저작자표시-비영리-동일조건변경허락 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게 l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. l 이차적 저작물을 작성할 수 있습니다. 다음과 같은 조건을 따라야 합니다: l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건 을 명확하게 나타내어야 합니다. l 저작권자로부터 별도의 허가를 받으면 이러한 조건들은 적용되지 않습니다. 저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다. 이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다. Disclaimer 저작자표시. 귀하는 원저작자를 표시하여야 합니다. 비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다. 동일조건변경허락. 귀하가 이 저작물을 개작, 변형 또는 가공했을 경우 에는, 이 저작물과 동일한 이용허락조건하에서만 배포할 수 있습니다.
THESIS FOR DEGREE OF MASTER OF SCIENCE
Map-based cloning and functional analysis of
spotted leaf 3 in rice
BY
SEUNG-HYUN WANG
FEBRUARY, 2014
MAJOR IN CROP SCIENCE AND BIOTECHNOLOGY
DEPARTMENT OF PLANT SCIENCE
Map-based cloning and functional analysis of
spotted leaf 3 in rice
UNDER THE DIRECTION OF DR. NAM-CHON PAEK
SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL
OF SEOUL NATIONAL UNIVERSITY
BY
SEUNG-HYUN WANG
MAJOR IN CROP SCIENCE AND BIOTECHNOLOGY
DEPARTMENT OF PLANT SCIENCE
FEBRUARY, 2014
APPROVED AS A QUALIFIED DISSERTATION OF SEUNG-HYUN WANG FOR THE DEGREE OF MASTER
BY THE COMMITTEE MEMBERS
FEBRUARY, 2014
CHAIRMAN Hee-Jong Koh, Ph.D. VICE-CHAIRMAN Nam-Chon Paek, Ph.D. MEMBER Do-Soon Kim, Ph.D.Map-based cloning and functional analysis of
spotted leaf 3 in rice
SEUNG-HYUN WANG
ABSTRACT
A rice lesion mimic mutants (LMMs), which display spontaneous cell death on leaf surface without pathogen attack, have been reported in many plants, including maize, barley, Arabidopsis thaliana and rice. Thus, the molecular mechanisms underlying the control of lesion mimic and resistance were very intricate in plants. Mitogen-activated protein kinase (MAPK) is a significant signaling module for reacting to diverse extracellular stimuli in plants. MAPKs have been researched on signaling pathways containing hormone response, development, disease resistance, and abiotic stress. Abscisic acid (ABA) is an important plant hormone in various aspects of plant development. Lesion mimic mutant spotted leaf 3 (spl3) in rice, irradiated by gamma rays, develops cell death spontaneously in leaves. Histochemical analysis revealed that hydrogen peroxide and singlet oxygen were highly accumulated in the spl3 mutant leaves compared with the wild type. we identified one base pair deletion in the first exon of a candidate gene, LOC_Os03g06410, encoding MAPKKK, OsEDR1, which is the sequence ortholog of AtEDR1 (Arabidopsis Enhanced Disease Resistance 1), a putative MAPK kinase kinase. SPL3 transcripts were constantly suppressed in ABA- and SA-treated
ii
induction, although SPL3 transcript levels were reduced or not changed at the two HAT. We additionally examined the transcriptional response of SPL3 to cold conditions (4℃) and observed that SPL3 transcript was constantly suppressed as in SA. SPL3 transcripts accumulated highly in leaf sheath and leaf blade, suggesting the possible role of SPL3 gene in the protection of the cells from the generation of necrotic lesion in leaves. Although SPL3 transcripts were considerably altered in these stress conditions, no significant difference was observed in the phenotypic change to the stresses between the wild type and mutant. Under ABA-containing media spl3 mutant had significantly longer primary and adventitious roots in length and more adventitious roots in number compared to those of the wild type; the reduced growth retardation of spl3 mutant was more obvious in 10 µM than 5 µM ABA-containing media. Transcriptional regulations of ABI1 and ABL1 are less sensitive to exogenous ABA treatment in spl3 mutant, whereas ABI3 was hyper sensitive in the mutant. Interestingly, the transcript level of ABI4 was constantly lower in spl3 mutant than in the wild type irrespective of exogenous ABA treatment. Our results suggested that spl3 mutation led the plant response to be less sensitive to ABA by altering transcript levels of various ABI genes in ABA signaling cascades.
