• 검색 결과가 없습니다.

Anti-Obese Activity of HPJ Extract on High Fat Diet-Induced Obese Mice

N/A
N/A
Protected

Academic year: 2021

Share "Anti-Obese Activity of HPJ Extract on High Fat Diet-Induced Obese Mice"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

혈 군 r ~ 엔 대 °

•M 름총학

고지방 식이로 유도된 비만 쥐에서

H P J

추출몰의 항버만 효과

원 해 단 • 권 해 연 • 장 아 • 김 성 집 • 신 대 희 * • 임 방 호 * • 정 성 현 ^ 경희대학교 약학대학 약물학 • 임상약학교실, *(주)휴온스 중앙연구본부 (Received June 17, 2009; Revised July 27, 2009: Accepted August 10, 2009)

Anti-Obese Activity of HPJ Extract on High Fat Diet-Induced Obese Mice

Hai-Dan Yuan, Hai-Yan Quan, Ya Zhang, Sung-Jib Kim, Dae-Hee Shin*, Bang-Ho Lim* and Sung-Hyun ChungPharmacology and Clinical Pharmacy Lab, College of Pharmacy, Kyung Hee University, Seoul 130-701, Korea

*Research Complex, Sungkyunkwan University, Cheoncheon-dong, Jangan~gu, Suwon, Gyeonggi-do 440-746, Korea

Abstract — In this study, we investigated the anti-obese activity of HPJ extract in C57BL/6J mice. The C57BL/6J mice were randomly divided into five groups: normal control group (Con), high fat diet control group (HFD), treatment groups with HPJ at 125 mg/kg (HPJ125), 250 mg/kg (HPJ250), or 500 mg/kg (HPJ500). To induce an obesity, mice were fed by a high fat diet for 6 weeks, and mice were administered with HPJ extract once a day for 8 weeks. At the end of treatment, we examined the effect of HPJ extract on body weight, plasma lipid, and lipogenic enzymes. HPJ extract was found to lower whole body and epididymal adipose tissue weights and lowered plasma levels of glucose, insulin, triglyceride (TO), total cho­

lesterol (TC), non-esterified fatty acid (NEFA) and leptin, compared to those in HFD group. Histological analyses of the liver and fat tissues of mice treated with HPJ extract revealed significantiy decreased number of lipid droplets and decreased size of adipocytes compared to the HFD group. In addition, HPJ extract preserved the morphological integrity of pancreatic islets. To elucidate an action mechanism of HPJ extract, Western blot and RT-PCR were performed using epididymal adipose tissues. HPJ extract up-regulated the levels of phosphorylated adenosine monophosphate-activated protein kinase (AMPK) and its substrate, acetyl-CoA carboxylasse (ACC). HPJ extract also attenuated lipogenic gene expressions of sterol reg­

ulatory element-binding protein la (SREBPla), fatty acid synthase (FAS), sterol-CoA desaturase 1 (SCDl) and glycerol- 3-phosphate acyltransferase (GPAT) in dose-dependent manners. In contrast, expressions of lipolytic genes such as per­

oxisome proliferator-activated receptor-a (PPAR-a) and CD36, and fatty acid p-oxidation gene, carnitine palmitoyltrans­

ferase-1 (CPT-1) were increased. These results suggest that HPJ extract ameliorates obesity through inhibiting synthesis of lipogenic enzymes as well as stimulating fatty acid oxidation resulting from activation of AMPK, and HPJ extract could be developed as a potential therapeutic agent for obese patients.

Keywords □ HPJ extract, C57BL/6J mice, high fat diet, AMPK, lipogenic and lipolytic enzymes

비만(Obesity)은에너지 섭취와소비의 불균형으로인하식 체

지방< >1 과도하게측적되여 생기는일종의대사성질환으로•서 생

활습관과밀접한관련이 있다.^비만은 지방대사와당대사에 불균형을초 래 고 지 혈 증, 고혈압, 동맥경화, 당뇨병, 지방간, 관절이상등다양한 병뢰행성 질환둘을유발하는원인이된다."^>

현재 비만을 개선시키기 위한치료 전락으로과도한 에너지 섭취의 제한과적당한운동을권장하•고었지만장기간꾸준히 해 야한다는어려운점이 있어최근에는식욕억제제(리덕틸), 지방

*본 논문에 관한 문의는 저자세게로 (전화) 02-961-0373 (팩스) 02-957-0384 (E-mail) [email protected]

흡수 저해제(제니칼)와같은약물이 임상에서사용되고 있으나 불면중, 혈압상승, 지방변등부작용으로사용에 제한을받고있 어이를대체할수있는새로운치료제의개발이요구되고었다.

