• 검색 결과가 없습니다.

A Survey of Viral Diseases of Proso Millet (Panicum miliaceum L.) and Sorghum (Sorghum bicolor L.) in South Korea

N/A
N/A
Protected

Academic year: 2021

Share "A Survey of Viral Diseases of Proso Millet (Panicum miliaceum L.) and Sorghum (Sorghum bicolor L.) in South Korea"

Copied!
6
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

Research in Plant Disease pISSN 1598-2262, eISSN 2233-9191 www.online-rpd.org

The Korean Society of Plant Pathology

This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/

by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Research Article Open Access https://doi.org/10.5423/RPD.2017.23.3.262

국내 기장 및 수수의 바이러스병 발생 조사

A Survey of Viral Diseases of Proso Millet (Panicum miliaceum L.) and Sorghum (Sorghum bicolor L.) in South Korea

민현근1† · 박충열1† · 이홍규1 · 염윤아1 · 오종희1 · 김봉섭2 · 임승모2 · 윤영남2 · 이수헌1,3*

1경북대학교 응용생명과학부, 2국립식량과학원 남부작물부, 3경북대학교 식물의학연구소

Hyun-Geun Min1†, Chung Youl Park1†, Hong-Kyu Lee1, Yoon-Ah Yeom1, Jonghee Oh1, Bong-Sub Kim2, Seungmo Lim2, Youngnam Yoon2, and Su-Heon Lee1,3*

1School of Applied Biosciences, Kyungpook National University, Daegu 41566, Korea

2Functional Crop Resource Development Division, NICS, RDA, Miryang 50426, Korea

3Institute of Plant Medicine, Kyungpook National University, Daegu 41566, Korea

Throughout year 2015 to 2016, 101 proso millet and 200 sorghum samples were collected from five provinces in South Korea. The samples were subjected to paired-end RNA sequencing and further analyzed by RT-PCR.

The results indicated that Rice black-streaked dwarf virus (RBSDV) was detected from sorghum collected in Gyeongsang province. The other four viruses, including RBSDV, Rice stripe virus (RSV), Barley virus G (BVG), and Cereal yellow dwarf virus (CYDV), were detected from proso millet. Among four viruses, both RSV and RBSDV were identified high frequency from proso millet collected from Gyeongsang province. Otherwise, BVG was nearly equally identified from five provinces, suggesting that the virus was supposedly widespread nation- wide. RBSDV was first identified from both proso millet and sorghum in South Korea. The other virus anno- tated CYDV identified proso millet was shown to have relatively low identities compared to CYDV previously reported, suggesting that the virus might be new member of Polerovirus.

Keywords: Proso millet, Sorghum, RNA sequencing, Virus

서 론

기장(Proso millet, Panicum miliaceum L.)은 화본과의 한해 살이풀로서 식량 및 사료용으로 재배된 가장 오래된 작물 중 하나이다(Kim 등, 2013). 아시아, 아프리카 지역에서는 중요한 식량작물로 활용되고 있으며 서양에서는 주로 새나 가축 등의 사료로 활용되고 있다(Casey와 Lorenz, 1977).

수수(Sorghum, Sorghum bicolor L.)는 쌀, 보리, 밀, 옥수수 에 이어 세계 5대 식량작물 중 하나이며 아프리카와 아시아 등 에서는 중요한 식량작물이며 가축의 사료로도 사용되고 있다 (Srinivas 등, 2010). 기장과 수수와 같은 잡곡은 현재 기능성 식 품 및 건강보조식품으로서 다양한 생리활성에 대한 연구가 이 루어지고 있다. 또한 일부 잡곡들은 소비가 증가하고 있는 추세 이며 최근 여러 유통 업체에서도 다양한 잡곡 및 혼합 곡류의 제품을 시판하고 있다(Kwak 등, 2004; Han 등, 2012). 이와 같이 국내에서 잡곡에 대한 관심이 증가하고 있으나 생산량과 관련 이 깊은 병해충에 대한 연구는 미흡한 실정이다.

세계적으로 기장에 보고된 바이러스는 Barley virus G (BVG),

*Corresponding author Tel: +82-53-950-5763 Fax: +82-53-950-6758 E-mail: [email protected]

These authors contributed equally to this work as co-first authors.