Keywords: spotted leaf 3 (SPL3), Map-based cloning, Mitogen-activated protein kinase (MAPK), ABA stress, root development, rice, ABA insensitive (ABI)
CONTENTS
ABSTRACT ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ i
CONTENTS ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ iii LIST OF TABLES AND FIGURES ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ iv ABBREVIATION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ v INTRODUCTION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 1
MATERIALS AND METHODS ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 8
RESULTS ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 13
DISCUSSION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 34
REFERENCES ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 40
iv
LIST OF TABLES AND FIGURES
Table 1. Primers used in this study
Figure 1. Phenotypic characterization of spl3 mutant
Figure 2. Reactive oxygen species (ROS) accumulation
in spl3 mutant
Figure 3. Map-based cloning and isolation of spotted leaf 3 (SPL3)
Figure 4. Alignment of the conserved domain of kinase domain (KD)
from diverse organisms
Figure 5. Expression patterns of SPL3.
Figure 6. Phenotypic observation of WT and spl3 with
exogenous ABA treatment
Figure 7. Phenotypes of spl3 and osedr1 plants under dark- and
MeJA- induced senescence
Figure 8. Time course expression patterns of ABI insensitive genes
in WT
Figure 9. Expression patterns of ABI insensitive genes without and
ABBREVIATION
LMM Lesion mimic mutant
spl3 spotted leaf 3
MAPK Mitogen-activated protein kinase ROS reactive oxygen species
DT Days of treatment CL Continuous light SD Short-day
ABI1 ABA insensitive 1 ABI2 ABA insensitive 2 ABI3 ABA insensitive 3 ABI4 ABA insensitive 4 ABI5 ABA insensitive 5 ABL1 ABA insensitive 5-like 1 RT-PCR Reverse transcription-PCR DAB 3,3-diaminobendizine
SOSG Singlet Oxygen sensor green H2O2 Hydrogen peroxide
1O
2 Singlet oxygen
SSR Simple sequence repeat STS Sequence-tagged site WT Wild-type
6
INTRODUCTION
A rice lesion mimic mutants (LMMs), which display spontaneous cell death
on leaf surface without pathogen attack, have been reported in many plants,
including maize, barley , Arabidopsis thaliana and rice [1,2,3,4,5,6,7,8,9].
Previous researches of LMM genes have reported that they encode diverse
different functional proteins, including membrane-associated proteins [10,
11, 12, 13], a ion channel family member [14, 15, 16], zinc finger proteins
[17, 18], E3 ubiquitin ligase [19], clathrin-associated adaptor protein [20] and
splicing factor 3b subunit3 [21]. Thus, the molecular mechanisms underlying
the control of lesion mimic and resistance were very intricate in plants.
Mitogen-activated protein kinase (MAPK) is a significant signaling module
for reacting to diverse extracellular stimuli in plants. MAPK cascades have
functions in the transduction of extracellular cue to intercellular targets in
eukaryotes. Moreover, MAPKs are formed by MAPK kinases (MAPKKs) and
MAPKK kinases (MAPKKKs) [22, 23, 24]. The downstream target of MAPKs
can be phospholipases, transcription factor, or cytoskeletal proteins [25, 26,
27]. MAPKs have been researched on signaling pathways containing
hormone response, development, disease resistance, and abiotic stress [29,
30].
Abscisic acid (ABA) is an important plant hormone in various aspects of
signal to launch the adaptive responses when plants are confronted by
abiotic stress and biotic stress [31, 32]. Without environmental stress, ABA
is also needed to fine-tune plant growth and development, such as seed
germination and leaf senescence in higher plants [33]. Genetic researches
have helped to demonstrate the key elements of ABA signaling. Five
ABA-insensitive members have been verified by genetic screens in Arabidopsis.
