Changes in Stanniocalcin-2 and Hypoxia-Inducible Factor-1α mRNA Expression in Medaka Oryzias dancena Exposed to Acute Hypoxia

(1)

70 서 론

일조량, 계절, 시공간에따라환경수내의용존산소량은현 저히다른양상을나타낸다. ^이러한^환경적^{용존산소량}(dissolved oxygen, DO)^의^변동성은^어류의^성장, ^생식^발달과^밀 접한영향을가진다(Wagner et al. 1986, Soitamo et al. 2001).

어류는저산소(hypoxia) ^환경^조건에서^생존하기^위하여^호흡, 대사변화및산소전달을수행하는헤모글로빈(hemo-globin) 분자의변형 등다양한생리적, ^생화학적^적응^과정을^거치 게된다(Shoubridge and Hochachka, 1981; Weber, 1982). ^포 유동물의경우, 체내 hypoxia에의해높은발현이유도되는 포도당수용체(glucose transporter), ^당분해^효소(glycolytic enzymes), 적혈구생성촉진인자(erythropoietin), 트렌스페린 (transferrin), ^혈관내피^성장인자(vascular endothelial growth factor, VEGF) ^등 40^가지^이상의^유전자가^보고된^바^있다(Se-

menza 1999). ^하지만, ^{포유동물과}^비교하여^어류의^관련^유전 자의분리와발현조절, ^기능에^대한^연구는^{상대적으로}^부족한 실정이다. 포유동물에서 hypoxia 의존적인유전자들의전사활 성은주로저산소증유발인자(hypoxia-inducible factor-1, HIF- 1)^에^의해^조절된다. HIF-1^은 HIF-1α^과 HIF-1β^로^구성된^이 형이량체(heterodimer)^로서^{전사활성을}^조절하며, ^특히 HIF-1

α는세포내 hypoxia^에^{특이적으로}^반응하는^{전사조인자로}

보고되고있다(Wang et al. 1995, Wang and Semenza 1995).

HIF-1α mRNA^와^단백질은 hypoxia ^가^유발될^경우^발현량이 현저히증가하게되며(Huang et al. 1996, Kallio et al. 1997), 반대로 정상적인혈중 산소조건에서 HIF-1α ^단백질은 26S proteasome^에^의해^신속히^분해되어^낮은^수준으로^회복^되어 진다(Salceda and Caro 1997, Huang et al. 1998).

최근포유동물의 hypoxia^에^의해^발현이^유도되는^단백질로

Article history;

Received 17 September 2012; Revised 6 December 2012; Accepted 12 February 2013

*Corresponding author: Tel: +82. 33. 640. 2348 Fax: +82. 33. 640. 2348 E-mail address: [email protected]

Kor J Fish Aquat Sci 46(1) 070-076, February 2013 http://dx.doi.org/10.5657/KFAS.2013.0070 pISSN:0374-8111, eISSN: 2281-8815

Some fish live in aquatic environments with low or temporally changing O2 availability. Variation in dissolved oxygen (DO) levels requires behavioral, physiological, and biochemical adaptations to ensure the uptake of sufficient O2. Several species are relatively well adapted to tolerate low O2 partial pressures (hypoxia). The medaka (Oryzias dancena) is an important model organism for biomedical research that shows remarkable tolerance to hypoxia. We investigated the regulation and role of hypoxia-inducible factor-1 (HIF-1α) as a general hypoxia-response gene and stanniocalcin-2 (STC2), which is one of the genes regulated by HIF-1α in mammals under hypoxia. We subjected adult male medaka to the following three acute hypoxia regimes: 1, 24, and 72 h at DO = 1.8±0.5 ppm. The changes in STC2 and HIF-1α mRNA were monitored using quantitative real-time reverse-transcription PCR. We found strong upregulation of HIF-1α mRNA in the livers of fish exposed to hypoxia. Hypoxia rapidly upregulated STC- 2 mRNA expression in muscle, but not in the brain, gills, liver, or intestine. Therefore, unlike in mammals, hypoxia

might regulate O. dancena STC-2 expression in an HIF-1α-independent manner.

