였다.

- 34 -

Figure 11. Penta-EF hand proteins are associated with biogenesis of apoptotic exosome (1). HeLa cells, which were infected with proteins of PEF family (ALG-2, peflin, grancalcin and sorcin) were confirmed by western blot (upper panels of a, c, e and g). Purified apoptotic exosomes were analyzed by western blot (lower panels of a, c, e and g) and NTA (b, d, f and h) from the cells treated with staurosporine (1 μM) for 24 h.

- 35 -

L. Apoptotic exosome 발생에 penta-EF hand 단백질이 관여한다 (2).

추가적으로 sorcin knock-out된 HeLa 세포에서 (Fig. 12a) ApoExo의 발생이 감소함을 western blot (Fig. 12b)과 NTA (Fig. 12c)를 통해 확인 하였다.

Figure 12. Penta-EF hand proteins are associated with biogenesis of apoptotic exosome (2). Knock-out of sorcin was confirmed by western blot (a). Sorcin KO cells were treated with saturosporine (1 μM) for 24 h. Purified apoptotic exosomes were analyzed by western blot (b) and NTA (c).

- 36 -

M. Apoptotic exosome 발생에 penta-EF hand 단백질이 관여한다 (3).

Apoptosis 과정의 세포에서 DFNA5(eGFP)와 penta-EF hand 단백질 (ALG-2, peflin, grancalcin 및 sorcin)의 위치변화를 공초점 현미경을 통해 관찰하였다. Staurosporine을 5시간 처리한 세포에서 ALG-2와 peflin은 핵에 위치하였으며 (Fig. 13a 및 13b), grancalcin과 sorcin의 경우는 세포질 내의 MVBs에서 DFNA5와 함께 위치하였다 (Fig. 13b 및 13d). 이 결과는 과발현 세포에서의 ApoExo의 생성변화를 관찰한 데이터와 함께 DFNA5에 의한 ApoExo의 생성 촉진에 penta- EF hand 단백질인 grancalcin과 sorcin이 관여함을 보여주고 있다.

- 37 -

Figure 13. Penta-EF hand proteins are associated with biogenesis of apoptotic exosome (2). HeLa cells, which were infected with internal eGFP tagged DFNA5 and C-terminal mCherry tagged ALG- 2 were treated with solvent or staurosporine (1 μM) for 5 h.

Images were taken by confocal microscopy (a). HeLa cells, which were infected with internal eGFP tagged DFNA5 were treated with solvent or staurosporine (1 μM) for 5 h and stained for peflin, grancalcin and sorcin. Images were taken by confocal microscopy (b, c and d).

- 38 -

Ⅳ. 고찰

DFNA5에 의한 apoptotic exosome (ApoExo)의 생합성 촉진에 ESCRT 복합체가 관여함을 본 연구에서 규명하였다. Apoptosis 과정의 세포에서 생성되는 exosome인 ApoExo은 caspase-3과 caspase-9에 의해 생성이 조절된다. 그러므로 ApoExo의 발생에서 caspase에 의해 활성화되는 gasdermin family가 관여될 것으로 생각되었다. Gasdermin family로 알려진 GSDMA, GSDMB, GSDMC, GSDMD, DFNA5 (GSDME) 및 DFNB59 (PJVK)는 N-terminal 과 C-terminal domain을 linker domain이 연결하고 있으며, 잘린 N-terminal fragment는 세포막에 구멍을 형성해 pyroptosis를 일으킨다 ¹⁵. 그중 DFNA5는 apoptosis과정에서 활성화된 caspase-3에 의해 잘린 N-terminal fragment가 세포막의 구멍을 형성하고, pyroptotic cell death를 발생시킨다 ²². Exosome은 endosomal sorting required transport (ESCRT)-dependent 기전과 ESCRT- independent 기전에 의해 발생한다. ESCRT 복합체는 세포막 remodeling, scission 및 budding에 관여하는 단백질이다. 세포막 단백질의 유비퀴틴화를 ESCRT-0가 인지하면, ESCRT-Ⅰ, ESCRT-Ⅱ 및 ESCRT-Ⅲ가 모여 복합체를 형성하고, filament의 역할을 하는 ESCRT-Ⅲ는 VPS4B에 의해 scission 된다 ⁹. 손상된 세포막 수선에 있어서 annexinA2 (ANXA2)와 annexinA7 (ANXA7)이 ESCRT-Ⅲ 복합체를 불러와 손상된 세포막을 복구한다고 알려져 있다 ^27,37. 이를 바탕으로 DFNA5에 의한 endosome 막의 구멍을 통해 세포 내 칼슘 이온이 유입되며, annexin (ANX) family가 penta-EF hand 단백질 (ALG-2, peflin, grancalcin 및 sorcin) 및 ESCRT-Ⅲ 와 함께 복합체를 형성해 ApoExo의 생성함을 본 연구에서 규명하고자 하였다.