Transcriptome studies using DNA chip analysis showed the changes in the
expression of thousands of genes after ABA treatment and implied the key
roles of transcriptional regulation in ABA signaling in Arabidopsis [34, 35].
Both ABI1 and ABI2 encode 2C-type protein phosphatases (PP2Cs) that
negatively control ABA response [36, 37, 38]. The ABI3 and ABI5 are
transcription factors, B3- and basic leucine zipper (bZIP)-types, respectively
[39, 40]. ABI3 constitutes an extra enhancer of transcription and organize a
complex with ABI5 to control the expression of downstream genes [41].
In this study, we analyzed the rice spl3 mutant which produces
spontaneous cell death on the leaf surface. Map-based cloning showed that
the spl3 encodes a MAPK kinase kinase domain-containing protein. Our
molecular analysis revealed that spl3 mutation alleviated root growth
retardation and delayed leaf senescence under exogenous ABA treatment,
8
MATERIALS AND METHODS
Plant material and growth conditions
The spl3 mutant was generated by γ-ray to japonica rice cultivar ‘norin8’. The wild-type ‘norin8’ and spl3 mutant plants were grown in experimental field in Su-won or growth chambers. The chamber conditions were diurnal
10-h light with normal intensity (200 umol m-² sec-¹ ) at 30℃ and 14-h dark
at 20℃ for short day (SD). For map-based cloning and phenotypic, the
plants were grown by experimental paddy field of Seoul National University
(37°N latitude).
Histochemical detection of reactive oxygen species
ROS accumulation was conducted as previously described with minor
modifications. To determine hydrogen peroxide (H2O2) and superoxide
anion (O2-), leaf samples of 4-week-old plants grown in growth chamber
were incubated in DAB solution containing with 0.1% 3,3’-diaminobenzidine and NBT solution staining including 0.05 nitroblue tetrazolium chloride in
eliminated by 90% ethanol at 80℃. Singlet Oxygen Sensor Green (SOSG;
Invitrogen) reagent was used to detect of singlet oxygen (1O2) described
earlier [42]. Leaves of 4-week-old plants were incubated by 50mM SOSG in
10mM sodium phosphate buffer (pH 7.5). After 30min incubation in dark,
observation of fluorescence emission following excitation at 480 nm was
detected using a laser scanning confocal microscope (LSM510, Carl
Zeiss-LSM510). The red autofluorescence emission from chlorophyll was also
imaged following excitation at 543 nm.
Genetic analysis and map-based cloning
For genetic analysis, F2 population was developed from crossing between a
japonica-type spl3 mutant and tongil-type cultivar Milyang23, which is
derived from hybridization with indica x japonica rice cultivars. A mapping
population using 1800 F2 individuals was used for the population from the
cross between spl3 and Milyang23 was used for locating and fine mapping
of the spl3 locus. Genomic DNA was extracted from young leaves of each
10
SPL3 in 1800 F2 individuals. The F2 population derived from the crossing
between spl3 and norin8 used for the mapping analysis was grown in the
paddy field in the Seoul National university Experimental Farm. To narrow
down the mapping region of spl3 gene, additional sequence-tagged-site
(STS) markers including SSR (simple sequence repeat) and dCAPS
(derived cleaved amplified polymorphic sequence) were used on
chromosome 3.
Stress treatment
To measure the mRNA level of the SPL3 under diverse stress conditions,
norin8 plants were grown in the chamber with a 14-h-light (30℃)/ 10-h-dark
(20℃) cycle. Plants at the 2-week-old were treated with drought (leaf
segments put on the petri dish without water), salt (addition of 150 µM NaCl),
cold (exposure to 4℃), sucrose(150 µM) and SA (100 µM) as previously
described [43]. To check phenotypic difference between WT and spl3,
plants were used as described. For drought stress treatment WT and spl3
plants, plants were grown both growth chamber with a 14-h-light (30℃)/
10-h-dark (20℃) cycle and greenhouse at commercial soil for 4-week-old in pot
salinity stress, plants grown in growth chamber for 4-week-old were treated
200mM NaCl solution and the solution was changed every day. In order to
cold stress response, WT and spl3 grown in growth chamber for 4-week-old
were put in 4℃ cold room with 14-h-light / 10-h-dark. To evaluate ABA
tolerance, seeds were germinated on 1/2 MS medium under dark condition
at 30℃ for 2 days. After 10 d of growth, plants were transferred to 1/2 MS
medium with 10 µM ABA. Shoots and roots were sampled.