Key words : Oryzias dancera, Hypoxia, Hypoxia-inducible factor, Medaka, Real-time PCR, Stanniocalcin

저산소환경에 의한 송사리( Oryzias dancena)의 Stanniocalcin-2와 Hypoxia-Inducible Factor-1αmRNA 발현의 변화

강릉원주대학교 해양분자생명공학과

Ji hye Shin and Young Chang Sohn^* 신지혜·손영창*

Changes in Stanniocalcin-2 and Hypoxia-Inducible Factor-1α mRNA Expression in Medaka Oryzias dancena Exposed to Acute Hypoxia

Department of Marine Molecular Biotechnology, Gangneung-Wonju National University, Gangneung 210-702, Korea

(2)

서스타니오칼신(stannio-caincin, STC1)^이^보고된^바^있다. STC1^은^{경골어류에서}^칼슘의^흡수를^{억제시키는}^{항과잉칼슘} 호르몬으로서그기능이최초로밝혀진호르몬이다(Butkus et al. 1987, Sundell et al. 1992). ^포유류 STC1^은^{항과잉칼슘}^작 용과더불어위암과난소암세포의증식, 전이및종양형성에 관여하여, ^마우스^난소의^{성스테로이드}^분비를^조절한다(Luo et al. 2004, Liu et al. 2010, He et al. 2011). STC1 ^상동단백 질인 STC2^는^{포유동물에서}^최초로^{분리되었으며}, STC-1^과 는비교적낮은상동성(~30%)^을^나타낸다(Chang and Red- del 1998, DiMattia et al. 1998, Ishibashi et al. 1998). 하지만, STC2^는^유방암, ^신장, ^췌장암의^발달에^따라^{특이적으로}^발현 이증가하고, ^종양^성장과^전이를^{촉진한다는}^점에서 STC1^과 유사한생리적기능을나타낸다(Bouras et al. 2002, Ieta et al.

2009, Meyer et al. 2009). ^대부분의^종양^성장과^전이는^세포 내 hypoxia와소포체스트레스(endoplasmic reticulum stress) 와밀접한연관성을지니고있다. ^이러한^현상은^암세포의^생 존을위한신생혈관형성(angiogenesis)^의^조건에^{필수적이며},

이과정중 HIF-1^에^의해^발현이^중재되는^다양한^{유전자들이}

암세포발달에관여된다(Koumenis et al. 2002, Koumenis and Wouters 2006). STC-1은인두암세포주 CNE-2에서 STC-2는 난소암세포주 SKOV3^에서^세포의^증식에^따른 hypoxia^에^의 해발현이증가된다고보고된바있다(Yeung et al. 2005, Law and Wong 2010). STC-1^과 STC-2 ^유전자의^프로모터^영역^내 HIF-1α ^단백질의^결합영역(hypoxia response element, HRE) 이존재하며, HIF-1α에의해 STC-1과 STC-2 유전자의전사 활성이유도된다(Yeung et al. 2005, Law and Wong 2010).

어류의 hypoxia^에^의한 HIF α subunits (HIF-1α, -2α, -3α) 유전자, ^단백질의^{발현유도와}^전사조절^{메커니즘은}^포유류의 경우와유사하게나타나며(Soitamo et al. 2001, Rahman and Thomas 2007, Chen et al. 2012), 그외 hypoxia 의존적발현 양상을보이는유전자들이동정되고있다(Ju et al. 2007, Waw- rowski et al. 2011). ^어류의 STC2^는^복어(Takifugu rubripes), 제브라피쉬(Danio rerio), 넙치(Paralichthys olivaceus)에서

유전자가분리되고일부기능이연구되어있지만(Luo et al.

2005, Shin and Sohn 2009), hypoxia에의한어류내생리적 작용및 HIF-1^와의^연관성^또한^명확하지^않다. ^본^연구는^광 염성 Oryzias dancena^의 hypoxia ^반응^유전자 HIF-1α mRNA 발현및낮은용존산소에따른 STC2 mRNA^의^발현^변화를^분 자수준에서밝히고자하였다. ^향후, ^환경중의^용존산소^부족 에따른항상성유지에필요한생리적조절기구를이해하는기 초연구가될것으로사료된다.