Received May 29, 2017 Revised June 21, 2017 Accepted June 23, 2017

(2)

Research in Plant Disease Vol. 23 No. 3 263

Foxtail mosaic virus (FoMV), Indian peanut clump virus (IPCV), Maize chlorotic mottle virus (MCMV), Panicum mosaic virus (PMV), Rice stripe virus (RSV), Satellite panicum mosaic virus (SPMV), Wheat streak mosaic virus (WSMV) 등이 있다(Cabanas 등, 2013; Park 등, 2017b; Reddy 등, 1998; Qiu와 Scholthof, 2001; Seifers 등, 1999; Sill과 Agusiobo, 1955; Yoon 등, 2012).

또한 수수에 보고된 바이러스는 Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Maize dwarf mosaic virus (MDMV), Sugarcane streak mosaic virus (SStMV), Johnson grass mosaic virus (JGMV), Zea mosaic virus (ZeMV), Pennis- etum mosaic virus (PenMV), Southern rice black-streaked dwarf virus (SRBSDV), Rice black-streaked dwarf virus (RBSDV), Maize rough dwarf virus (MRDV), Sorghum chlorotic spot virus (SCSV) 등이 있으며(Bai 등, 2002; Kendall 등, 1988; Matsukura 등, 2015;

Srinivas 등, 2010; Toler, 1985; Yang과 Mirkov, 1997), 현재까지 국내에서 수수에 보고된 바이러스는 없으며 기장에는 BVG와 RSV 2종만이 보고되어 있다(Park 등, 2017b; Yoon 등, 2012). 따 라서 기장과 수수에 바이러스로 인한 피해와 전염경로, 특성 등 에 대한 정보가 부족하며 저항성 품종 개발 등의 연구가 이루 어지기 어려운 실정이다. 본 연구에서는 차세대 염기서열 분석 (Next generation sequencing, NGS)을 기반으로 국내 기장과 수수의 바이러스병 발생실태를 조사하고 미보고 바이러스에 대한 동정을 실시하였다.

재료 및 방법

시료채집. 국내 기장과 수수에 발생하는 바이러스병 발생 실태를 조사하기 위해 2015년과 2016년 5월부터 10월까지 재 배량이 많은 지역(강원도 횡성군, 영월군, 정선군, 경상북도 안 동시, 의성군, 칠곡군, 예천군, 경상남도 밀양시, 충청북도 단양 군, 전라북도 고창군, 전라남도 나주시, 여수시, 신안군, 영광군, 제주도 제주시)을 선정하여 전국적인 조사를 실시하였으며 기 장의 경우 총 101점(Table 1), 수수의 경우 총 200점의 시료를 채집하였다(Table 2). 육안으로 관찰한 기장과 수수의 주요 병 징으로는 황화, 줄무늬, 위축 등이었으며(Fig. 1) 채집한 시료는 초저온냉동고(-80oC)에 보관하여 실험에 사용하였다.

차세대 염기서열 분석(Next generation sequencing). 기 장 및 수수에 발생하는 바이러스를 조사하기 위해 NGS 분석을 실시하였다. 15년도에 채집한 기장 60점의 시료와 수수 97점의 시료를 동량으로 소량씩 떼어낸 후 혼합하여 각각 1점의 시료 로 만들었으며, 혼합시료는 액체질소를 이용하여 곱게 마쇄한

후 Easy-Spin Total RNA extraction Kit (iNtRON Biotechnology, Seongnam, Korea)를 이용하여 제조사의 매뉴얼에 따라 total RNA를 추출하였다. 혼합시료에서 추출한 total RNA는 테라젠 이텍스(Theragen Etex Bio Institute, Suwon, Korea)의 Illumina Hiseq-2500 (Illumina Inc., San Diego, CA, USA) 장비를 이용하 Table 1. The number of proso millet samples collected in 2015 and 2016

Province Area Yeara

Total 2015 2016

Gangwon Hoengseong 3 - 3

Yeongwol - 3 3

Gyeongbuk Uiseong 15 21 36

Chilgok - 2 2

Gyeongnam Miryang 8 6 14

Jeonbuk Gochang 9 8 17

Jeonnam Yeonggwang - 1 1

Yeosu 5 - 5

Naju 4 - 4

Jeju Jeju 16 - 16

Total 60 41 101

aProso millet samples were collected from June to August 2015 and July to September 2016.