RNA isolation and Quantitative real time PCR
(qRT-PCR) analysis
Total RNA was extracted from the 4-week-old plants with the MG™ Total RNA Extraction Kit (Macrogen, Korea). First strand cDNA was synthesized
with 2 ng of total RNA in a 25ul volume using M-MLV reverse transcriptase
and oligo (dT) 15 The 20ul of qRT-PCR mixture mixed 2ul of the cDNA
mixture (25ul), 10ul of 2X GoTaq PCR mix (Roche) and 0.25l of the primers.
PCR was operated on the Light Cycler 2.0 instrument device (Roche
12
Table 1. Primers used in this study.
Gene Forward primer (5’→3’) Reverse primer (5’→3’)
Primer used for RT-qPCR
RT-SPL3 TATGGGAATGCTGGCAGAA CTGGGACTCCTGGTGAGAAG RT-OsABI1 AACGAGAGGCTGCACTGA CTAGTAGCTTCCTGCTCTG RT-OsABI2 TGCCATGTCGCGATCAATAG AGACCATCACTAGCAAGAACGAGA RT-OsABI3 CTGCAGGAGGGTGATTTCAT CTCACCTTCACACCACGTATC RT-OsABI4 ACCCCTGGTTCGATCTCTTC AGCTGGAACGCCAAGCTAAG RT-OsABI5 CGAAGCTGAACTGAACTATC CTGGCTGCCACCCCTATTTG RT-OsABL1 GCGGCAGAGGCGGATGAT GTTCGTCGGAGGCAAAATCT RT-OsUbq5 ACCACTTCGACCGCCACTACT ACGCCTAAGCCTGCTGGTT Primer used for map-based cloning
Primer name Forward primer (5’→3’) Reverse primer (5’→3’)
RM14430 AAGCAACGCAAGAACCCTTGG ATGGCCGTCCAATAAACCAACC RM14374 CATGAGACAGCGAAGAACAATGG CCGGTACTGTACTGAGACTGAGAGG RM14423 AGTCAGTCAGTCCAATTCAGTCACG AGGACGACGACGAGTGTAACTGC RM14395 AATATCCGCAGCCGAAACATAGC ACCGACCAAACCAACACAATCG spl3 SSR-5 ACCCTTCTGTGGTTGTGTCC GACATGAATATGTTCCTCCTGCT
RESULTS
Phenotypic characterization of the spl3 mutant
Lesion mimic mutant spotted leaf 3 (spl3) in rice, irradiated by gamma rays,
develops cell death in leaves. In natural field conditions, the spl3 mutant
appears small reddish brown spot on leaves, and shows semi-dwarf
phenotype compared to wild-type Norin 8 (Fig.1A). The lesion mimic
phenotype of spl3 continuously produced and finally dispersed over the
whole leaf surface (Fig.1B). Even under conditions, these lesion mimic
phenotype still appeared on the mutant leaves (data not shown). To
investigate the phenotypic change of spl3 mutant during leaf development,
we observed spl3 mutant throughout developmental stage in the paddy field.
Some reddish brown spots were initially observed in spl3 mutant eight
weeks after sowing, and the mutant exhibited necrotic lesions over time.
The mutant lesion appeared from older leaves and moved from the tip to the
bottom of the leaves (Fig.1C), whereas the wild-type leaves did not display
any lesion symptom. The phenotypic characterization of spl mutant
suggests that SPL3 is essential for protection of rice leaves from cell
14
Fig.1 Phenotypic characterization of spl3 mutant. (A,B) 80–day-old wild-type
and spl3 plants (A top), leaf blades (bottom) and magnified spl3 mutant
plant(B). C, 8-week-old leaf blades of spl3 in 2nd tillers grown under natural
paddy field.