재료 및 방법 실험어와 실험조건

실험어 O. dancena는부경대학교해양바이오신소재학과남

윤권교수님으로부터제공받았다. ^수컷O. dancena(약 6^월령) 를대조군(control; 15^마리) ^및 hypoxia ^실험군(hypoxia; 15^마 리)^으로^나누어^{수용하였다}. ^각^사육수조(35×19×22 cm)^의 수온은 25℃ ^내외로^{유지하였으며}, ^실험기간^중^사료는^공급하 지않았다. 실험전 2일동안안정화를시킨후, hypoxia 실험 군의사육수는질소가스(100% N2)^를^주입하여^낮은^용존산소 조건을유도하였다. ^각^군의^{용존산소농도와}^수온은^용존산소 측정기(Hanna Instruments, Smithfield, RI, USA)^를^이용하여 측정하였으며, ^대조군과 hypoxia ^실험군의 DO^는^각각 6.8±

0.5 ppm과 1.8±0.5 ppm으로유지시켜진행하였다. 실험개 시 1^시간, 24^시간, 72^시간^{경과시점에서}^각^그룹의^{실험어로부} 터뇌, ^아가미, ^장, ^간, ^근육을^{적출하였다}(^각각 5^마리). ^조직^적 출은실체현미경을이용하여수행하였으며, ^각^조직은^액체질 소에급속동결하여 total RNA^를^추출하기^전까지 -80℃^에^동 결보관하였다.

RNA 추출

Total RNA^는 RNeasy Mini Kit (QIAGEN, Valencia, CA, USA)^로^{추출하였으며}, genomic DNA ^제거^및 cDNA ^합성은 QuantiTect Reverse Transcription Kit (QIAGEN)를이용하여 수행하였다. ^모든^조직의 cDNA^는^최종농도 0.5 μg^으로^정량 된 total RNA로부터합성하였다. 각 cDNA는 qRT-PCR 분석 전까지 -20℃^에^동결^{보관하였다}.

Quantitative real-time reverse-transcription PCR

HIF-1α, STC2 유전자발현분석은 quantitative real-time reverse-transcription PCR (qRT-PCR) ^방법으로^조사하였 다. ^{표적유전자} STC2^는^클로닝한 O. dancena STC2 partial cDNA (GenBank Accession No. JX680809) ^{염기서열을}^바탕 으로 oligo primers^를^{제작하였으며}(Table 1 and Fig. 1), HIF-1 α (GenBank Accession No. DQ317443)와 18S ribosomal RNA (18S rRNA, GenBank Accession No. HM347347)^에^대 한 oligo primers^는 GenBank^에^등록된^{염기서열을}^바탕으로 Primer Express v3.0 software (Applied Biosystems, Foster

Table 1. Oligo primer sequences used in quantitative real-time reverse-transcription PCR (qRT-PCR)

Primer Directions Sequence (5’ – 3’)

HIF-1α Forward TGTCAACTTTGTGCTCAGTGGAAT HIF-1α Reverse TTCGTCTGCCTCCTGCG

STC2 Forward CATTGCCTGGTGAACGCC STC2 Reverse TGTTTGATGCATTCTCTCTGGA 18S F Forward GTTTTTCTCTCTCTGAACTGGGC 18S R Reverse ACTCCTGGTGGTGCCCTTC

(3)

City, CA, USA)를이용하여제작하였다(Table 1). 뇌, 아가미, 장, ^간, ^근육의 total RNA (0.5 μg)^로부터^합성된 cDNA^를^주 형으로 oligo primers (10 μM), SYBR premix Ex-Taq, ROX Referance Dye II와함께총량 20 μL로 qRT-PCR을수행하였 다. PCR^은 ABI 7500 Fast Real-Time PCR Systems (Applied Biosystems)을이용하여 50℃에서 2분그리고 95℃에서 10분 반응후, two-step PCR ^방법으로 95℃^에서 15^초, 60℃^에서 1 분, ^총 40 cycles^을^{수행하였다}. qRT-PCR ^결과를^분석하기^전, 각시료의희석배수에따른증폭산물의임계값(cycle thresh-

old, Ct)^을^통한^{표준정량과}^해리곡선^분석을^통하여^사용된

oligo primers의표적유전자에대한특이성을검증하였다. 증 폭된 HIF-1α^와 STC2 ^유전자^발현량은 ABI 7500 Sequence Detection Software V.1.3.1 (Applied Biosystems)^를^이용하여 분석하였으며, 18S rRNA 유전자발현량으로값을보정하였 다.

통계처리

각그룹내 15마리개체의표적유전자발현에대한평균간의

유의성검정은 SPSS V.18.0 통계패키지를이용하여분산분석 후, post hoc Tukey test^와 t-test^로^{분석하였다}(P<0.05).