한편한의학적 관점에서는비만을 비습(지방파수분)과 담옴 (체내수액의 정체에 의한노폐물)의 과잉축적으로 해석하기도 하며이러한대사성 질환은예로부터 방풍통성산, 방기황기탕등 의한방처방으로치료하식 왔다. 생약복합추출물인 HPJ는기 존에 시판된제품들파는견혀 다른한방처방으로서 에로부터사 용되어온비만치료처방의 가감방이며 텍사, 시호, 저령, 대황, 감초, 건강, 육계, 작약, 목단피, 반하, 승마등 1 1중의 생약재로 구성되어 있다.

따라서 본연구에서는고지방식이로유도된 C57BL/6J 비만쥐

(2)

고지방 식이로 유도된 버만 쥐에서 HPJ 추출물의 항비만 효과 287

를 이용하식 HPJ 추출물이 체중, 혈중 지질 및 지방 대사에 머 치는 영향 등을 검토하여 HPJ의 항비만 효과와 작용기전을 살 펴보았다.

실험방법

실험재료

본 연구에서 시용?t HPJ 추출물은 텍사, 시호, 저령, 대황, 감 초 ■둥 1 1 종의 생약으로 구성되어 있으며 (주)?r온스로부터 시료 를 제공받아 사용하였다. HPJ 추출물은 각 구성 생약을 일정 비 율로 흔합하여 추출기에 넣고 물로 80~100T에서 3~4시간 추 출한 다옴 여과하고 능측한 다옴 동결건조하여 얻은 것을 제공 받았다. 시험물질은 HPJ 추출물을 물에 용해하여 흔화한 것을 사용하였다.

실험동물 및 약물투여

6주령의 C57BL/6J mouse를 (주)오리엔트사로부터 구입하여 1 주일 동안 고형사료와 물을 섬취하면서 실험실 환경에 적응시 킨 루 본 실험에 사용하였다. 정상군(Con), 대조군(high fat diet 군, HFD), 실험군 HPJ 125 mg/kg 루늬군, HPJ 250 투여 군과 HPJ 500 mg/kg 투여군 등 5개 그룹으로 나누었으며 정상 군 미우스는 regular dietf- 섬취시켰고 나머지 그룹은 고지방 식 이를 섭취시켰다. HPJ 투여는 고지방 식이 섬취 6주 후부터 시 작하였다. HPJ는 증류수에 용해하여 8주간 경구 투여하였으며 -S-Y-게, 식이 섭취량 및 물 섭취링은 한 주에 두번씩 측정하였다.

고지방식이의 조성은 Table I파 같다.

Table I - Composition of the experimental diet

HFD 45%cal Regular diet

g% kcal% g% kcal%

Protein 24 20 20 21

Carbohydrate 41 35 66 68

Fat 24 45 5 12

kal/kg 4,776 3902

Ingredient g kcal g kal

Casein (from milk) 200 800 200 800

Corn starch 155.036 620 150 600

Sucrose 50 200 500 2000

Dextrose 132 528 0 0

Cellulose 50 0 50 0

Soybean oil 25 225 0 0

Com oil 175 1575 50 450

Mineral mixture 35 0 35 0

Vitamin mixture 10 40 10 40

TBHQ 0.014 0 0 0

DL-methionine - - 3 12

L-Cystine 3 12 0 0

Choline bitartrate 2.5 0 2.0 0

Total 837.6 4,000 1000 3,902

혈액지표분석

혈액 지표 분석을 위한: 혈액 채취는 12 시간 절식 시킨 후 설 시하였다.^ 채혈한 혈액은 3,000 rpm에서 1(>분간 원심 분리한 혈청을 분석에 시'§-하였다.^^ 혈중 포도당 농도는 glucose oxidase method(Trinder method)를 사 g썩여 측정하였으며 , 흡광도 측정 은 UV Spectrophotometer(U-3210, HITACHI™, Japan) 률 사 용 하 였 다. 혈중 인슐린 농 도 는 마 우 스 insulin ELISA kit (Shibayagi, Japan)를 구입하여 ELISA reader(Labsystems, Finland)로 즉정하였다. 혈중 총 콜레스테롤(total cholesterol), 혈 중 중성지방(triglyceride, TG)은 시관 kit(Stanbio, USA)를 구입 Si여 생화학 분석기기 (SMARTLAB, USA)틀 사용하여 측정하였 고 혈중 leptin은 마우 스 leptin ELISA kit(LINCO research, USA)률 구입하쉬 측정하였다.

Fat 부위별 무게(내장지 방, 부고환 지방 ) 측점

, 부고환 지방, brown adipose tissue인 scapular 부위도 같 적출하여 부위벌 무게 및 형태를 비교 하였다.