Two kinds of ROS related to cell death lesion under
constant light conditions.
Many earlier studies showed that lesion mimic mutants are affected by light
[44, 45]. We hence first tested the effects of light on the mutant phenotype in
growth chamber. When grown under short-day (SD; 10-h light, 30℃ / 14-h
dark, 20℃) conditions, both wild-type and mutant plants did not display any
mutant phenotype on leaves. Under constant light conditions, however, red
spot with some necrotic lesions appeared in spl3 mutant leaves (Fig.2A). As
excessive accumulation of reactive oxygen species (ROS) can cause leaf
variegation and/or necrotic lesions in some rice mutants, we next examined
the accumulation levels of three types of ROS (singlet oxygen, superoxide
and hydrogen peroxide) in the spl3 leaves grown under CL conditions
(Fig.2B and C). Histochemical analysis revealed that hydrogen peroxide and
singlet oxygen were highly accumulated in the spl mutant leaves compared
with the wild type (Fig. 2B and C), and superoxide level, however, was not
significantly different between the wild type and mutant leaves (data not
shown). These results suggest that red spot observed in spl3 mutant were
16
Fig.2 Reactive oxygen species (ROS) accumulation in spl3 mutant. A,
The wild-type and mutant were grown under short day 30℃ (SD) and
constant light (CL) for 1 month in growth chamber. B. Hydrogen
peroxide(H₂O₂) detected by 3,3’-diaminobenzidine (DAB) in spl3. C, accumulation of singlet oxygen (¹O₂) was detected by SOSG
Map-based cloning of the spl3 locus, which encodes
MAPK kinase kinase.
To isolate SPL3 gene, we performed map based cloning using 1771 F₂
plants that were developed from a cross of spl3 (japonica) mutant and
Milyang23 (a tongil-type indica/japonica hybrid cultivar). In F₂ populations,
the segregation ratio of the wild-type and mutant types were 3.6:1, indicating
that the spl3 mutant phenotype is handled by a single recessive gene. spl3
gene was previously mapped to the short arm of chromosome 3 [46]. We
narrowed down the spl3 locus to a 415 kb interval between RM14395 and
RM14423 on chromosome 3 (Fig.3A). Using two sequence-tagged site (STS)
and 1 simple sequence repeat (SSR) markers, the spl3 locus was finally
delimited to a 161.2-kb interval between S3015.2 and SSR-5, in the BAC
clone AC099401 and AC119797 (GenBank accession number) (Fig. 3B). In
this genomic region, we found sixteen candidates based on the Rice
functional genomic expression database of the Salk Institute Genomic
Analysis Laboratory (http://signal.salk.edu/cgi-bin/RiceGE). Sixteen
expressed genes were cloned by RT-PCR or genomic PCR. As a result, we
identified one base pair deletion in the first exon of a candidate gene,
18
arginine (Arg, R), leading to premature translational termination (Fig. 4).
OsEDR1 consists of 1018 amino acids with protein kinase domain at the
C-terminal region, (Fig. 4). The premature stop codon occurred in the
N-terminal of spl3 abrogated the translation of protein kinase domain, which
has been well conserved among both monocot and dicot species. For
genetic complementation of the spl3 mutant, we crossed spl3 (as a maternal
plant) and osacdr1 T-DNA insertion mutant (as a pollen donor), in which the
same OsEDR1 gene was knocked out. All F1 plants displayed the spotted
leaf phenotype as the parents and the 1-bp deletion of spl3 was confirmed
by dCAPS analysis (Fig. 5). These results indicate that OsEDR1 is the gene
Fig.3 Map-based cloning and isolation of spotted leaf 3 (SPL3).
A, Genetic mapping of the spl3 locus. The spl3 locus was mapped
between simple sequence repeat (SSR) markers, initially, RM14395 and
RM14423, at the short arm of chromosome 3. PCR-based SSR and STS
marker primers are listed in Table S1. B, Fine mapping of the SPL3 locus
with extra STS and next generation sequencing (NGS)-based SSR markers.