- 39 -

Apoptosis 과정에서 caspase-3에 의해 활성화되어 세포막에 구멍을 형성한다고 알려진 DFNA5는 CD63과 함께 multivesicular bodies (MVBs)를 형성하고 (Fig. 4b), ApoExo 발생에 관여하였다. 또한 DFNA5의 N-terminal fragment에 의한 세포 내 칼슘 이온의 증가는 (Fig. 8) ESCRT-Ⅲ 복합체와 칼슘 의존성 단백질인 annexin을 모은다 (Fig. 7 및 Fig. 10c). 그리고 ESCRT-Ⅲ 복합체 (CHMP2A 및 CHMP3)의 dominant negative form 또는 ANX KO (ANXA2 KO 및 ANXA7 KO) 세포주에서, DFNA5의 과발현이 ApoExo의 생성을 완전히 회복하지 못함은 ESCRT-III 복합체가 DFNA5의 down stream으로 작용함을 보여주고 있다 (Fig. 6a, 6b 및 Fig. 9c, 9d). 또한 penta-EF hand 단백질인 ALG-2와 peflin이 과발현된 apoptosis 과정의 세포에서 ApoExo의 방출이 감소하였고, 반대로 grancalcin과 sorcin이 과발현된 세포주 에서는 ApoExo의 생성이 증가하였다 (Fig. 10). 추가적으로 sorcin KO세포에서 ApoExo의 방출이 감소하였으며 (Fig. 11), ESCRT-Ⅲ와 마찬가지로 grancalcin과 sorcin은 apoptosis 과정중인 세포의 MVBs에서 DFNA5와 함께 위치하였다 (Fig. 12c 및 12d). 즉 penta-EF hand 단백질 중 grancalcin과 sorcin은 ApoExo 발생에 관여함을 알 수 있었다. 손상된 세포막의 복구에서 penta-EF hand 단백질인 ALG-2는 Bro1 domain을 가지는 단백질인 ALIX와의 결합을 통해 ESCRT-III 복합체를 손상된 세포막으로 불러와 세포막을 복구한다고 알려져 있다. Bro1 domain은 ESCRT-III의 CHMP2나 CHMP4와 결합하는 특이 domain으로 알려져 있기 때문에 ³⁸ DFNA5에 의한 ApoExo의 생합성에서 MVB에 도착한 penta-EF hand 단백질인 sorcin이나 grancalcin이 Bro1 domain 단백질과 결합하여, 결국에는 ESCRT-III를 불러모아 intraluminal vesicles (ILVs)의 형성에 관여하였을 가능성이 높다. Bro1 domain 단백질에는 잘 알려진 ALIX

- 40 -

이외에도 HD-PTP와 BROX가 있으므로 이들이 ApoExo의 합성에 미치는 단백질의 영향과 DFNA5, annexin, 및 sorcin/grancalcin과의 관계를 증명하는 추가의 연구가 진행되어야 한다고 생각한다.

지금까지의 연구 결과를 요약하면 Figure. 14와 같다. Caspase 또는 아직 알려지지 않은 요소에 의해 잘려 나온 gasdermin의 N-terminal fragment가 endosome 막의 구멍을 형성한다. 구멍을 통해 세포 내로 칼슘 이온이 유입되며, 세포 내 국소적인 칼슘 농도의 증가는 칼슘 이온 결합 단백질인 annexin 및 sorcin/grancalcin이 endosome 막에 도달하도록 유도하고 Bro1 domain 단백질을 불러모은다. Bro1 domain에 ESCRT-

Ⅲ 복합체가 결합하면, endosome 막의 budding이 일어나고 VPS4B가 MVB의 내부로 ILVs를 방출시킨다. 또한 VPS4B는 ESCRT-Ⅲ 복합체를 recycle 하기 위해 세포질로 돌려보낸다. ILVs의 내막은 ANXA2와 같은 annexins에의해 덮여 있으며, annexin은 스캐폴드 (scaffold)로써의 역할을 할 것으로 추정된다.