조직의 형태학적 관찰

쥐에서 적줄한 간, 췌장, 부고환지방을 10 % neutral buffered formalin을 사용하겨 고정. 이후 탈수 및 포매 파정을 거쳐 파라 핀 볼럭을 제 ^ }고 두께 5 나미의 관상 절편으로 제작한 후 xylene 으로 파라핀을 제거시키고, 100%, 95%, 907c, 80%, 70% 알코 을로 친수화시킨 루 hematoxylin과 eosin으로 염색하여 광학현 미경 (Olympus, Japan)으로 관찰하였다.피^

AMPK 인산화촉정

'V-고환 지방에서 Western blot 방 법 으 iil phospho-AMPK, AMPK, phospho-ACC, ACC롤 측정하였 다 . 단백질 분석을 위

헤 부:il환 지방 조직을 lysis buffer(50 mM Tris-HCL pH=7.5, 1 mM EDTA, 0.25% sucrose, 0.4 mg/m/ digonin and 1.5 mM PMSF)를 이용하쉬 균질화 시켰다.그^ 단백실 정량은 Bio- Rad assay reagent(Bio-Rad, USA)를 이용하여 측정하였다. 정량 한 단백질 40 lAgi: 8% SDS-PAGE로 분리한 후 gd을 membrane (Milipore, Cat. No: IPVHOOOlO)에 transfer하고 5% skim milkJii 상온에서 1 시?]: blocking 한 루 1:3000 비율로 희석시 킨 primary antibody(P-AMPK, AMPK, P-ACC, ACC)(Cell signaling Technology, Beverly, USA)와 4°C에서 overnight 하 였 다. 다음 Tris-buffered saline tween-20(TBST)으로 4번 washing 한 푸 1: 5000의 비율로 희석시킨 secondary antibody (Santa Cruz Biotechnology, Santa Cruz, USA)와 상온에서 1 시 간 반응시켰다. 이 후 TBST로 4번 washing하고 ECL solution (Amersham, Sweden)을- 이용하여 X-ray 필름에 developing 하 였다.

(3)

288 원해단 • 권해연 ■정마■김성집 • 신대희 • 임방호 ■정성현

지방 함성에 관여하는 유전자발현 측정

부고환 지방 조직에서 total RNA 분리는 guanidine thiocyanate- water saturated phenol/chroloform 분러 방법을 이용하였다. 물 층에 있는 total RNA는 이소프로관을을 이용하여 침전시켜 분 리한 RNA는 260 nm와 280 nm의 파장에서 흡광도룰 측정하여 량였 고, 총 RNA 10 나g을 Moloney murine leukemia virus transcriptase와 Oligo(dT) 15 primer를 이용하여 역견사하였다.피 Primer의 종류 및 서열은 Table VI에 표시한 바와 같다. PCR 반 응 조건은 95°C에서 30초 동안 번성 , 30초 동안 붙임 (상응한 붙 온도는 Table VI에 표시), 72X에서 30초 동안 연장을 하셔 총 30 cycle 하 였 다 . 이 후 반응 생성물을 0.5 ethidium bromide로 염색된 1% agarose gel을 이용하여 100 V에서 전기 영동 하였다. CPN은 증폭된 유전자둘의 대조군으로 사용되었다.

에너지 소모에 관여하는 유전자발현 측정

부 고환 지방에서 에너지 소모에 관여하는 유전자인 CPT1 (carnitine palmitoyltransferase 1)의 발현을 RT-PCR로 죽정하 였다. Primer의 종류 및 서열은 Table VI에 표시된 바와 같다.

PCR 반응 조건은 에서 30초 동안 번성, 55°C에서 30초 동 안 붙임, 72X에서 30초 동안 연장을 하며 총 30 cycle 하였다.

이후 반응 생성물을 0.5|ig/m/ ethidium bromide로 염색된 1 %

agarose gel을 이용하여 100 V에서 전기영동 하였다. CPN은 증 폭된 유전자들의 대조군으로 사용하였다.

자료 분석 및 통계 처리

모든 실험 결과는 평균±표준 오차로 나타내었다. 당뇨 대조군 (DC)파 비교하며 통계적 유의성을 Student's t-tes& 처리하였으 F<0.05 이하인 경우 유의성 있는 차서가 있는 것으로 판정 하였다.

