• 검색 결과가 없습니다.

타이타늄 입자 자극에 의한 조골세포에서의 Wnt/β-catenin 신호계의 영향

N/A
N/A
Protected

Academic year: 2021

Share "타이타늄 입자 자극에 의한 조골세포에서의 Wnt/β-catenin 신호계의 영향"

Copied!
8
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

Volume 13, Number 1, June, 2010

※ 통신저자: 이 상 수

강원도 춘천시 교동 153

한림대학교 춘천성심병원 정형외과-골격노화연구소

TEL: 033) 240-5198 FAX: 033) 252-9875 E-mail: [email protected] 접수일: 2010년 6월 7일, 게재확정일: 2010년 6월 10일

*이 논문은 2010년도 정부(교육과학기술부)의 재원으로 한국연구재단의 지원을 받아 수행된 기초연구사업(R13- 2005-022-01000-0)과 2009년도 정부(교육과학기술부)의 재원으로 한국연구재단의 대학중점연구소 지원사업으 로 수행된 연구임(2009-0094072).

타이타늄 입자 자극에 의한 조골세포에서의 Wnt/β-catenin 신호계의 영향

한림대학교 의과대학 골격노화연구소∙정형외과학교실1), 천연의약연구소2), 기초의과학연구센터3)

남주석1,3)∙Sinha Nidi1,3)∙Ashish R Sharma1,3)∙이진구1,2)∙권순창1)∙장준동1)∙이상수1,3)

= Abstract =

Affection of Wnt/β-catenin in Titanium Particles Challenged Osteoblasts

Ju-Suk Nam, Ph.D.1,3), Sinha Nidi, B.S.1,3), Ashish R Sharma, M.S.1,3), Jin-Koo Lee, Ph.D.1,2), Sun-Chang Kwon, M.D.1), Jun-Dong Chang, M.D.1), Sang-Soo Lee, M.D.1,3)

Institute for Skeletal Aging & Orthopedic Surgery1), Institute for Natural Medicine2),

Infectious Disease Medical Research Center, Hallym University College of Medicin, Chuncheon, Korea3)

Purpose: The intracellular mechanisms that lead to periprosthetic osteolysis including impaired bone form- ing activity of osteoblast remain incompletely characterized. To determine the possibility that Ti-particles play a role to regulate Wnt/β-catenin signaling pathway in impaired osteogenesis, we analyzed the stability of β- catenin and the transcriptional changes of regulators for Wnt/β-catenin signaling pathway in MC3T3-E1 osteoblast cells.

Materials and Methods: Ti-particles were prepared by sterilizing and counted on the microscopy. Tran- scriptional changes of OPG, RANKL, LRP5, LRP6, DKK1 and sFRP2 were determined by real-time RTPCR.

Protein level of β-catenin and GSK3βwas detected using Western blotting and immunofluorescence staining.

Results: After 4 hours of treatment of Ti-particles, OPG/RANKL mRNA ratio was significantly decreased.

And also, decreased protein levels of β-catenin and phospho-GSK3β were detected. Using immunofluores- cence stain, it was confirmed that Ti-particles suppressed nucleus staining of β-catenin induced by Wnt3a con- ditioned medium. The results of real-time RT-PCR showed reduced level of LRP5 and LRP6 transcripts, and induced level of DKK1 and sFRP2 transcripts by challenging of Ti-particles

Conclusion: Our report suggests that Ti-particles may play a crucial role in the regulation of Wnt/β-catenin signaling pathway in osteoblast through the transcriptional changes of membrane receptors and extracellular inhibitors for Wnt.

Key Words: Wnt/ β-catenin, Osteoblast, Titanium particle

(2)

서 론

마모편(wear debris)이 골용해(periprosthet- ic osteolysis)의 발생과 진행의 기전에는 마모편 의 다양한 표적 세포들의 영향과 세포-세포간의 상호 영향에 대한 정확한 이해가 필요하다. 특정 마모편은 대식세포는 물론 인근 조직의 조골세포 등의 세포를 자극 할 수 있다7,16,18). 현재까지의 보 고에 의하면 마모편은 조골세포에 직접적인 작용 으로 조골세포에서의 골기질 생성능의 저하를 유 발할 수 있다고 알려져 있다4,15,19). 그러나 이러한 골용해 모델에서의 조골세포의 골형성능 저하 기 전은 아직까지 명확하지 않아 많은 관심이 필요한 상태이다.