Table 2. The number of sorghum samples collected in 2015 and 2016

Province Area Yeara

Total 2015 2016

Gangwon Hoengseong 7 - 7

Yeongwol 7 8 15

Jeongseon - 6 6

Gyeongbuk Uiseong 19 25 44

Andong - 23 23

Yecheon - 12 12

Chilgok - 3 3

Gyeongnam Miryang 25 11 36

Jeonbuk Gochang 14 - 14

Yeosu 18 - 18

Naju 2 3 5

Shinan - 5 5

Chungbuk Danyang - 7 7

Jeju Jeju 5 - 5

Total 97 103 200

aSorghum samples were collected from May to September 2015 and June to October 2016.

(3)

여 paired-end RNA sequencing을 실시하였으며 각각 10 Gbp (Giga base pair)의 데이터를 생산하였다. 생산된 raw read se- quence 데이터는 씨더스(Seeders, Daejeon, Korea)에 분석을 의뢰하였으며, 씨더스에서 구축한 파이프라인을 이용하여 기 존에 보고된 식물바이러스 염기서열과 상동성을 갖는 virus-like sequence를 선별하였다(Supplementary Fig. 1). 확보한 모든 contig은 미국 국립생물정보센터(National Center for Biotech- nology Information, NCBI)의 BLAST를 통해 재확인하였다.

RT-PCR 진단. 채집한 각각의 시료에서 바이러스의 감염여 부를 확인하기 위해 기장 101점, 수수 200점의 시료에 대해 개 별 진단을 실시하였다. 개별 시료에 대한 total RNA 추출은 위

Fig. 1. Sorghum (A) and proso millet (B-F) samples showing various abnormal symptoms; (A) A sample collected from Miryang in July 2015 detected Rice black-streaked dwarf virus (RBSDV), which showed stripe; (B) A sample collected from Uiseong in July 2015 detected Panicum distortion mosaic virus (PDMV), which showed white streaked; (C) A sample collected from Yeosu in August 2015 detected Barley virus G (BVG), which showed brown stripe and spot; (D) A sample collected from Uiseong in July 2015 detected BVG and PDMV co-infection, which showed brown stripe and yellowing; (E) A sample collected from Uiseong in July 2015 detected Rice stripe virus (RSV), which showed severe white stripe; (F) A sample collected from Miryang in August 2015 detected RBSDV, which showed white streaked and dwarf.

Table 3. Specific primer pairs designed based on contigs obtained from RNA sequencing

Virusa Primer name

Sequence of primer

(5′ → 3′) Amplicon

size (bp) BVG MYDV-CT-F5 GACATCTACTCTTTGAGTTTC

MYDV-CT-R5 TCCTTATTCCTCTTCGGAAC 568

PDMV CYDV-CT-F6 ACATCTAGCACCACAGATCC CYDV-CT-R6 CTCCAGAGTGTCCAGCTCT 412

RBSDV RBSD-N40 CGTCGAAACGAATTAGAAGAGAAAA RBSD-C40 AATCAAAACAAGGTACAGCCAAAGA 235

RSV RSRV-N30 CATCACAGTGTCACTGGTCT RSR4-C10 AGTTGATAATAAGAATAGGA 571

aBVG: Barley virus G, PDMV: Panicum distortion mosaic virus, RBS- DV: Rice black-streaked virus, RSV: Rice stripe virus.

(4)

Research in Plant Disease Vol. 23 No. 3 265

의 방법과 동일하게 실시하였으며, RNA sequencing 분석을 통 해 확보한 contig을 바탕으로 각 바이러스(BVG, PDMV, RBSDV, RSV)에 대한 특이적 프라이머를 제작하였다(Table 3). RT-PCR 은 2× RT-PCR Premix SR-8000 (Genetbio, Korea)을 이용하 여 수행하였으며 2× premixture 10 ml에 forward primer (10 pmol) 1 ml, reverse primer (10 pmol) 1 ml, 증류수 7 ml, 주형 total RNA 1 ml를 첨가하여 최종적으로 20 ml의 반응액을 만들 었다. RT-PCR 반응은 50oC에서 30분간 역전사 반응 후에 95oC 에서 10분간 처리하여 역전사효소를 불활성화 시켰으며, 95oC 에서 30초, 55oC에서 30초, 72oC에서 1분간 35회 증폭한 후에 마지막으로 72oC에 5분간 처리하였다. 증폭된 PCR 산물은 0.5×

TAE 버퍼를 이용하여 만든 1.5% 아가로즈 겔을 EtBr (Ethid- ium bromide)로 염색한 후 전기영동(HOEFER, USA)하여 확 인하였다.