결 과 HIF-1α mRNA 발현변화

O. dancena 간의경우, hypoxia 실험군(hypoxia) 송사리의

HIF-1αmRNA ^발현은 1^시간^시점에서^{일시적으로}^감소하는

경향을나타낸후, 72 시간시점에서발현이유의적으로증가

하였다(Fig. 2C). Hypoxia ^실험군의^아가미와^장에서 HIF-1

α mRNA ^발현이^{경시적으로}^증가하는^경향을^{나타내었으나},

대조군(control)과의유의적인차이는없었으며(Fig. 2B and

2D), ^뇌와^근육의^경우는^두^군간의^유의적인^차이가^확인되지

않았다(Fig. 2A and 2E).

STC2 mRNA 발현변화

O. dancena 근육의경우, hypoxia ^유도 1^시간^시점에서 STC2 mRNA ^발현이^{유의적으로}^{증가하였으며}, 72^시간^시점 Fig. 1. Alignment of medaka STC2 partial sequence and other vertebrate STC2s. The STC2 sequences used for this alignment were ex- tracted from the NCBI GenBank databases. GenBank accession nos. are as follows: Medaka (JX680809; confidential until Oct 1, 2013 or published), Flounder (EU816770), Pufferfish (AY688945), Zebrafish (AY688947), Human (NM003714).

(4)

Fig. 2. Effects of hypoxia on HIF-1α mRNA levels. Expression levels of HIF-1α mRNA in medaka that was exposed to hypoxia at 1, 24 or 72 h after inducing hypoxia. The relative HIF-1α mRNA levels were normalized by 18S rRNA values, respectively.

Data were represented by the mean S.E.M of five independent samples (P<0.05). *, t-test; (A) Brain; (B) Gills; (C) Liver; (D) Intestine; (E) Muscle.

Fig. 3. Effects of hypoxia on STC2 mRNA levels. Expression levels of STC2 mRNA in medaka that was exposed to hypoxia at 1, 24 or 72 h after inducing hypoxia. The relative STC2 mRNA levels were normalized by 18S rRNA values, respectively. Data were represented by the mean S.E.M of five independent samples (P<0.05). *, t-test; (A) Brain; (B) Gills; (C) Liver; (D) Intestine;

(E) Muscle.

7 6 5 4 3 2 1 0

Control Hypoxia

1h 24h 72h a

a

a a

HIF-1 α/18rRNAmRNAlevels

(A)

6 5 4 3 2 1 0

Control

Hypoxia b

a a

1h 24h 72h

(B)

ab ab

ab

a

*

a a

b

1h 24h 72h 2.5

2

1.5

1

0.5

0

(C) Control

Hypoxia

a

a a a

a

1h 24h 72h 16

14 12 10 8 6 4 2 0

(D) Control

Hypoxia

a

1h 24h 72h 14

12 10 8 6 4 2 0

(E)

Control Hypoxia

a

12 10 8 6 4 2 0

Control Hypoxia

1h 24h 72h

a a

a ab

ab b

STC2/18SrRNAmRNAlevels

(A)

7 6 5 4 3 2 1 0

Control Hypoxia

1h 24h 72h a

a

a a

a b

(B)

*

7 6 5 4 3 2 1 0

Control Hypoxia

1h 24h 72h a

a

ab a

ab b

(D)

12 10 8 6 4 2 0

Control Hypoxia

1h 24h 72h a

C

ab bc

ab

STC2/18SrRNAmRNAlevels a (E)

8 7 6 5 4 3 2 1 0

Control Hypoxia

1h 24h 72h a

a

a a

(C)

(5)

에서대조군수준으로회복되었다(Fig. 3E). ^반면, ^뇌의 STC2

mRNA ^발현은^{경시적으로}^{증가하였고}, ^이는^대조군과 hy-

poxia ^{실험군에서}^{공통적으로}^나타났다(Fig. 3A). ^대조군의^아 가미, ^간^및^장의 STC2 mRNA ^발현도^경시적^증가^패턴을^나 타내었다(Fig. 3B-3D). 특히, 아가미조직의 STC2 mRNA는 hypoxia^에^의한^유의적인^발현^변화가^나타나지^않았지만, ^대

조군의증가된 STC2 mRNA ^발현^수준과^비교하여^상대적으

로낮은발현수준을나타내었다(Fig. 3D).