실 험 결 고^ 및 고 찰

체중

Fig. 1에서 보듯이 고지방식이 대조군 마우스는 정상군 마우스 비하여 체중증가가 뚜렷하였고 개복했을 때 가장 많은 내장 지방을 드러내었다. 반면 HPJ 투여군 마우스는 대조군에 버콩t여 덜 뚱뚱하였고 내장 지방도 적었다. 부고환 지방 역시 대조군 마 우스에서 제일 컸지만 HPJ 투여군에서는 농도 의존적으로 작아 졌옴을 관찰할 수 있었다. 하지만 간의 크기는 각 그룹에서 차어 관찰되지 않았다. Table II는 8주 동안 HPJ 추출물을 경구 투 여한 후 체중번화에 미치는 영향을 그룹간 비교한 결과이다. 대 조군은 정상군에 비하여 체중이 23.1%(^<0.001) 유의적으로 증

Con HFD HPJ125 HPJ250 HPJ500

외형

■ ■ ■

개복

부고환 지방

■ ■ ■ ■ ■

Fig. 1 - Gross appearance of whole body, abdomen, epididymal fat and liver.

(4)

22.5±0.6 27.3 ±0.3 4.8 ±0.3 0.74±0.05 0.17±0.02

22.2 ±0.3 33.6±0.8^^^ 11.5±0.6태우 2.03±0.11^^ 0.28±0.02^^

21.7±0.3 31.6±0.7=" 9.9±0.8 1.88±0.13 0.28±0.04

21.5±0.4 31.4±0.5* 9.9±0.7 1.78±0.16 0.25±0.02

22.2 ±0.3 31.3±0.4* 9.1±0.6 1.72±0.03 0.26±0.01

Values represent the mean±SE (n=6). /xO.Ol, p<0.001 vs. Con; */)<0.05 vs. HFD

가하였고 HPJ125, HPJ250, HPJ500 투여군은 대조군에 비하여 능도 의존적으로 체중이 5.4%, 6.5%, 6.8%(/><().05)로 유의적으 로 감소하였다. 체숭 증가량 역시 정상군에 비하여 대조군에서 139.6%{^<0.001) 유 의 적 으 로 증 가 하 였 고 HPJ125, HPJ250, HPJ500 투여군은 대조군에 비하여 13.9%, 13.9%, 20.9% 감소 하였다. 부고환 지방 무게는 대조군에서 정상군에 버하여 174.3%

{^<0.01) 유의적으로 증가하였고 HPJ125, HPJ250, HPJ500 투 여군에서는 대조군에 비하여 7.4%, 12.3%, 15.3% 농노의존적으 로 감소하였다. 같색지방 무게 역시 대조군에서 정상군에 비하 64.7%(^<0.01)로 유의적으로 증가하였으나 HPJ 엑스 투여 군에서는 감소하는 경향을 보였다. 이 결과는 HPJ 추출물어 High fat diet에 의한 체중증가를 감소시키는 효과가 있옴을 나타내었다.

식이, 음수량 및 식이 효율

Table IIK :- 11룹간 식이, 옴수량, 식이 효율 및 에너지 섭취량 을 나타내었다. 대조군의 경우 정상군에 비해 식이섭취량은 거 차이를 나타내지 않은 반던 HPJ 추출물 투여군은 대조군에 비해 용량 의존적으로 감소함을 알수 있었다. 움용수 섭취량은 대조군에서 정상군에 비헤 31.6% 감 소 하 였 HPJ125, HPJ250, HPJ500 투여군에서는 대조군에 비해 10.4%, 14.1%, 16.1% 로 용량외존적으로 상승함을 알 수 있었다. 식이효율은 대조군에서 정상군에 비해 140% 증가하였고 HPJ 추출물 투여군에서는 대 조군에 약간의 감소는 보이:il 있지만 유의적으로 차미가 나지 않 았다. 하지만 하루 에너지 섬취량은 정상군에 비헤 대조군에서 평균 22.3% 증가하였고 HPJ125, HPJ250, HPJ500 투여군에서 는 5.1%, 5.8%, 7.5% 감소함을 알수 있었다. 이 젼파는 HPJ 추

Table III - Effects of HPJ extract on food and water intakes and feed efficiency ratio

Group Food intake Water intake (g/mouse) (ml/mouse)

Feed efficiency ratio

Energy intake (kcal/day)

Con 242.1 390.4 0.020±0.004 9.64

HFD 241.2 267.2 0.048+0.006끓쌓쌓 11.75 HPJ 125 226.7 295.0 0.043 ±0.008 11.05

HPJ250 222.3 311 0.042 ±0.003 10.83

HPJ500 218.4 318.4 0.049±0.003 10.64

출물이 식이 섭취 억제 효과에 기인된 항 비만 작용이 있을 것 으로 추측된다.