- 41 -

Figure 14. Schematic illustration summarizing gasdermin-mediated biogenesis of apoptotic exosomes.

- 42 -

Ⅴ. 결론

ESCRT 복합체는 DFNA5에 의한 apoptotic exosome의 생합성에 관여한다. DFNA5의 잘려 나온 N-terminal domain은 endosome 막의 구멍을 형성하고, 세포 내 칼슘 이온 농도를 증가시킨다. 칼슘 의존성 단백질인 annexin과 penta-EF hand 단백질인 grancalcin 및 sorcin이 결합하면, 복합체에 ESCRT-Ⅲ를 불러와 intraluminal vesicles를 형성한다.

추가적으로 각 단백질의 역할과 단백질 간의 관계를 증명하는 연구가 필요하다.

- 43 -

ⅤI. 참고문헌

1. Elmore S. Apoptosis: a review of programmed cell death.

Toxicologic pathology.

2. Siddiqui WA, Ahad A, Ahsan H. The mystery of BCL2 family:

Bcl-2 proteins and apoptosis: an update.

Archives of toxicology.

3. Hongmei Z. Extrinsic and intrinsic apoptosis signal pathway review. In:

Apoptosis and medicine.

4. Strzyz P. Pulling the apoptotic trigger for necrosis.

Nature reviews Molecular cell biology.

5. Van Niel G, d'Angelo G, Raposo G. Shedding light on the cell biology of extracellular vesicles.

Nature reviews Molecular cell biology.

6. Colombo M, Raposo G, Théry C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles.

Annual review of cell and developmental biology.

2014;30:255-289.

7. Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes.

Science.

8. Baietti MF, Zhang Z, Mortier E, et al. Syndecan–syntenin–

ALIX regulates the biogenesis of exosomes.

Nature cell

biology.

- 44 -

9. Zhang Y, Liu Y, Liu H, Tang WH. Exosomes: biogenesis, biologic function and clinical potential.

Cell & bioscience.

2019;9(1):19.

10. Raposo G, Stoorvogel W. Extracellular vesicles: exosomes, microvesicles, and friends.

Journal of Cell Biology.

2013;200(4):373-383.

11. Maas SL, Breakefield XO, Weaver AM. Extracellular vesicles:

unique intercellular delivery vehicles.

Trends in cell biology.

2017;27(3):172-188.

12. Baxter AA. Stoking the fire: how dying cells propagate inflammatory signalling through extracellular vesicle trafficking.

International journal of molecular sciences.

2020;21(19):7256.

13. Kakarla R, Hur J, Kim YJ, Kim J, Chwae Y-J. Apoptotic cell- derived exosomes: Messages from dying cells.

Experimental

& Molecular Medicine.

14. Park SJ, Kim JM, Kim J, et al. Molecular mechanisms of biogenesis of apoptotic exosome-like vesicles and their roles as damage-associated molecular patterns.

Proceedings of the National Academy of Sciences.

15. Feng S, Fox D, Man SM. Mechanisms of gasdermin family members in inflammasome signaling and cell death.

Journal of

molecular biology.

- 45 -

16. He W-t, Wan H, Hu L, et al. Gasdermin D is an executor of pyroptosis and required for interleukin-1β secretion.

Cell research.

17. Kayagaki N, Stowe IB, Lee BL, et al. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling.

Nature.

18. Mitra S, Exline M, Habyarimana F, et al. Microparticulate caspase 1 regulates gasdermin D and pulmonary vascular endothelial cell injury.

American journal of respiratory cell and molecular biology.

19. Sarhan J, Liu BC, Muendlein HI, et al. Caspase-8 induces cleavage of gasdermin D to elicit pyroptosis during Yersinia infection.

Proceedings of the National Academy of Sciences.

2018;115(46):E10888-E10897.

20. Sollberger G, Choidas A, Burn GL, et al. Gasdermin D plays a vital role in the generation of neutrophil extracellular traps.

Science immunology.

21. Kambara H, Liu F, Zhang X, et al. Gasdermin D exerts anti- inflammatory effects by promoting neutrophil death.

Cell reports.

22. Wang Y, Yin B, Li D, Wang G, Han X, Sun X. GSDME mediates caspase-3-dependent pyroptosis in gastric cancer.

Biochemical and biophysical research communications.

2018;495(1):1418-1425.