결과 및 고찰

기장 및 수수에 발생하는 바이러스. NGS 분석을 통하여 수 수의 경우 Rice black-streaked dwarf virus (RBSDV), 기장의 경우 RSV, RBSDV, Cereal yellow dwarf virus (CYDV), Maize yellow dwarf virus (MYDV)가 검출되었다(Supplementary Fig. 1). 기장에서 검출된 MYDV의 경우 NCBI BLAST를 통해 확인한 결과 최근 국

내에서 보고한 신종바이러스인 Barley virus G (Zhao 등, 2016) 로 확인되었다. CYDV는 Polerovirus 속에 속하는 바이러스로 RNA sequencing을 통해 획득한 contig의 BLAST 결과 기존에 보고된 CYDV 분리주들과 염기서열 상동성이 매우 낮은 것으로 확인되었다(Supplementary Fig. 1). 따라서 획득한 contig을 바 탕으로 특이적 프라이머를 제작하였으며, RT-PCR 및 클로닝을 통해 전체 염기서열을 결정하였다(자료 미제시). 그 결과 모든 암호화 된 단백질(Open Reading Frame, ORF)의 서열이 다른 Polerovirus 속에 속하는 바이러스들과 10% 이상 차이를 보이 므로 국제 바이러스 분류위원회(International Committee on Taxonomy of Viruses, ICTV)의 종 분류 기준에 따라 신종바 이러스로 동정하였으며, Panicum distortion mosaic virus (PDMV)로 가칭하였다. RNA sequencing 분석을 통해 확보한 contig을 바탕으로 설계한 프라이머를 이용하여 전체 시료에 대해 개별 진단을 실시한 결과 수수의 경우 27점(13.5%)의 시료 에서 RBSDV가 검출되었으며, 기장의 경우 BVG가 17점(16.8%), PDMV가 1점(1%), RBSDV가 4점(4%), RSV가 3점(3%)이 검출되 었으며, 3점(3%)의 시료에서 BVG와 PDMV 그리고 7점(6.9%) 의 시료에서 BVG와 RBSDV의 복합감염이 확인되었다. RSV와 RBSDV의 경우 애멸구(Laodelphax striatellus)에 의해 영속 전염 하는 바이러스로 1960년대에 국내에 대발생한 이후로 발생이 점점 감소하였으나 중국으로부터 애멸구의 대량비래로 인해

Table 4. Result of RT-PCR detection of proso millet samples using specific primers

Year Sample

numbera Collection

region Collection month

Detected virusb

RBSDV RSV PDMV BVG

2015 12 Uiseong July - - + -

13,15,17 Uiseong July - - + +

16,18 Uiseong July - - - +

26,30 Yeosu August - - - +

40,42 Miryang August - + - -

44 Miryang August + - - -

2016 61,62 Miryang July + - - -

66 Miryang August - + - -

69 Yeongwol September - - - +

78 Gochang September + - - +

79 Gochang September - - - +

80 Yeonggwang September - - - +

81-90 Uiseong September - - - +

91-96 Uiseong September + - - +

97 Uiseong September + - - -

aSample numbers were assigned according to priority of collection date.

bRBSDV: Rice black-streaked virus, RSV: Rice stripe virus, PDMV: Panicum distortion mosaic virus, BVG: Barley virus G, +: Positive reaction from RT-PCR, -: Not detected.

(5)

2000년대 이후 벼와 옥수수에서 발생이 지속적으로 보고되고 있으며(Jeong 등, 2012; Lee 등, 2008), 기장과 수수에서 RBSDV 는 국내 첫 발생보고이다. 기장 및 수수에서 RSV와 RBSDV의 발 생은 벼와 옥수수에서의 발생과 마찬가지로 애멸구의 대량비 래와 함께 온난화로 인한 월동 애멸구의 밀도 증가가 원인인 것 으로 예상된다.