당단백질로 구성된 Wnt family는 mes- enchymal progenitor들이 adipocytes와 chondrocytes로의 분화를 억제하면서 골형성을 일으키는 조골세포로의 분화를 촉진시키는 역할을 하여 골형성 및 재형성을 조절한다11,20). 최근에는 조골세포의 Wnt 신호계가 조골세포의 RANKL 의 생성을 억제하거나 Osteoprotegrin (OPG)의 증가를 통하여 파골세포의 활성화를 조절하는 것 으로 보고되고 있다13).

이에 본 연구에서는 골용해 상황에서 Wnt 신 호전달계가 조골세포의 골형성능 저하 기전으로 관여할 가능성을 규명하고자 조골세포에서의 titanium (Ti) 입자에 의한 Wnt 신호전달계의 영향을 분석하였다.

재료 및 방법 1. 세포 배양 및 Ti 입자의 준비

조골세포로 분화할 수 있는 MC3T3-E1 세포주 는 10% 우태아 혈청(FBS; Gibco, Grand Island, New York, USA), 페니실린 및 스트렙 토마이신이 포함된 αMEM (Gibco, Grand Island, New York, USA) 배지를 사용하여 5%

CO2와 37℃ 온도 하에서 배양되었다.

멸균된 Ti입자(Johnson Matthey, catalog

#00681; Alfa-Aesar, a Johnson Matthey Company, Ward Hill, Massachusetts, USA)

를 70% 에탄올에 48시간 이상 담궈 둔 다음, 이 를 다시 PBS로 씻어준 뒤 현미경하에서 5~10 μ m 크기의 입자를 선택하여 농도를 계산한다. 배양 된 세포에 세포당 입자 수를 1:40, 1:80, 1:160의 농도로 7시간 동안 처리하였다17).

2. Real-Time RT-PCR

Ti 입자를 처리한 MC3T3-E1 세포에서 Trizol 을 사용하여 전체 RNA를 추출한 후, 2 μg의 RNA와 Oligo d(T)12-18 및 역전사효소 (Pro- mega, Madison, WI, USA)로 cDNA를 합성 하였다. PCR 반응은 2 μl의 cDNA와 SYBR Green Mix (QIAGEN, Valencia, CA, USA) 를 사용하여 95℃ 15초, 60℃ 15초, 72℃ 20초의 조건으로 수행하였다.

파골세포 형성에 관여하는 OPG, RANKL 및 Wnt 신호전달에 관여하는 LRP5, LRP6, DKK1, sFRP2에 대한 primer를 제작하였다 (Table 1). 정량적 결과 분석을 위하여 GAPDH 의 발현 정도를 가지고 표준화 하였다.

3. Western blot analysis

Ti 입자를 처리한 MC3T3-E1 세포를 PBS로 세척하고 protease inhibitor (Sigma, St.

Louis, MO, U.S.A.)가 포함된 passive lysis buffer (Promega, Madison, WI, U.S.A)를 사용하여 단백질을 추출하였다. 단백질 추출액을 SDS-PAGE를 이용하여 분리한 후, western blotter (Bio-RAD)를 이용하여 PVDF mem- brane (Amersham Pharmacia, Piscat- away, NJ, U.S.A.)으로 옮겼다. Membrane 을 5%의 무지방 우유가 함유된 1X TBST (100 mM Tris (pH7.5), 1.5 M NaCl, 0.5%

tween-20) 용액으로 blocking하고, 1X TBST 로 세척한 후, 일차 항체를 1% 무지방 우유를 포함한 용액에서 부착시켰다. 일차항체 반응 후, membrane을 1X TBST를 이용하여 세척하고, 이차항체를 반응시킨 후, 1X TBST로 세척하고 ECL western blotting detection kit (Amersham Pharmacia)을 사용하여 발광을

(3)

유도한 후, X-ray film (Amersham Phar- macia)을 사용하여 현상하였다. 사용된 일차항 체는 anti-β-catenin antibody, anti-phos- pho-GSK3β antibody, anti-GSK3 anti- body, anti-Actin antibody (Santa Cruz, Santa Cruz, CA, U.S.A.)이며, 각 단백질의 발현 정도는 Actin 발현 정도로 표준화하였다.