혈중 포도당, 인술린 및 인술린저항성 지수

Table IV는 8주 동안 시료를 경구투여 학 후 공복 시 혈당번 화를 보여주고 있다. 대조군에 비해 HPJ125, HPJ250, HPJ500 투 여 군 은 혈당이 19.1%(**/)<0.01), 24.2%(**/)<0.01), 26.0%

(**/><0.0 1)로 농도 의존적으로 감소하였다. 인술린 수치 역시 HPJ125, HPJ250, HPJ500 투여군에서 대 조 군 에 비해 각각 26.0%, 35.0%, 47.2%(/)<0.05) 감소하는 경향을 나타냈다. 인술 린 저항성지수 역시 HPJ125, HPJ250, HPJ500 투여군에서 대조 군에 비해 각각 28.1%, 39.1%, 51.8%(^<0.05) 감소하여 농도 의존적으로 감소하는 경향을 보였다.

혈액 지표 분석

비만은 흔히 고지혈증과 동반되어 있으녀 식이에 의해 유도된 흰쥐에서는 혈중 중성지방과 콜레스테#이 증가된다고 보:되 j l 있다.^® Table V흐 :- 8 주 동안 시료를 경-7 무여한 후 , 12시 Yb 식시켜 공복 상배의 험동물에서 전혈을 채취한 후 측정한 중 성지방(TG), total cholesterol(TC), 그s):il 지방세포에서 분버되 {: adipokine인 leptin의 농도 그리고 NEFA 농도를 나타낸 것이 다. 혈중 중성지방은 대조군에서 정상군에 비해 유의적으로 높 았으며 {^<0.001) HPJ125, HPJ250, HPJ 500 투여군에서는 대조

Table IV - Effects of HPJ extract on fasting plasma glucose and insulin levels, and homeostasis model assessment values for insulin resistance (HOMA-IR)

Group Blood glucose (mg/d/)

Insulin

(mU/m/) HOMA-IR

Con 100.8+5.0 60.2 ±12.3 14.37±2.41 HFD 152.7±9.3끓라 235.6±34.1 부태 89.96± 16.42^^^

HPJ125 123.5 ±8.9="* 174.4±39.1 52.57± 11.42*

HPJ250 115.7±5.4** 153.2±20.1 44.34±7.00= 내 HPJ500 113.0±5.3** 124.5±20.6=^ 35.43 + 7.26======

Values represent the mean+SE (n=6). 후우우/)<0.001 vs. Con

Values represent the mean±SE (n=6). Homeostasis Model As­

sessment was used to calculate an index of insulin resistance as insulin (mU/m/)xglucose (mM)/22.5. <0.001 vs. Con, *p<

0.05, =^ <0.01 vs. HFD

고지방 식이로 유도된 비만 쥐에서 HPJ 주줄물의 항비만 효과 289

- Effects of HPJ extract on whole body, epididymal and brown fat weights Body weight (g)

Group --- Weight gain (g) Epididymal fat weight(g) Brown fat weight (g)

Initial Final

(5)

290 원해단' 권해연 • 정아■ • 김성집 ■ 신대희 ■ 임방호 • 정성현

Table V - Effects of HPJ ext'ract on plasma parameters

Group TG (mg/d/) Cholesterol (mg/d/) Leptin (ng/m/) NEFA (mEq//)

Con 50.1±3.3 120.3±4.7 2.09 ±0.29 1151.2±63.0

HFD 87.1 ±3.7 황우끓 188.2 ±2.4 부우후 13.74+1.55야벼 1700.2+62.9벼쌓쌀

HPJ125 81.9±5.2 177.0±4.7* 13.04±1.47 1544.5 ±58.0

HPJ250 77.2 ±5.8 171.2±2.8** 12.89±0.94 1539.8 ±24.0

HPJ500 67.7±6.0* 146.3±3.2*** 11.76±1.23 1356.7+98.7**

Values represent the meaniSE (n=6). Plasma parameters were analyzed in plasma samples obtained from blood of 12 hr fasted mice.

*><0.001 vs. Con; *^<0.05, **/><0.01, ***p<OM)l vs. HFD

Table VI - Characteristics of specific primers used for RT-PCR analysis

Gene Forward primer (from 5' to 3') Reverse primer (from 5' to 3') Annealing temperature C*C)