고 찰

최근송사리과에속하는일본송사리(O. javanicus)와인도송 사리(^{바다송사리}, O. dancena 혹은 O. melastigma)는새로운 동물실험모델로주목을받고있는광염성어종이다 (Kang et al. 2008). ^특히, O. dancena는 hypoxia ^환경수(0.8-1.8 ppm) 에대한높은적응력과생존력을나타내고, ^어류의 hypoxia ^유 도실험에적합한동물모델로사용되고있다(Yu et al. 2006).

본연구는 qRT-PCR ^분석을^통하여 hypoxia ^유발에^따른 O.

dancena HIF-1α^와 STC-2 mRNA^의^발현^변화를^{조사하였다}. 어류의 HIF-1α ^유전자는^뇌, ^심장, ^신장, ^비장, ^간, ^생식소를^포 함한다양한조직에서광범위하게발현되어지는데(Ju et al.

2007, Chen et al. 2012), 담수어 Chinese sucker (Beaufortia kweichowensis)의 HIF-α subunit mRNAs (HIF-1α, HIF-2α, HIF-3α)^는^특히^간에서^높게^발현되며, ^이^중 HIF-1α^과 HIF-3 α는 HIF-2α ^보다^{상대적으로} ^높은 mRNA ^발현^수준을^보 였으며(Chen et al. 2012). ^또한, ^농어(Dicentrarchus labrax)

의 HIF-1α mRNA는다른조직과비교하여간에서높은발

현수준이관찰되었다(Terova et al., 2008). ^하지만^조직^특이 적인 HIF-1α^의^발현양상^만으로는 hypoxia^에^대한 HIF-1α 의발현과조절을이해하는것으로는충분하지않다. ^본^연구 는 O. dancena의간 HIF-1α mRNA^가 hypoxia^에^의존적으 로발현이증가되는경향을확인하였다(Fig. 2). 이결과는이 미보고된바있는 O. melastigma의경우와일치하며(Yu et al.

2006), hypoxia^에^대한^어류의^항상성에^관여하는^주된^조직 이간으로추정된다. ^어류의^경우, hypoxia^에^의한^다양한^생 리적, ^생화학적^변화가^수반되며, ^특히^대사율의^저하(Chen et al. 2012), 산소에대한헤모글로빈의친화성증가(Jensen et al.

1993), ^높은^무기^호흡율(Virani and Rees 2000)^을^{나타낸다는} 보고가있다. Hypoxia^에^의한 O. dancena ^간 HIF-1α mRNA 의발현증가는체내항상성유지를위한대사작용의변화가 우선적으로일어난것이라사료된다.

일련의 O. dancena 유전자클로닝과정에서 STC2 프로모 터영역(-2397 bp) ^내부에^후보 HRE ^영역(-RCGTG-)^을^확인 하였다(Data not shown). Hypoxia^에^의한^간^특이적인 HIF-1 α mRNA ^발현과^일치하여 STC2 ^전사가^조절될^것이라는^가 설을바탕으로 hypoxia^에^의한 STC2 mRNA^의^발현을^조

사하였다(Fig. 3). ^{아가미에서는}^{경시적으로} ^발현이^증가하

는대조군의 STC2 mRNA^와^{대조적으로} hypoxia ^실험군의

STC2 mRNA ^발현은^낮은^수준으로^유지되는^경향을^나타내

었다(Fig. 3B). ^또한, ^{근육에서는} hypoxia ^{의존적으로} STC2

mRNA 발현이급증한후, 경시적으로발현이감소하여회복

되는경향을나타냈다(Fig. 3E).

본연구의 hypoxia^에^의한 O. dancena STC2 mRNA^의^발

현양상과조직반응은 HIF-1α^와^이질적인^경향을^{나타내었으}

며, ^이는 STC2^에^대한^전사가 HIF-1α ^{의존적으로}^조절될^것 이라는본연구의가설과상응하지않는다. 어류 STC2는포유

동물과달리 HIF-1α^와^독립적인^발현^{메커니즘에}^의해^조절될

수있으며, hypoxia^에^대한^차별적인^생리^작용을^담당할^것이 라사료된다. ^프로모터^내부에 HRE^를^가지고^있는^글로빈^유 전자의경우, ^{일본송사리와}^{제브라피쉬는} hypoxia^에^의해^서 로다른발현양상을나타내는데, 이는같은유전자라도어류 의종에따라 hypoxia^의^반응^역가나^조절^{메카니즘이}^상이할 수있다는점을시사한다(Wawrowski et al. 2011). ^이를^명확