4. 면역형광염색

β-catenin의 세포내 이동 및 발현량을 알아보 기 위하여 coverslip에 배양된 MC3T3-E1 세포 에 Ti 입자를 처리한 후, 4% paraformalde-

hyde로 10분간 고정시킨다. 고정된 세포를 10%

normal goat serum으로 blocking하고 anti-β- catenin antibody로 반응시킨다. 1X PBS로 세 척 후, FITC가 부착된 이차항체와 반응시킨 다 음, DAPI가 포함된 mounting 용액을 사용하여 slide위에 mounting 하였다.

결 과

1. 골용해의 지표로서의 OPG/RANKL 비율

Ti 입자들이 조골세포에 미치는 직접적인 영향 을 알아보기 위하여, Ti 입자들을 처리한 MC-

Table 1. Primers for real-time RT-PCR

Gene Forward primer (5’→3’) Reverse primer (5’→3’) Product size GenBank No.

OPG CCACAATGAACAAGTGGCTGTGCT TAGGTAGGTGCCAGGACACATTT 155 NM_008764.3 RANKL CGTGCAGAAGGAACTGCAACACAT TTGATGGTGAGGTGTGCAAATGGC 135 NM_011613.3

LRP5 CCTGGAGCTGTTGAGTGACA GAGTGGGATAGCCACATCGT 124 NM_008513

LRP6 GGACGATCAGTTGGAGTGGT CAGCCCGTTCAATTTTAGGA 127 NM_008514

DKK1 CTGAAGATGAGGAGTGCGGCTC GGCTGTGGTCAGAGGGCATG 183 NM_010051.2 sFRP2 ATCCTGGAGACAAAGAGCAAGACC TGACCAGATACGGAGCGTTGATG 142 NM_009144.1 GAPDH TCAACAGCAACTCCCACTCTTCCA ACCCTGTTGCTGTAGCCGTATTCA 115 NM_008084.2

Fig. 1. Decreased OPG/RANKL ratio after treatment of Ti-particles in osteoblasts. (A) MC3T3-E1 cells were grown overnight in 6-well plates (2×105cells/well). Ti-particles were treated with indicated ratios for 3 hours. Total RNA was purified for real-time RTPCR. The ratio of RANKL/OPG was calculated with the gene expression level of RANKL and OPG normalized with GAPDH. (B) Distribution of Ti-particles in MC3T3-E1 cells visualized by phase contrast microscopy. Black dots indicate Ti-particles.

A B

(4)

3T3-E1 세포주에서 OPG와 RANKL에 대한 mRNA의 발현 변화를 real-time RTPCR 방법 을 이용하여 측정하였다. 4시간 처리한 실험군에 서의 발현양으로 OPG/RANKL 비율을 계산한 결과, 세포당 80개의 입자를 처리한 세포에서는 대조군과 비교하여 30%의 감소를 보였으며, 세 포당 160개의 입자를 처리한 세포에서는 80%의 감소를 나타냈다(Fig. 1).

2. Wnt 신호전달 경로를 조절하는 β-catenin 단백질의 변화

OPG/RANKL의 비율을 유지하면서 조골세포 에 의한 파골세포의 활성 정도를 조절하는 기작으 로 Wnt/β-catenin 신호전달 경로가 잘 알려져 있다14). 따라서, Ti 입자에 의한 Wnt/β-catenin 신호전달 경로의 변화를 알아보고자 Wnt/β- catenin 신호전달 경로의 주요 조절인자인 β- catenin과 β-catenin의 분해에 관여하는 GSK3β 에 대한 변화를 확인하였다. β-catenin의 전체 단백질 양은 Ti 입자에 의해 현저하게 감소됨을 나타냈으며, GSK3β의 활성을 저해하는 인산화도 감소됨을 Western blotting으로 보여주었다 (Fig. 2A). 또한, Wnt3a를 포함한 조건화 배지 와 Ti 입자를 동시에 처리 하였을 때, Wnt3a로

증가된 β-catenin의 핵내 이동을 감소시킴을 면 역형광염색을 이용하여 확인하였다(Fig. 2B).