SREBP1 GCGCTACCGGTCTTCTATCA TGCTGCCAAAAGACAAGCG 57

FAS GATCCTGGAACGAGAACAC AGACTCGTGGAACACGGTGGT 57

SCDl CGAGGGTTGGTTGTTGATCTGT ATAGCACTGTTGGCCCTGGA 57

GPAD GGTAGTGGATACTCTGTCGTCCA CATCAGCAACATCATTCGGT 66

PPAR-a CCCTGAACATCGAGTGTCGA CTTGCCCAGAGATTTGAGGTCCT 57

CD36 TCCTCTGACATTTGCAGGTCTATC GTGAATCCAGTTATGGGTTCCAC 51

CPTl CCTGGGCATGATTGCAAAG ACAGACTCCAGGTACCTGCTCAC 55

CPN ATGGTCAACCCCACCGTG TTAGAGTTGTCCACAGTCGGAGA 57

군에 비해 각각 5.8%, 11.4%, 22.4% 낮아져서 농도 의존적으로 낮 아 지 는 경향을 보 였 다 . 총 콜 레 스 테 롤 은 HFD군에 버해 HPJ125, HPJ250, HPJ500 투여군에서 각각 6.0%(습<0.05), 9.0%(습<0.01), 22.3%(/)<0.001)로 유의적으로 낮아지는 경향을 보 였 다. Leptin level은 대조군에 비해 HPJ125, HPJ250, HPJ 500 투여군에서 각각 5.1%, 6.2%, 14.4% 로 농도의존적으로 낮 아지는 경향은 보였지만 유의적인 경향은• 보이지 않았다. NEFA level은 대조군에 비해 HPJ125, HPJ250, HPJ 500 투여군에서 각각 9.2%, 9.5%, 20.2%(/)<0.01)로 농도 의존적으로 낮아지는

경향을 보였다.

조직의형태학적관찰

Fig. 2는 HPJ 추출물이 간, 췌장, 흰색지방인 부고환지방의 형태에 머처는 영향을 살펴본 결과식다. 그림에서 보는 바와 같 이 간조직의 염색 결과에서 대조군에서 많은 지방듬이 관찰 되 었지만 HPJ 투여군에서는 지방구가 농도의 존적으로 현저하게 즐어든 것을 관찰할 수 있었다. 췌장 조직에서는 HPJ 투여군에 췌장 islet의 모앙이나 구조가 대조군에 비해 구조가 뚜렷함

Con H FD HPJ125 HPJ250 HPJ500

Liver

Pancreas

Epididymal fiit

Fig. 2 - Effects of HPJ extract on liver, pancreas, epididymal adipose tissue morphology. Magnification of histological section x 200.

(6)

고지방 식이로 유도된 비만 쥐에서 HPJ 추출물의 항비만 효과 291

을 관찰할수있었고부고환지방쉬1 HPJ투여그룹의지방 size 는 대조군의 지방 size에비해 작았다(Fig. 2). 이결과는 HPJ 추출물이 간에서 지방의축적을 억제하고 췌장 islets의파괴틀 억제하며 부고환지방의 축적을감소시키는효과가있옴을시사 하였다.

Western blot

AMP-activated protein kinase(AMPK) serine/threonine kinase의일원으로세포내에너지상태률감지하는 "에너지 센 서"로 알려져 있는효소이다. AMPK는세포내에너지가부 족한상황- ATP에비해 AMP가증가하는상황에서 활성화 되어 정상에너지균형을회복시키기 위해 ATP를소비하는과 정죽지방산, 콜레스테롤등의 합성을억제하고반대로 ATP를 생산하는 과정 즉지방산 산화, 해당과정을 활성화시킨다.^®

AMPK는지방세포로부터 분비되는 렘틴(leptin)과아디포넥틴 (adiponectin)의세포 내 신호전달 물질로서도 잘알려져 있 다〶1647) Acetyl-CoA carboxylase(ACC)는지방대사가증가할경 우에생성되는효소물질가운데 하나이다.1® AMPK는지방산 합성에서 ACC 등 핵심효소률억제함으로써 ATP의추가적 사 용을억제한다.^® 본연구에서는비만의 표적 단백질인 AMPK ACC의활성을보고자부고환지방조직에서 AMPK률중심으 로활성화되는 marker 들의 발현을 Western blot 방법으로 측 정하였다. Fig. 3에서 보는 바와 같이 HPJ는용량의존적으로 AMPK를현저하게 인산화시켰으며 ACC 역시 현저하게 인산 화시켰다. 이결과 HPJ 투여로인해지방산산화가촉진되는것 으로해석이가능하다.

HPJ

HPJ Con HF 125 250 500

P-AMPK AMPK p-ACC ACC

^ a c tin

Con HF 125 250 500

[ ' ■ M r S B V I

I 헬 ' 1황 I

I i

\ m

Fig. 3 - Western blot analyses of phospho-AMPK, AMPK, phospho- ACC, ACC levels in epididymal tissue. Lysate (40 나g) was subjected to SDS-PAGE. Western blotting using antibodies against phospho-AMPK, AMPK, phospho-ACC, ACC, and actin was carried out as described in Materials and Methods. Actin was used as an control to evaluate relative expression of protein.