채집지역별 바이러스 감염양상. 수수의 경우 2015년도에 채집한 시료 중 밀양(7월)에서 채집한 시료 1점, 2016년도에 채 집한 시료 중 안동(6월)에서 채집한 시료 1점과 의성(9월)에서 채집한 시료 25점에서 RBSDV가 검출되었다. 2000년대 이후 남 부와 중부 지역을 시작으로 전라북도, 강원도 지역에서 벼 및 옥수수에 RBSDV 발생이 확인되었으며(Lee 등, 2005, 2006), 최 근에는 경상남북도 지역의 옥수수 재배단지에서 RBSDV의 발 생이 확인되었다(Lee 등, 2008). 이와 같이 벼와 옥수수의 경우 전국적으로 RBSDV의 발생이 확인되었으나 수수의 경우 전국 적으로 채집한 시료를 대상으로 진단을 실시하였으나 경상도 지역에서만 발생이 확인되었다. 따라서 경상도 지역에서 재배 되고 있는 수수와 다른 지역에서 재배되고 있는 수수의 품종에 대한 저항성 비교와 지역별 애멸구의 밀도 변화 등을 확인하여 정확한 감염경로에 대한 조사가 필요할 것으로 보인다.

기장의 경우 수수와 다르게 다양한 지역에서 바이러스가 검 출되었으며 대부분의 시료에서 바이러스가 단독감염되어 있 으나 일부 복합감염된 시료도 확인되었다(Table 4). 기장에서 RBSDV는 밀양과 의성 그리고 고창에서 채집한 시료에서 감염 이 확인되었지만 고창에서 채집한 시료 중 1점의 시료에서만 RBSDV가 검출되어 수수와 마찬가지로 경상도 지역에서 높은 감염률을 나타내었다. 또한 RSV는 밀양, PDMV는 의성에서 채 집한 시료에서만 감염이 확인되었다. 최근 보고에 따르면 중국 으로부터 서해안 지역에 애멸구의 대량 비래는 5월 말부터 6 월 초에 걸쳐 급격히 이루어지고 있으며 RSV 보독충율은 7.7%, RBSDV 보독충율은 4.4%인 것으로 나타났다(Jeong 등, 2012).

본 조사에서 RSV와 RBSDV가 감염된 시료는 모두 7, 8, 9월에 채 집한 시료이며 애멸구의 대량 비래 후 지역적으로 이동하여 6 월 중하순부터 본격적으로 애멸구로 인한 바이러스 감염이 이 루어지는 것으로 보인다. BVG의 경우 의성, 여수, 영월, 고창, 영 광에서 감염이 확인되어 전국적으로 분포하고 있음을 확인하 였다. BVG는 2016년 보리에서 첫 보고(Zhao 등, 2016) 이후로 2017년 조(Setaria italica)에서도 발생보고(Park 등, 2017a)가 되 었다. 따라서 BVG는 신종바이러스로 보고되었으나 이미 국내 전 지역에 정착하고 있는 바이러스로 예상된다. 또한 BVG는 Polerovirus 속에 속하는 바이러스로 이 속에 속하는 바이러스

들은 복숭아혹진딧물(Myzus persicae), 보리수염진딧물(Sito- bion avenae) 등의 진딧물에 의해 순환형 영속전염(circulative persistent non-propagative manner)을 통해 전염되는 것으로 보고되어 있다(Yang 등, 2008). 복숭아혹진딧물은 기주범위가 매우 넓지만 주로 과수나 채소작물을 가해하기 때문에 기장의 경우 곡류에 많이 발생하는 보리수염진딧물이 BVG의 주요 전 염원인 것으로 생각된다.

본 연구에서는 기장과 수수에 발생하는 바이러스병의 종류 와 분포를 알아보기 위하여 전국적인 조사를 실시하였으며 기보고된 바이러스 이외에 미보고 바이러스(수수-RBSDV, 기 장-RBSDV) 및 신종(기장-PDMV)으로 의심되는 바이러스를 동 정하였다. 이 바이러스들은 주로 애멸구나 진딧물을 통해 전염 되기 때문에 농가에서는 매개충 방제와 함께 월동 잡초 제거 등을 통한 지속적인 관리가 필요할 것으로 보인다. 또한 이상증 상을 나타내는 많은 시료에서 바이러스가 검출되지 않아 바이 러스뿐만 아니라 다른 병해충에 대한 추가적인 실험이 필요할 것으로 생각된다. 본 연구결과를 통해 바이러스병 예방을 위한 저항성 품종 개발 등의 기초자료로 활용될 수 있을 것으로 사 료되며 동정한 바이러스의 전염 경로 및 매개충, 특징 등에 대 한 추가 연구와 지속적인 발생조사가 필요하다.