3. Wnt 수용체인 LRP5/6 유전자 발현

β-catenin의 단백질 양과 핵내 이동을 조절 할 수 있는 인자들 중에 조골세포에서 골형성에 관여 하는 것으로 잘 알려진 Wnt 수용체인 LRP5와 LRP6가 존재한다13). MC3T3-E1 세포주에서 Ti 입자에 의한 LRP5와 LRP6의 발현양은 두 수용 체 모두 유사하게 80% 이상 감소됨을 real-time RTPCR로 확인 하였으며, 1:80과 1:160의 Ti 입자 농도를 처리한 세포에서 두 수용체 모두 감 소량의 차이는 보이지 않았다(Fig. 3).

4. Wnt 저해인자인 DKK1 및 sFRP2 유전자 발 현

Wnt/β-catenin 신호전달 경로의 활성은 다양 한 방법으로 조절 될 수 있는데, 조골세포에서 대 표적으로 Wnt 수용체인 LRP와 결합하여 Wnt 리간드의 신호전달을 저해하는 DKK1, Wnt 리 간드와 직접 결합하여 수용체를 통한 신호전달을 저해하는 sFRP2등이 알려져 있다3,10). real-time RTPCR을 통한 DKK1과 sFRP2의 발현 양상은

Fig. 2. Reduced β-catenin level after treatment of Ti-particles in osteoblasts. (A) MC3T3-E1 cells were grown overnight in 6-well plates (2×105cells/well). Ti-particles were treated with indi- cated ratios for 3 hours. Total cellular proteins were immunoblotted with anti-β-catenin anti- body, anti-phospho-GSK3βantibody, anti-GSK3 antibody, and anti-Actin antibody. (B) For immunofluorescence staining, cells were treated with L-cell conditioned medium (50%), Wnt3a conditioned medium (50%), and Wnt3a conditioned medium (50%) including Ti-parti- cles (1:160). β-catenin was labeled with anti-β-catenin antibody and detected with anti-mouse antibody conjugated with FITC. DAPI was used for nucleus staining.

β

β β

β

A B

(5)

Ti 입자를 처리한 실험군에서 두 유전자 모두 현 저하게 감소하고 있음을 보여주었다(Fig. 4). 또 한, 이들의 발현 양상은 Ti 입자에 의한 OPG/

RANKL 비율의 감소에서와 유사한 농도 의존적 변화를 나타내고 있다.

고 찰

골용해는 인공 고관절 전치환술에서 장기간 사 용한 뒤 인공관절면에서 발생된 마모편에 의한 생 물학적 반응의 결과로 삽입물 주변부의 골조직의 손실 및 인공관절의 고정력이 소실되어 그 수명을

마치게 하는 주요한 합병증이다5). 골용해의 진행 에 있어서 마모편에 대한 향염 반응이 주요한 요 인이라는 이론은 여러 실험적 증거들에 의해서 뒷 받침되어오고 있다. 일반적으로 마모편을 분리된 대식세포에 함께 배양 하였을 때, 혹은 골용해 동 물모델에 도입하였을 경우 pro-inflammatory cytokine들의 합성을 개시하는 현상을 나타낸다.

결국 TNFα나 IL-1과 같은 대식세포로부터 분비 된 pro-inflammatory cytokine들은 직접적으 로 혹은 RANKL의 합성 증가를 통해서 파골세 포의 생성과 활성을 증가 시키게 되고, 이는 인공 관절 후 발생하는 골용해증에서 나타나는 골흡수

Fig. 4. Increased expression of DKK1 and sFRP2 transcriptional level after treatment of Ti-particles in osteoblasts. Total RNA was isolated from Ti-treated MC3T3-E1 cells. DKK1 and sFRP2 were detected by real-time RTPCR. The expression level of DKK1 and sFRP2 was demon- strated as a relative expression level to GAPDH.

Fig. 3. Down-regulation of LRP5/6 in transcriptional level after treatment of Ti-particles in osteoblasts. Total RNA was isolated from Ti-treated MC3T3-E1 cells. LRP5 and LRP6 were detected by real-time RTPCR. The expression level of LRP5 and LRP6 was demonstrated as a relative expression level to GAPDH.

(6)

(bone-resorption)로 이어진다1,7,16). 이와 같은 연구 결과들은 골용해를 설명하는 비교적 단순화 된 모델을 제공하고 있다.