L늙 genesis gme

Lipolysisgene

> Fatly acid P- oxidationgene

Fig. 4 - Quantitative RT-PCR analyses of SREBPl-a, FAS, SCDl, GPAX PPAR-a, CD36, UCR CPTl, CPN genes in the presence or absence of HPJ extrcat on epididymal adipose tissue. Total RNA was subjected to RT-PCR as described in Materials and Methods.

RT-PCR

HPJ AMPK 활성화 결과를 검증하기 위해 target gene(lipogenesis, lipolysis 관련유전자들)의 발현을 RT-PCR로측정 한걸과 Fig. 4에서 보듯이 HPJ 투여군에서 lipogenesis 관련 gene 들인 SREBPla, FAS, SCDl, GPAT gene돌의 발현은 농 도의존적으로억제시킨반면에 lipolysis 관련 gene 들인 CD36, PPAR-a의발현은증가시켰고 지방산 산화에 관련된 geneCPT1 gene 의발현 역시증가시켰다.

결 론

HPJ 주 '즐S HFD로비만을유도한 C57BL/6J d]우스에 8주 간경구투여한결과대부분의 지표에서 대조군에 비해 HPJ 투 여군에서 개선되는결파률보여주었다. 이들은체중뿐만아니라 혈당수치에서도유의적인 감소률나타내었으며 체중감소 작용 기전은흰색부고환지방에서 metabolic sensor에해당하는단백 질인 AMPK의활성화와그로인한지방산산화촉진, 그러고부

환지방에서 SREBPla, FAS, SCDl, GPAT lipogenesis gene둘의발현을억제하식지방산의 합성 억제, CD36, PPAR-a lipolysis gene들의발현증가및지방산산화에 관여하는단 백질인 CPT-1 발현증가등에기인하는것으로사료된다. 결론 적으로 HPJ 추출물은고지방식이 유도비만동물모델에서 체중 감소 활성을나타내었고이로 인해 혈당치 및지질프로파일이 개선되는활성을보여주어서 향후 비만치료제 흑은 예방목적

(7)

원해단 • 권해연 • 장어* • 김성집 • 신대희 • 임방호 • 정성현

으로 개발될 수 있을 것으로 기대된다.

참고문헌

1) Ahn, J. Y., Lee, H. J., Kim, S. N., Park, J. H. and Ha, T. Y ,: The anti-obesity effect of quercetin is mediated by the AMPK and MAPK signaling pathways. Biochem. Biophys. Res. Commun.

373, 545 (2008).

2) Song, M. Y., Lv, N., Kim, E. K., Kwon, K. S., Yoo, Y. B., Kim, J. H., Lee, S. W, Song, J. H., Lee, J. H., Lee, S. K., Shin, B. C., Ryu, D. G., Park, B. H. and Kwon, K, B. : Antiobesity activity of aqueous extracts of Rhizoma Dioscoreae Tokoronis on high- fat diet-induced obesity in mice, / Med. Food. 12, 304 (2009).

3) Woo, M. N., Bok, S. H., Lee, M. K., Kim, H. J., Jeon, S. M., Do, G. M,, Shin, S. K., Ha, T. Y. and Choi, M. S, : Anti-obesity and hypolipidemic effects of a proprietary herb and fiber com­

bination (S&S PWH) in rats fed high-fat diets,/. Med. Food 11, 69 (2008).

4) Uludag, I. E, Kulu, U., Sener, U., Kose, S. and Zorlu, Y. : The effect of carbamazepine treatment on serum leptin levels.

Epilepsy. Res. (in press) (2009),

5) Clapham, J. C. and Arch, J. R. : Thermogenic and metabolic antiobesity drugs; rationale and opportunities. Diabetes Obes.

Metab. 9, 259 (2007).

6) Janero, D. R. and Makriyannis, A. : Cannabinoid receptor antagonists: pharmacological opportunities, clinical experience, and translational prognosis. Expert. Opin. Emerg. Drugs. 14,43 (2009).

7) Chakrabarti, R. : Pharmacotherapy of obesity: emerging drugs and targets. Expert Opin. Then Targets. 13, 195 (2009).

8) Kim, D, J., Jeong, Y. J., Kwon, J. H„ Moon, K. D., Kim H. J., Jeon, S. M., Lee, M. K., Park, Y. B. and Choi, M. S .: Beneficial effect of chungkukjang on regulating blood glucose and pancreatic beta-cell functions in C75BL/KsJ-db/db mice, ].

Med. Food 11, 215 (2008).