요 약

2015년부터 2016년까지 국내 5개 지역에서 기장 101점, 수수 200점의 시료를 채집하였다. 채집한 시료에 대해 paired-end RNA sequencing, RT-PCR 진단을 수행하였다. 그 결과, 경상도 에서 채집한 수수에서 Rice black-streaked dwarf virus (RBSDV) 가 검출되었으며, RBSDV, Rice stripe virus (RSV), Barley virus G (BVG), Cereal yellow dwarf virus (CYDV) 4종의 바이러스가 기 장에서 검출되었다. 기장에서 검출된 4종의 바이러스 중 RSV와 RBSDV는 경상도에서 채집한 시료에서 높은 감염률을 보였다.

반면, BVG는 5개 지역에서 모두 감염이 확인되었으며, 이미 전 국적으로 분포되어 있는 바이러스인 것으로 보인다. 본 연구에 서는 국내 기장과 수수에서 RBSDV를 처음으로 동정하였으며, 수수에서 검출된 CYDV는 기존에 보고된 CYDV 분리주와 상동 성이 상대적으로 낮은 것으로 보아 Polerovirus 속의 신종 바이 러스로 예상된다.

Conflicts of Interest

The authors declare that they have no competing and commercial interests in this work.

(6)

Research in Plant Disease Vol. 23 No. 3 267

Acknowledgement

This research was supported by a grant from National Institute of Crop Science, Rural Development Administration, Republic of Korea (Project No. PJ0111282016).

References

Bai, F. W., Yan, J., Qu, Z. C., Zhang, H. W., Xu, J., Ye, M. M. and Shen, D.

L. 2002. Phylogenetic analysis reveals that a dwarfing disease on different cereal crops in China is due to rice black streaked dwarf virus (RBSDV). Virus Genes 25: 201-206.

Cabanas, D., Watanabe, S., Higashi, C. H. and Bressan, A. 2013. Dis- secting the mode of maize chlorotic mottle virus transmission (Tombusviridae: Machlomovirus) by Frankliniella williamsi (Thysanoptera: Thripidae). J. Econ. Entomol. 106: 16-24.

Casey, P. and Lorenz, K. 1977. Millet: functional and nutritional properties. Baker’s Dig. 51: 45-51.

Han, G. S., Chung, H. J., Lee, Y. M. and Yoon, J. H. 2012. Quality char- acteristics of cooked rice with mixed cereals by blending ratio of the cereals frequently consumed in Korea. Korean Soc. Com- munity Living Sci. 23: 537-552.

Jeong, T. W., Kim, B. R., Han, G. S., Kang, D. W., Jeong, I. Y., Lim, H. S.

and Kim, J. S. 2012. Evaluation of pesticide treatment for control of Rice stripe virus after mass migration of small brown plan- thoppers. Res. Plant Dis. 18: 245-249. (In Korean)

Kendall, T. L., Langenberg, W. G. and Lommel, S. A. 1988. Molecular characterization of sorghum chlorotic spot virus, a proposed furovirus. J. Gen. Virol. 69: 2335-2345.

Kim, J. K., Park, S. Y., Yeo, Y. S., Cho, H. S., Kim, Y. B., Bae, H. H., Park, C. H., Lee, J. H. and Park, S. U. 2013. Metabolic profiling of millet (Panicum miliaceum) using gas chromatography-time-of-flight mass spec- trometry (GC-TOFMS) for quality assessment. Plant Omics 6: 73- 78.

Kwak, C. S., Lim, S. J., Kim, S. A., Park, S. C. and Lee, M. S. 2004. An- tioxidative and antimutagenic effects of Korean buckwheat, sorghum, millet and job’s tears. J. Korean Soc. Food Sci. Nutr. 33:

921-929.

Lee, B. C., Hong, Y. K., Hong, S. J., Park, S. T. and Lee, K. W. 2005.

Occurrence and detection of Rice black-streaked dwarf virus in Korea. Plant Pathol. J. 21: 172-173.

Lee, B. C., Hong, Y. K., Hong, S. J. and Park, S. T. 2006. Occurrence of Rice black-streaked dwarf fijivirus in maize. Res. Plant Dis. 12: 62- 64. (In Korean)

Lee, B. C., Jung, J. H., Kim, J. I., Yoon, Y. N., Hong, S. J., Kwak, D. Y.,

Hong, Y. K., Kang, H. W. and Lee, K. W. 2008. Viruliferous rate of the small brown planthopper in the maize field infected with Rice black-streaked dwarf virus. Res. Plant Dis. 14: 226-228. (In Korean)

Matsukura, K., Towata, T., Yoshida, K., Sakai, J., Okuda, M., Onuki, M.

and Matsumura, M. 2015. Quantitative analysis of Southern rice black-streaked dwarf virus in Sogatella furcifera and virus threshold for transmission. Phytopathology 105: 550-554.