마모편은 대식세포는 물론 인근 조직의 조골세 포 등의 다른 종류의 세포의 활동에도 영향을 미 치게 된다. 골용해에서 보여지는 과도한 파골세포 형성을 완전히 이해하기 위해서는 파골세포 형성 을 조절하는 여러 cytokine들의 신호전달에 관여 할 수 있는 마모편의 다양한 영향을 이해하여야 한다. 최근 연구에 의하면 Ti이 대식세포에서 anti-osteoclastogenic 활성을 갖는 IFN-γ와 IL-6 신호전달을 각각 p38의 활성과 SOCS3, 그 리고 SOCS1을 통해서 저해한다는 보고를 하기도 하였다17). 따라서, 마모편이 골용해의 발생과 진 행에 어떻게 관여하는가에 대하여 마모편이 다양 한 표적 세포들에 미치는 영향, 인근 세포들간의 상호 작용들에 대한 자세한 이해가 필요하다. 특 히 조골세포와 파골세포와 관련된 영향은 골 재형 성의 항상성 기전에 주로 영향을 미치게 되므로 주의를 요한다.

임상적 관점에서 인공관절 후 발생하는 골용해 증은 단순히 골 흡수에 의한 현상으로만 설명 할 수 없으며 골형성능 저하에 대한 초점을 두고 접 근하여야 치료 타깃으로 발전시킬 수 있다. 실제 로 실험적으로도 폴리에틸렌과 금속 입자는 조골 세포에 의하여 탐식되어 골과 기질 형성을 억제하 게 된다6). 이 현상은 in vitro에서 대식세포에서 처럼 마모편의 크기, 조성, 용량에 따라 결정된다.

골 형성능의 억제와 함께 마모 입자는 조골세포에 서의 RANKL, OPG, IL-1, TNF, IL-11 생성 에 영향을 미치게 된다12). UHMWPE (Ultra- High Molecular-Weight Polyethylene)는 인 간 조골세포에서의 RANKL의 분비를 증가시키며 OPG를 억제한다. 실제로 인간 조골세포에 UHMWPE 마모편을 처리한 배양액에서 파골세 포 형성능의 증가가 확인되었다7-9). 그러므로 조골 세포는 마모편에 반응하여 골형성능의 억제와 파 골세포 분화 유도를 통하여 삽입물 주위 골용해증 병인에 기여하고 있음이 분명 하며 이는 향후 집 중해야 할 내용들이다.

본 연구에서는 Ti 입자를 사용하여 골용해 상황 에서 조골세포에 직접적인 영향을 줄 수 있는 신

호전달 중 Wnt 신호전달계의 관련성을 규명하고 자 하였다. 골대사 및 골형성의 조절에 관여하는 여러 신호전달 가운데, 당단백질로 구성된 Wnt family는 골형성과 골 재형성을 포함한 다양한 세포활동에 관여하고 있다. 발생 과정 혹은 세포 분화시에 Wnt 신호전달계는 mesenchymal progenitor들이 adipocytes와 chondrocytes로 의 분화를 억제하면서 골형성을 일으키는 조골세 포로의 분화를 촉진시키는 역할을 하는 것으로 알 려져있다11). 또한, 조골세포에서의 Wnt 신호전달 계는 파골세포의 형성을 조절하는 것에도 관여한 다. Wnt 신호전달이 조골세포에서의 OPG의 발 현을 증가시키며, OPG는 결국 파골세포 형성의 필수 인자인 RANKL을 억제하게 된다. 따라서, Wnt 신호전달이 조골세포에서 RANKL의 억제 와 OPG의 증가를 통하여 파골세포에 의한 골흡 수를 억제하며, 이는 Wnt 신호전달계가 조골세 포를 통한 골형성은 물론 파골세포를 통한 골흡수 에도 관여함을 보여주는 것이다13).

실험 결과, OPG/RANKL 비율은 Ti 입자를 조골세포에 처리한 후 감소되었는데, 이를 조절하 는 기작에 Wnt/β-catenin 신호전달 경로가 관여 할 수 있는 가능성을 Wnt 수용체인 LRP5, LRP6의 발현 감소 및 Wnt 저해인자인 DKK1, sFRP2의 발현 증가를 통하여 확인할 수 있었다.