9) Lim, S., Yoon, J. W, Choi, S. H., Cho, B. J., Kim, J. T, Chang, H. S,, Park, H. S., Park, K. S,, Lee, H. K., Kim, Y. B. and Jang, H. C .: Effect of ginsam, a vinegar extract from Panax ginseng, on body weight and glucose homeostasis in an obese insulin- resistant rat model. Metabolism 58, 8 (2009).

10) Yuan, H. D., Shin, E. J. and Chung, S. H. : Anti-diabetic effect and mechanism of Korean red ginseng in C57BL/KsJ db/db mice. J. Ginseng Res. 32, 187 (2008).

11) Park, C. E., Kim, M. J., Lee, J. H., Min, B. L, Bae, H., Choe, W, Kim, S. S. and Ha, J. : Resveratrol stimulates glucose transport in C2C12 myotubes by activating AMP-activated protein kinase. Exp. Mol. Med. 39, 222 (2007).

12) Akli, S., Chelly, J., Lacorte, J. M., Poenaru, L. and Kahn, A. : Seven novel Tay-Sachs mutations detected by chemical mismatch cleavage of PCR-amplified cDNA fragments.

Genomics. 11, 124 (2001).

13) Hue, L. and Rider, M. H. : The AMP-activated protein kinase:

more than an energy sensor. Essays Biochem. 43, 121 (2007).

14) Nammi, S., Sreemantula, S. and Roufogalis, B. D, : Protective effects of ethanolic extract of Zingiber officinale rhizome on the development of metabolic syndrome in high-fat diet-fed rats. Basic, Clin, Pharmacol Toxicol. 104, 366 (2009).

15) Kola, B., Grossman, A. B. and Korbonits, M. : The role of AMP-activated protein kinase in obesity. Front Horm. Res. 36, 198 (2008)

16) Yano, W, Kubota, N., Itoh, S., Kubota, X, Awazawa, M., Moroi, M., Sugi, K., Takamoto, L, Ogata, H., Tokuyama, K, Noda, T, Terauchi, Y., Ueki, K. and Kadowaki, T : Molecular mechanism of moderate insulin resistance in adiponectin-knockout mice.

Endocr. J. 55, 515 (2008).

17) Janovsk^, A„ Hatzinikolas, G., Staikopoulos, V, Mclnerney, J., Mano, M. and Wittert, G. A .; AMPK and ACC phosphorylation:

Effect of leptin, muscle fibre type and obesity. Mol Cell.

Endocrinol 284, 1 (2007).

18) Pang, J., Choi, Y. and Park, T. ; Ilex paraguariensis extract ameliorates obesity induced by high-fat diet: potential role of AMPK in the visceral adipose tissue. Arch. Biochem. Biophys.

476, 178 (2008).

19) Landree, L. E., Hanlon, A. L., Strong, D. W., Rumbaugh, G., Miller, I. M., Thupari, J. N., Connolly, E. C., Huganir, R. L, Richardson, C., Witters, L. A., Kuhajda, E R and Ronnett, G. V : C75, a fatty acid synthase inhibitor, modulates AMP-activated protein kinase to alter neuronal energy metabolism. J. Biol.

Chem. 279, 3817 (2004).

수치

Table  I - Composition  of the  experimental  diet
Fig.  1 - Gross  appearance  of whole  body,  abdomen,  epididymal  fat  and  liver.
Table  III - Effects  of HPJ  extract  on  food  and  water  intakes  and  feed  efficiency  ratio
Table  VI - Characteristics  of  specific  primers  used  for  RT-PCR  analysis
+2

참조

관련 문서

The epididymal adipose tissue weight in the HFD-A5 group was significantly decreased compared with those in the HFD group, and adipose tissue weights of

The results showed that GAE supplementation significantly decreased body weight gain, adipose tissue mass, leptin concentration, and the levels of TG and TC in the plasma and

Effects of seaweed consumption on CLS formation and size of gonadal adipose tissue in C57BL/6N mice fed HFD To investigate whether or not seaweed consumption can prevent inflammation

12 weeks later, body weight, fat weight, liver weight, blood glucose, total cholesterol, triglyceride, HDL, ALT, AST, obesity related neuropeptides and adipokines,

(B) Representative H&amp;E staining of epididymal adipose tissue and (C) size of adipocytes. Each bar represents the mean ± SD. 1) Means that do not share the same

The consumption of an HF diet compared to the NC group resulted in increases in body weight, the food efficiency ratio (FER), retroperitoneal and subcutaneous fat weights,

Results : HFD-fed mice showed an increase in the body weight and serum biochemistry parameters levels (total cholesterol and triglycerides) as well as organic

After all groups were treated with several kinds of diets for 8 weeks, we measured body weight gain, adipose tissue weights, plasma lipid and