히하기위해서는 STC2 ^전사에^대한^{상위조절자의}^연구와^종

특이적인발현양상에대한조사가요구된다. ^{포유동물의}^경 우, STC1과 STC2는이온전이, 스테로이드호르몬합성, 미 토콘드리아의 ATP ^합성을^포함하여^세포^내^작용과^생리적^기 능에대한연구결과가있다(Luo et al. 2004, Luo et al. 2005, Ellard et al. 2007, Yeung et al. 2012). STC2^의^{과잉발현을}^유 도한형질전환 마우스는정상개체보다지연된성장율과 산 소소비량의급증, 섭이량의증가를나타낸다는보고가있으 며, ^이는 STC2^가^호흡과^{대사조절에}^밀접하게^관여됨을^시사 한다(Gagliardi et al. 2005). ^어류는^{환경수로부터}^유발되는 hypoxia^에^의해^체내의^다양한^생리적^변화가^{유도되는데}, ^특 히대사율은감소하고, ^무기^호흡률은^{증가시키면서}^체내^항상 성을유지시킨다(Virani and Rees 2000, Chen et al. 2012). 환 경수의낮은 DO^에^의한 hypoxia^는^일종의^{스트레스로}^작용하 여어류내대사활동을급증시키게되는데, ^이는 STC2^에^의하 여촉발되는효과이며점차체내항상성이유지되는과정에서

STC2 mRNA ^발현의^회복이^근육에서^나타난^것이라^사료된

다. 아가미는항상성과정에서호흡계를조절하게되는데, 무 기호흡으로의효율적인전환을유도하기위하여 STC2^의^발 현수준이 hypoxia ^{특이적으로}^낮게^유지된^것이라^사료된다. 이러한 STC2^의 hypoxia^에^의한^발현^특이성은^실험^조직들^중 아가미와근육에서국한되어나타나게되는데이는두조직이 환경수의영향을직접적으로접하는 1차적인반응조직으로서 나타나는결과라고생각된다.

사 사

실험어를제공해주신부경대학교해양바이오신소재학과남 윤권교수님께심심한사의를표합니다. ^본^연구는^{국토해양부}

(6)

의재원으로한국해양과학기술진흥원의지원 (20088033-1), 한국연구재단 (2012R1A1A2044506) ^및^{강릉원주대학교}^교 내연구비(2011-0190)^를^지원^받아^{수행되었음을}^밝히며^사의 를표합니다.

참고문헌

Bouras T, Southey MC, Chang AC, Reddel RR, Willhite D, Glynne R, Henderson MA, Armes JE and Venter DJ. 2002.

Stanniocalcin 2 is an estrogen-responsive gene coexpressed with the estrogen receptor in human breast cancer. Cancer Res 62, 1289-1295.

Butkus A, Roche PJ, Fernley RT, Haralambidis J, Penschow JD, Ryan GB, Trahair JF, Tregear GW and Coghlan JP.

1987. Purification and cloning of a corpuscles of Stannius protein from Anguilla australis. Mol Cell Endocrinol 54, 123-133.

Chang AC and Reddel RR. 1998. Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2.

Mol Cell Endocrinol 141, 95-99.

Chen N, Chen LP, Zhang J, Chen C, Wei XL, Gul Y, Wang WM and Wang HL. 2012. Molecular characterization and expression analysis of three hypoxia-inducible factor alpha subunits, HIF-1alpha/2alpha/3alpha of the hypoxia- sensitive freshwater species, Chinese sucker. Gene 498, 81- 90. http://dx.doi.org/10.1016/j.gene.2011.12.058

DiMattia GE, Varghese R and Wagner GF. 1998. Molecular cloning and characterization of stanniocalcin-related protein. Mol Cell Endocrinol 146, 137-140.

Ellard JP, McCudden CR, Tanega C, James KA, Ratkovic S, Staples JF and Wagner GF. 2007. The respiratory effects of stanniocalcin-1 (STC-1) on intact mitochondria and cells: STC-1 uncouples oxidative phosphorylation and its actions are modulated by nucleotide triphosphates. Mol Cell Endocrinol 264, 90-101. http://dx.doi.org/10.1016/

j.mce.2006.10.008

Gagliardi AD, Kuo EY, Raulic S, Wagner GF and DiMattia GE. 2005. Human stanniocalcin-2 exhibits potent growth- suppressive properties in transgenic mice independently of growth hormone and IGFs. Am J Physiol Endocrinol Metab 288, 92-105. http://dx.doi.org/10.1152/ajpendo.00268.2004 He LF, Wang TT, Gao QY, Zhao GF, Huang YH, Yu LK and

Hou YY. 2011. Stanniocalcin-1 promotes tumor angiogenesis through up-regulation of VEGF in gastric cancer cells.