이는 canonical 신호전달 경로인 β-catenin을 감 소시키는 기작이 다양한 수준에서 이루어질 수 있 음을 시사한다. 결국 이러한 유전자 발현의 변화 가 Wnt/β-catenin 신호전달 경로의 활성화에 직 접적인 영향을 주게 됨으로써 파골세포 형성을 조 절할 뿐만 아니라 조골세포에 의한 골형성 작용에 도 주요하게 관여할 수 있을 것이라 사료된다.

최근 골형성의 조절에 다양한 역할을 보여주는 Wnt/β-catenin 신호전달 경로에 대한 많은 연구 들이 진행되고 있으며, 임상 연구 결과들 또한 LRP5의 유전자 변이가 골밀도 및 골절과 관련되 어 있음을 보여주고 있다. Wnt-10b, LRP-5/6, sFRP-1, DKK-2, Axin-2, β-catenin과 같은 Wnt 신호전달 경로의 다양한 유전자들에 관한 형질전환 및 유전자 결핍 동물 연구들은 canoni- cal Wnt 신호전달 경로가 파골세포 형성 및 골 흡수 뿐만이 아니라 골기질 형성, 세포분화, 세포

(7)

분열, 세포사멸 등을 포함하는 다양한 조골세포의 생리활성의 조절에 관여하고 있음을 증명한다2). 이러한 Wnt 신호전달 경로에 대하여, 조골세포 의 기능과 관련된 다양한 Wnt 리간드들과 수용 체들의 조합이 갖는 특이성, β-catenin을 경유하 는 canonical 경로 이외의 noncannonical 경로 들의 가능한 역할, 골 재형성 과정에서 파골세포 에 미칠 수 있는 직접적인 영향 등에 관한 향후 연구의 필요성을 제시 하고자 한다.

결 론

Ti 입자는 조골세포에서 Wnt 수용체 발현을 억제하고, 신호저해 조절물질의 발현을 증가시켜 조골세포에서의 β-catenin 신호전달 경로의 활성 화를 억제하였다. 이로 인하여 파골세포 조절에 관여하는 OPG/RANKL 비율을 감소시키며 Wnt 신호전달에 의한 골형성기능을 저해할 것으 로 사료된다.

REFERENCES

1) Baumann B, Rader CP, Seufert J et al.: Effects of polyethylene and TiAlV wear particles on expression of RANK, RANKL and OPG mRNA.

Acta Orthop Scand.75: 295-302, 2004.

2) Bodine C, Scherer MJ: Technology for improv- ing cognitive function. A workshop sponsored by the US Interagency Committee on Disability Research (ICDR): reports from working groups.

Disabil Rehabil. 28: 1567-71, 2006.

3) Cianferotti L,Demay MB: VDR-mediated inhi- bition of DKK1 and SFRP2 suppresses adi- pogenic differentiation of murine bone marrow stromal cells. J Cell Biochem. 101: 80-8, 2007.

4) Dean DD, Schwartz Z, Blanchard CR et al.:

Ultrahigh molecular weight polyethylene parti- cles have direct effects on proliferation, differen- tiation, and local factor production of MG63 osteoblast-like cells. J Orthop Res. 17: 9-17, 1999.

5) Gallo J, Kaminek P, Ticha V, Rihakova P,Dit-

mar R: Particle disease. A comprehensive theory of periprosthetic osteolysis: a review. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 146: 21-8, 2002.

6) Goodman SB, Ma T, Chiu R, Ramachandran R,Smith RL: Effects of orthopaedic wear parti- cles on osteoprogenitor cells. Biomaterials. 27:

6096-101, 2006.

7) Granchi D, Amato I, Battistelli L et al.: Molec- ular basis of osteoclastogenesis induced by osteoblasts exposed to wear particles. Biomateri- als. 26: 2371-9, 2005.

8) Granchi D, Ciapetti G, Amato I et al.: The influence of alumina and ultra-high molecular weight polyethylene particles on osteoblast-osteo- clast cooperation. Biomaterials. 25: 4037-45, 2004.

9) Gutwein LG,Webster TJ: Increased viable osteoblast density in the presence of nanophase compared to conventional alumina and titania particles. Biomaterials. 25: 4175-83, 2004.