C, Physical mapping of spl3 region. The spl3 region was narrowed down to
a 161.2-kb interval between S3015.2 and SSR-5 using 6 F recombinant
individuals. D, SPL3 gene structure. Thirteen exons and 11 introns are
20
Fig.4 Alignment of the conserved domain of kinase domain(KD) from
diverse organisms. The kinase domain is indicated by red underline.
Shown are O.sative, S. bicolor, B. distachyon, G. max and Os03g06410
The transcript accumulation of SPL3 was remarkably
altered under multiple abiotic stress conditions.
OsEDR1, a sequence ortholog of Arabidopsis EDR1, show enhanced
resistance to bacterial blight disease (Xanthomonas oryzae pv. oryzae) [47].
In contrast, OsEDR1/OsACDR1-overexpressing plants obtained enhanced
resistance to rice blast (Magnaporthe grisea), and both loss-of-function and
RNA-silencing OsEDR1/OsACDR1 mutants are susceptible to M. grisea [48].
In addition, OsEDR1 expression was rapidly and transiently regulated by the
diverse environmental stress conditions during short time frame of 30-120
min. To further study the function of SPL3 in plant response to abiotic
stresses, we examined time course expression of SPL3 for 24 hours in
response to multiple abiotic stresses, because some genes encoding
MAPKKK such as DSM1 are induced at the various time points for 24 hours
after abiotic stress treatment [49]. In the previous report, SPL3 gene was
transiently down-regulated within two hours after various abiotic stress
treatments such as ABA, SA, drought, sucrose and NaCl, but not
significantly altered at NaCl treatment. qRT-PCR experiments in this study
revealed that the expression profiles of SPL3 gene are consistent with the
previous report until two hours after treatment (HAT) (Fig. 4A). In the
22
conditions with different time points for induction, although SPL3 transcript
levels were reduced or not changed at the two HAT. We additionally
examined the transcriptional response of SPL3 to cold conditions (4℃) and
observed that SPL3 transcript was constantly suppressed as in SA. These
results indicate that the transcript accumulation of SPL3 is likely involved in
plant response to various abiotic stresses.
To further determine spatial expression of SPL3, we examined the
transcripts of SPL3 in various tissues of two-week-old wild-type plants by
qRT-PCR (Fig. 4B). As a result, SPL3 transcripts accumulated highly in leaf
sheath and leaf blade, while minimum levels of the transcripts were detected
in shoot base (SB), root (RT) and young panicle (YP). The increased
accumulation of SPL3 transcripts in leaves suggests the possible role of
SPL3 gene in the protection of the cells from the generation of necrotic
Fig.5 Expression patterns of SPL3. A, Expression of SPL3 under diverse
abiotic stress. Two-week-old seedlings were treated to ABA(100mM),
SA(100mM), drought, sucrose(150mM), NaCl(150mM) and cold(4℃).
Relative expression levels of SPL3 were checked by real-time PCR. B,
SPL3 expression in various tissues. Total RNAs were extracted from leaf
24
The spl3 mutant is less sensitive to exogenous ABA
treatment in plant developmental processes
To reveal the regulatory function of SPL3 in diverse stress-signaling
cascades in rice, mutant and wild-type plants were used to examine
phenotypic responses to various abiotic stresses such as drought, NaCl,
cold and ABA. First, we grew the wild-type and mutant plants for four weeks
in the normal growth conditions and transferred them to drought (no water
supply), NaCl (200mM) and cold (4℃) conditions. Although SPL3 transcripts
were considerably altered in these stress conditions (Fig. 4A), no significant
difference was observed in the phenotypic change to the stresses between
the wild type and mutant (data not shown). Next, we tested phenotypic
response of spl3 mutants to ABA stress with one-week-old plants grown in
½ MS media for two days and ABA-containing media for five days. The
wild-type root development was remarkably retarded in ABA-treated conditions;
root growth retardation was much severer in 10 µM ABA-containing media
compared to 5 µM ABA media. In the mock-treated conditions, there was no
significant difference in the development of primary and adventitious roots
between the wild type and spl3 mutant (Fig.5A). However under
ABA-containing media spl3 mutant had significantly longer primary and
adventitious roots in length and more adventitious roots in number
compared to those of the wild type; the reduced growth retardation of spl3
(Fig.5A). These results suggest that spl3 mutation compromised ABA
signaling cascades in primary and adventitious root development.