J Biomed Sci 18, 39. http://dx.doi.org/10.1186/1423-0127- 18-39

Huang LE, Arany Z, Livingston DM and Bunn HF. 1996. Ac- tivation of hypoxia-inducible transcription factor depends primarily upon redox-sensitive stabilization of its alpha subunit. J Biol Chem 271, 32253-32259.

Huang LE, Gu J, Schau M and Bunn HF. 1998. Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-de-

pendent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A 95, 7987-7992.

Ieta K, Tanaka F, Yokobori T, Kita Y, Haraguchi N, Mimori K, Kato H, Asao T, Inoue H, Kuwano H and Mori M. 2009.

Clinicopathological significance of stanniocalcin 2 gene expression in colorectal cancer. Int J Cancer 125, 926-931.

http://dx.doi.org/10.1002/ijc.24453

Ishibashi K, Miyamoto K, Taketani Y, Morita K, Takeda E, Sasaki S and Imai M. 1998. Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Bio- phys Res Commun 250, 252-258.

Jensen K, Freundlich M, Bunemann L, Therkelsen K, Hansen H and Cold GE. 1993. The effect of indomethacin upon cerebral blood flow in healthy volunteers. The influence of moderate hypoxia and hypercapnia. Acta Neurochir (Wien) 124, 114-119.

Ju Z, Wells MC, Heater SJ and Walter RB. 2007. Multiple tis- sue gene expression analyses in Japanese medaka (Oryzias latipes) exposed to hypoxia. Comp Biochem Physiol C Toxicol Pharmacol 145, 134-144. http://dx.doi.org/10.1016/

j.cbpc.2006.06.012

Kallio PJ, Pongratz I, Gradin K, McGuire J and Poellinger L.

1997. Activation of hypoxia-inducible factor 1alpha: post- transcriptional regulation and conformational change by recruitment of the Arnt transcription factor. Proc Natl Acad Sci U S A 94, 5667-5672.

Kang CK, Tsai SC, Lee TH and Hwang PP. 2008. Differen tial expression of branchial Na+/K(+)-ATPase of two medaka species, Oryzias latipes and Oryzias dancena, with different salinity tolerances acclimated to fresh water, brackish water and seawater. Comp Biochem Physiol A Mol Integr Physiol 151, 566-575. http://dx.doi.org/10.1016/j.cbpa.2008.07.020 Koumenis C, Naczki C, Koritzinsky M, Rastani S, Diehl A,

Sonenberg N, Koromilas A and Wouters BG. 2002. Regu- lation of protein synthesis by hypoxia via activation of the endoplasmic reticulum kinase PERK and phosphorylation of the translation initiation factor eIF2alpha. Mol Cell Biol 22, 7405-7416.

Koumenis C and Wouters BG. 2006. "Translating" tumor hypoxia: unfolded protein response (UPR)-dependent and UPR-independent pathways. Mol Cancer Res 4, 423-436.

doi: 10.1158/1541-7786.MCR-06-0150

Law AY and Wong CK. 2010. Stanniocalcin-2 promotes epi- thelial-mesenchymal transition and invasiveness in hypoxic human ovarian cancer cells. Exp Cell Res 316, 3425-3434.

http://dx.doi.org/10.1016/j.yexcr.2010.06.026

Liu G, Yang G, Chang B, Mercado-Uribe I, Huang M, Zheng J, Bast RC, Lin SH and Liu J. 2010. Stanniocalcin 1 and ovarian tumorigenesis. J Natl Cancer Inst 102, 812-827. http://

dx.doi.org/10.1093/jnci/djq127

Luo CW, Kawamura K, Klein C and Hsueh AJ. 2004. Para- crine regulation of ovarian granulosa cell differentiation by

(7)

stanniocalcin (STC) 1: mediation through specific STC1 receptors. Molecular Endocrinology 18, 2085-2096.

Luo CW, Pisarska MD and Hsueh AJ. 2005. Identification of a stanniocalcin paralog, stanniocalcin-2, in fish and the para- crine actions of stanniocalcin-2 in the mammalian ovary.