10) Heider U, Hofbauer LC, Zavrski I, Kaiser M, Jakob C, Sezer O: Novel aspects of osteoclast activation and osteoblast inhibition in myeloma bone disease. Biochem Biophys Res Commun.

338: 687-93, 2005.

11) Hill TP, Spater D, Taketo MM, Birchmeier W,Hartmann C: Canonical Wnt/beta-catenin signaling prevents osteoblasts from differentiat- ing into chondrocytes. Dev Cell. 8: 727-38, 2005.

12) Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Boyle WJ, Riggs BL: The roles of osteo- protegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J Bone Miner Res. 15: 2-12, 2000.

13) Holmen SL, Zylstra CR, Mukherjee A et al.:

Essential role of beta-catenin in postnatal bone acquisition. J Biol Chem. 280: 21162-8, 2005.

14) Kieslinger M, Folberth S, Dobreva G et al.:

EBF2 regulates osteoblast-dependent differentia- tion of osteoclasts. Dev Cell. 9: 757-67, 2005.

(8)

15) Lohmann CH, Dean DD, Koster G et al.:

Ceramic and PMMA particles differentially affect osteoblast phenotype. Biomaterials. 23:

1855-63, 2002.

16) Purdue PE, Koulouvaris P, Potter HG, Nestor BJ,Sculco TP: The cellular and molecular biolo- gy of periprosthetic osteolysis. Clin Orthop Relat Res. 454: 251-61, 2007.

17) Rakshit DS, Ly K, Sengupta TK et al.: Wear Debris Inhibition of Anti-Osteoclastogenic Sig- naling by Interleukin-6 and Interferon-{gamma}

Mechanistic Insights and Implications for Periprosthetic Osteolysis. J Bone Joint Surg Am.

88: 788-99, 2006.

18) Vermes C, Chandrasekaran R, Jacobs JJ, Galante JO, Roebuck KA,Glant TT: The effects of particulate wear debris, cytokines, and growth factors on the functions of MG-63 osteoblasts. J Bone Joint Surg Am. 83-A: 201- 11, 2001.

19) Wang ML, Nesti LJ, Tuli R et al.: Titanium particles suppress expression of osteoblastic phe- notype in human mesenchymal stem cells. J Orthop Res. 20: 1175-84, 2002.

20) Zou L, Zou X, Li H et al.: Molecular mecha- nism of osteochondroprogenitor fate determina- tion during bone formation. Adv Exp Med Biol.

585: 431-41, 2006.

수치

Table 1. Primers for real-time RT-PCR
Fig. 2. Reduced  β-catenin level after treatment of Ti-particles in osteoblasts. (A) MC3T3-E1 cells were grown overnight in 6-well plates (2×10 5 cells/well)
Fig. 3. Down-regulation of LRP5/6 in transcriptional level after treatment of Ti-particles in osteoblasts

참조

관련 문서

co-treatment with hispidulin and TGF-β up-regulated the protein of expression E-cadherin and occludin against TGF-β-induced in MCF-7 and HCC38 cells.. The

MC3T3-E1 cell morphorologies on the (a) CP-Ti surface and (b) nano-mesh surface for 20 min culturing time.. MC3T3-E1 cell morphorologies on the (a) CP-Ti surface and

From the results of Micro Vickers hardness test, Ti- 40Hf alloy showed significantly increasing of hardness and tensile strength than others in the case of

The untreated surfaces and AA plasma treated with 3D-PCL surfaces were also examined for their in vitro pre-osteoblast (MC3T3-E1) cells proliferation and

The surface of untreated Ti, SLA treated Ti, and AA plasma polymerized SLA/Ti were also examined for their proliferation and differentiation of

F F Fi i ig g g.. C) 처리한 시편의 미세조직을 관찰한 것이다.. 950× 10 -6 ㎂/㎠ 이므로 Cp-Ti 의 시편에서 부식성이 다소 양호하게 나타났다.이러한 부식특성의 차이는 Cp-Ti

In vitro cell migration in APE or JAG1 siRNA-treated M059K cell line Fig,11 Down-regulation of JAG1 induces S phase arrest in

Null hypotheses of this study was there is no difference in root canal length determination between conventional and heat-treated Ni-Ti files by 2