ABA is a phytohormone critical for plant growth and development
including leaf senescence during plant’s life cycle [49]. As spl3 mutant showed ABA-insensitive phenotype in root growth, we asked whether spl3
mutation causes other ABA-mediated developmental processes. To test
this, we evaluated leaf senescent phenotype of spl3 and osedr1 T-DNA
mutants responsive to ABA treatment (Fig. 5C). Detached 2nd leaves of
two-month-old spl3 and osedr1 mutants were compared with each wild-type
plant, Norin8 and Hwayoung, respectively. spl3 and osedr1 mutants clearly
showed delayed senescence phenotype at five days after dark treatment.
Total chlorophyll level of spl3 and osedr1 were also significantly higher than
those of the wild type plants (Fig. 5D). To ascertain the specific role of SPL3
in ABA signaling, we further tested spl3 mutation effect on the senescing
phenotypes induced by other senescence-inducing components such as
dark and methyl jasmonic acid (MeJA) (Fig. 5). In both dark and 50µM
MeJA-treated conditions, spl3 mutants did not show any significant
difference in senescence phenotype compared to the wild-types (Fig. 5),
indicating that SPL3 is involved in ABA-induced leaf senescence
Fig.6 Phenotypic observation of WT and spl3 with exogenous ABA
treatment. A, Root growth under ABA treatment shows insensitive
phenotype in spl3 at different concentration of ABA (side of a square =
1.8cm). B, The root length and number of 8-day-old plants were measured.
C, ABA treatment in detached leaves of 2-month-old plants grown in paddy
field (20mM ABA). D, Chlorophyll level were measured after ABA treatment
for 5 days using leaf discs of norin8, spl3, Hwa-young and osedr1. The
data are showed as averages + SD. A statistical analysis with a student’s t test implies important difference (** P < 0.01). These experiments were
28
Fig.7 Phenotypes of spl3 and osedr1 plants under dark- and MeJA- induced
senescence. (A, C) Dark- and MeJA- induced senescence in norin8, spl3,
Hwa-young and osedr1 in detached leaves of 2-month-old plants grown in
paddy field for 5 days. (50mM MeJA). (B, D) Chlorophyll level were
measured after ABA treatment for 5 days using leaf discs of norin8, spl3,
statistical analysis with a student’s t test implies important difference (*P < 0.05). These experiments were repeated three times with similar results. DT,
30
The transcript levels of several ABA-insensitive genes
were significantly altered in spl3 mutant.
As spl3 showed ABA-insensitive phenotype in root development and leaf
senescence, we hypothesized that ABA signaling was compromised in spl3
mutant. Several components regulating ABA signaling in plant development
and stress response have been identified in rice [50, 51]. In this regard, we
examined the transcript levels of ABA-insensitive genes in the wild type and
spl3 mutant. Under ABA treated conditions, the expression levels of all the
tested ABA-insensitive genes were dramatically up-regulated within 24
hours after treatment (Fig. 5), which is consistent with the previous reports.
Next, we compared the transcript levels of the genes between the wild type
and spl3 mutant before and after exogenous ABA treatment (Fig. 6). The
transcript levels of all the tested genes except ABI4 showed no significant
difference between the wild type and spl3 in the mock treated conditions,
while under ABA-treated conditions transcription level of ABI1, ABI4 and
ABL1 were significantly lower in the mutants than in the wild type (Fig.6). In
contrast, ABI3 transcript was highly accumulation in the spl3 mutant
compared to the wild type. These results indicated that the transcriptional
regulations of ABI1 and ABL1 are less sensitive to exogenous ABA
treatment in spl3 mutant, whereas ABI3 was hyper sensitive in the mutant.