Endocrinology 146, 469-476. http://dx.doi.org/10.1210/

en.2004-1197

Meyer HA, Tolle A, Jung M, Fritzsche FR, Haendler B, Kris- tiansen I, Gaspert A, Johannsen M, Jung K and Kristiansen G. 2009. Identification of stanniocalcin 2 as prognostic marker in renal cell carcinoma. Eur Urol 55, 669-678.

http://dx.doi.org/10.1016/j.eururo.2008.04.001

Rahman MS and Thomas P. 2007. Molecular cloning, characterization and expression of two hypoxia-inducible factor alpha subunits, HIF-1alpha and HIF-2alpha, in a hypoxia- tolerant marine teleost, Atlantic croaker (Micropogonias undulatus). Gene 396, 273-282. http://dx.doi.org/10.1016/

j.gene.2007.03.009

Salceda S and Caro J. 1997. Hypoxia-inducible factor 1alpha (HIF-1alpha) protein is rapidly degraded by the ubiquitin- proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes. J Biol Chem 272, 22642-22647.

Semenza GL. 1999. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu Rev Cell Dev Biol 15, 551-578.

Shin J and Sohn YC. 2009. cDNA cloning of Japanese flounder stanniocalcin 2 and its mRNA expression in a variety of tissues. Comp Biochem Physiol A Mol Integr Physiol 153, 24-29. http://dx.doi.org/ 10.1016/j.cbpa.2008.11.014 Soitamo AJ, Rabergh CM, Gassmann M, Sistonen L and Ni-

kinmaa M. 2001. Characterization of a hypoxia-inducible factor (HIF-1alpha) from rainbow trout. Accumulation of protein occurs at normal venous oxygen tension. J Biol Chem 276, 19699-19705.

Sundell K., Bjornsson BT, Itoh H and Kawauchi H. 1992.

Chum Salmon (Oncorhynchus-Keta) Stanniocalcin Inhibits Invitro Intestinal Calcium-Uptake in Atlantic Cod (Gadus- Morhua). Journal of Comparative Physiology B-Biochemi-

cal Systemic and Environmental Physiology 162, 489-495.

Virani NA and Rees BB. 2000. Oxygen consumption, blood lactate and inter-individual variation in the gulf killifish, Fundulus grandis, during hypoxia and recovery. Comp Bio- chem Physiol A Mol Integr Physiol 126:397-405.

Wagner GF, Hampong M, Park CM and Copp DH. 1986. Puri- fication, characterization, and bioassay of teleocalcin, a gly- coprotein from salmon corpuscles of Stannius. Gen Comp Endocrinol 63, 481-491.

Wang GL, Jiang BH, Rue EA and Semenza GL. 1995. Hypox- ia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci U S A 92, 5510-5514.

Wang GL and Semenza GL. 1995. Purification and characterization of hypoxia-inducible factor 1. J Biol Chem 270, 1230-1237.

Wawrowski A, Gerlach F, Hankeln T and Burmester T. 2011.

Changes of globin expression in the Japanese medaka (Oryzias latipes) in response to acute and chronic hypoxia.

J Comp Physiol B 181, 199-208. http://dx.doi.org/10.1007/

s00360-010-0518-2

Weber RE. 1982. Intraspecific adaptation of hemoglobin function in fish to oxygen availability. In: Exogenous and Endogenous Influences on Metabolic and Neural Control.

Addink ADF and Spronk N, eds. Pergamon Press, Oxford, U.K., 87-102.

Yeung BH, Law AY and Wong CK. 2012. Evolution and roles of stanniocalcin. Mol Cell Endocrinol 349, 272-280. http://

dx.doi.org/10.1016/j.mce.2011.11.007

Yeung HY, Lai KP, Chan HY, Mak NK, Wagner GF and Wong CK. 2005. Hypoxia-inducible factor-1-mediated activation of stanniocalcin-1 in human cancer cells. Endocrinology 146, 4951-4960. http://dx.doi.org/10.1210/en.2005-0365 Yu RM, Chen EX, Kong RY, Ng PK, Mok HO and Au DW.

2006. Hypoxia induces telomerase reverse transcriptase (TERT) gene expression in non-tumor fish tissues in vivo:

the marine medaka (Oryzias melastigma) model. BMC Mol Biol 7, 27. http://dx.doi.org/10.1186/1471-2199-7-27