23. Rogers C, Fernandes-Alnemri T, Mayes L, Alnemri D, Cingolani G, Alnemri ES. Cleavage of DFNA5 by caspase-3

- 46 -

during apoptosis mediates progression to secondary necrotic/pyroptotic cell death.

Nature communications.

2017;8(1):1-14.

24. Wang Y, Gao W, Shi X, et al. Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin.

Nature.

25. Saeki N, Kuwahara Y, Sasaki H, Satoh H, Shiroishi T.

Gasdermin (Gsdm) localizing to mouse Chromosome 11 is predominantly expressed in upper gastrointestinal tract but significantly suppressed in human gastric cancer cells.

Mammalian genome.

26. McNeil PL, Steinhardt RA. Plasma membrane disruption:

repair, prevention, adaptation.

Annual review of cell and developmental biology.

27. Sønder SL, Boye TL, Tölle R, et al. Annexin A7 is required for ESCRT III-mediated plasma membrane repair.

Scientific reports.

28. Moss SE, Morgan RO. The annexins.

Genome biology.

2004;5(4):1-8.

29. Gerke V, Creutz CE, Moss SE. Annexins: linking Ca 2+

signalling to membrane dynamics.

Nature reviews Molecular cell biology.

30. Gruenberg J, Stenmark H. The biogenesis of multivesicular endosomes.

Nature reviews Molecular cell biology.

2004;5(4):317-323.

- 47 -

31. Jia J, Han Q, Borregaard N, Lollike K, Cygler M. Crystal structure of human grancalcin, a member of the penta-EF- hand protein family.

Journal of molecular biology.

2000;300(5):1271-1281.

32. Maki M, Narayana S, Hitomi K. A growing family of the Ca2+-binding proteins with five EF-hand motifs.

Biochemical Journal.

33. Ilari A, Fiorillo A, Poser E, et al. Structural basis of Sorcin- mediated calcium-dependent signal transduction.

Scientific reports.

34. Maki M, Kitaura Y, Satoh H, Ohkouchi S, Shibata H. Structures, functions and molecular evolution of the penta-EF-hand Ca2+-binding proteins.

Biochimica et Biophysica Acta (BBA)-Proteins and Proteomics.

35. Jia J, Tarabykina S, Hansen C, Berchtold M, Cygler M.

Structure of apoptosis-linked protein ALG-2: insights into Ca2+-induced changes in penta-EF-hand proteins.

Structure.

36. Scheffer LL, Sreetama SC, Sharma N, et al. Mechanism of Ca 2+-triggered ESCRT assembly and regulation of cell membrane repair.

Nature communications.

37. Häger SC, Nylandsted J. Annexins: players of single cell wound healing and regeneration.

Communicative & Integrative

Biology.

- 48 -

38. Ali N, Zhang L, Taylor S, Mironov A, Urbé S, Woodman P.

Recruitment of UBPY and ESCRT exchange drive HD-PTP- dependent sorting of EGFR to the MVB.

Current biology.

2013;23(6):453-461.

- 49 - -영문요약-

DFNA5-mediated increase of apoptotic exosomes is executed by activation of ESCRT complex

Apoptotic exosome (ApoExos), which is extracellular vesicle (EV) originated from endosome, has characteristics of exosomes, and is a damage-associated molecular patters (DAMPs) that induce immune response and inflammation. During the apoptosis, N-terminal fragment of DFNA5 (GSDME) can be cleaved by caspase-3 and cleaved N-terminal fragment creates the plasma membrane pore. In this study, it was investigated How the DFNA5-mediated increase of apoptotic exosomes in apoptotic cells was regulated and it was determined how endosomal-sorting required for transport (ESCRT) complex was involved in the process. The cleaved N-terminal fragment of DFNA5 by activation of caspases makes pores in the endosomal membrane through which calcium ion is entered into the cytoplasm. The locally increased calcium ions play a crucial role in increasing the biogenesis of ApoExo by DFNA5 and make complex with calcium-activated proteins annexin, penta-EF hand proteins (grancalcin and sorcin) and ESCRT-III in the endosomal membrane.

This complex will involve the formation of intraluminal vesicles.

Therefore, further research is needed to identify the molecular mechanisms investigating how the increased calcium ions by DFNA5 make complexes composed of annexin, penta-EF hand protein and ESCRT-III.

Key words: Apoptotic exosome, caspase, DFNA5, ESCRT complex