Park, C. Y., Min, H. G., Lee, H. K., Yeom, Y. A., Oh, J. H., Kim, B. S., Bae, D.

H., Yoon, Y. N. and Lee, S. H. 2017a. Occurrence of viruses infect- ing foxtail millet (Setaria italica) in South Korea. Res. Plant Dis.

23: 69-74. (In Korean)

Park, C. Y., Oh, J. H., Min, H. G., Lee, H. K. and Lee, S. H. 2017b. First report of barley virus G in proso millet (Panicum miliaceum) in Korea. Plant Dis. 101: 393.

Qiu, W. and Scholthof, K. B. 2001. Genetic identification of multiple biological roles associated with the capsid protein of satellite panicum mosaic virus. Mol. Plant-Microbe Interact. 14: 21-30.

Reddy, A. S., Hobbs, H. A., Delfosse, P., Murthy, A. K. and Reddy, D. V. R.

1998. Seed transmission of indian peanut clump virus (IPCV) in peanut and millets. Plant Dis. 82: 343-346.

Seifers, D. L., Harvey, T. L., Haber, S., She, Y. M., Chernushevich, I., Ens, W. and Standing, K. G. 1999. Natural infection of sorghum by foxtail mosaic virus in kansas. Plant Dis. 83: 905-912.

Sill, W. H. and Agusiobo, P. C. 1955. Host range studies of the Wheat streak mosaic virus. Plant Dis. Rep. 39: 633-642.

Srinivas, K. P., Subba Reddy, Ch. V., Ramesh, B., Lava Kumar, P. and Sreenivasulu, P. 2010. Identification of a virus naturally infecting sorghum in India as Sugarcane streak mosaic virus. Eur. J. Plant Pathol. 127: 13-19.

Toler, R. W. 1985. Maize dwarf mosaic, the most important virus disease of sorghum. Plant Dis. 69: 1011-1015.

Yang, X., Thannhauser, T. W., Burrows, M., Cox-Foster, D., Gildow, F.

E. and Gray, S. M. 2008. Coupling genetics and proteomics to identify aphid proteins associated with vector-specific trans- mission of polerovirus (luteoviridae). J. Virol. 82: 291-299.

Yang, Z. N. and Mirkov, T. E. 1997. Sequence and relationships of sugarcane mosaic and sorghum mosaic virus strains and devel- opment of RT-PCR-based RFLPs for strain discrimination. Phyto- pathology 87: 932-939.

Yoon, Y., Jung, J., Lee, B., Lee, Y., Lee, J., Kim, H., Bae, S., Nam, M., Lee, K.

and Yago, J. 2012. First report of Rice stripe virus of proso millet in Korea. Plant Dis. 96: 150.

Zhao, F., Lim, S., Yoo, R. H., Igori, D., Kim, S. M., Kwak, D. Y., Kim, S.

L., Lee, B. C. and Moon, J. S. 2016. The complete genomic se- quence of a tentative new polerovirus identified in barley in South Korea. Arch. Virol. 161: 2047-2050.

수치

Table 2. The number of sorghum samples collected in 2015 and  2016
Fig. 1. Sorghum (A) and proso millet (B-F) samples showing various abnormal symptoms; (A) A sample collected from Miryang in July 2015  detected Rice black-streaked dwarf virus (RBSDV), which showed stripe; (B) A sample collected from Uiseong in July 2015
Table 4. Result of RT-PCR detection of proso millet samples using specific primers

참조

관련 문서

The objectives of this study were to evaluate excessive soil-water stress to cereal crops by using CS factors at various growth stages and evaluate the use of the yield-SDI

The length and diameter of culm in Ibaegchal were slowly decreased, but the length of ear, the 1000-grain weight and the yield potential were similar for all seeding dates

를 측정한 결과 Fig.. The Hunter' L, a, b value of Korean traditional wine added with different nuruks and different amounts of proso millet. 1) Values with different

Among the cereal samples, sorghum had the highest contamination frequency of DON, ZEA, and FUM, and the co-occurrence of Fusarium mycotoxin was 70.0%, which was higher than