Interestingly, the transcript level of ABI4 was constantly lower in spl3 mutant
level of ABI2 and ABI5 were similarly up-regulated in the wild-type and spl3
mutant under ABA treatment. Taken together, our results suggested that
spl3 mutation led the plant response to be less sensitive to ABA by altering
32
Fig.8 Time course expression patterns of ABI insensitive genes in WT.
(A-D), ABA insensitive genes were up-regulated in WT under ABA treatment.
Plants grown in the ½ MS media for ten days were transferred to 10mM
34
expression analysis. Relative abundance of mRNA of ABA insensitive genes
in the shoot base(SB) of WT and spl3 seedlings. The expression of each
genes was normalized to Ubiquitin in each sample. Mean and SD values
were gained from three independent samples. A statistical analysis with a
DISCUSSION
ABA signaling is involved in various plant development
and ABA-insensitive genes are key components in ABA
signaling pathway.
Here, we report the isolation and characterization of a spotted leaf 3(spl3)
in rice. A database investigation and sequence analysis shows that SPL3
contains a conserved protein kinase domain and appears a B3 subgroup of
a Raf-like MAPKKK [49]. The well-characterized ABA receptors are a family
of soluble proteins such as PYR (pyrabactin resistant), PYL (PTR-like) or
RCAR (regulatory component of ABA receptor), which comprise the origins
of the “core ABA signaling pathway” [52, 53]. Arabidopsis CHLH protein has been displayed to bind ABA in covering plasmon resonance examines and
genetic studies have provided functional verification for a role in ABA
signaling (Du et al., 2012). In particular, CHLH binds WRKY transcription
factors such as WRKY40 (AT1G80840), WRKY18 (AT4G31800), and
WRKY60 (AT2G25000) in the presence ABA, thus block them from
ABA-36
by influencing the level of ABI transcription factors. The ABI genes regulated
by “core signaling pathway” act in many tissues and developmental stages. In Arabidopsis, the participation of ABA in lateral root (LR) formation has
been researched using ABA signaling mutants. These studies demonstrated
that ABA regulates LR emergence, negatively [56]. Exogenous ABA
treatment suppresses the appearance of LR primordia from the primary
root before activation of the LR meristem [57]. The particular ABA-induced
expression of ABI5, a basic leucine zipper transcription factor, in LR tips
might indicate a role for ABI5 in LR meristem initiations and/or
maintenances [58]. Furthermore, some examples imply interplay between
ABA and auxin during LR initiation. Arabidopsis ABI3 [59] and Zea mays
ortholog VP1 encode transcription factor that has been display to affect root
structure and to mediate ABA/auxin crosstalk. ABI8, a unique plant protein,
is involved in signaling that also influences LR formation. In abi8 mutants,
LR initiation is inhibited and the LR meristem miss division competence [60].
Mutating ABI4, which encodes an AP2 domain transcription factor regulated
by ABA, results in an expanded number of LRs and its overexpressing
plants have a decreased number of LRs [61]. Until now, only few genes that
regulate plant development have been functionally characterize in rice.
ABI5-Like1 (ABL1), a rice bZIP transcription factor, participated in rice ABA
signaling and stress responses through directly binding to WRKY family
SPL3 has crucial role in MAPK cascades signaling
with ABA pathway
ABA mediates various processes such as salt, cold and drought stresses in
rice [62, 63, 64, 65]. Diverse recent researches have showed that MAPK
cascade genes are controlled by ABA responses [66, 67, 68, 69]. OsMPK5
and OsMPK12 are up-regulated by ABA at the mRNA and protein level [68.
70]. OsMEK2 and OsMEK1 are also induced by ABA and chilling stresses
[71, 72]. These results suggest that the mentioned MAP kinase components
might function in ABA signal transduction. Previous studies have described
up-regulation of OsMPK1 and OsMEK2 by ABA, and a current study
demonstrated the OsMPK1 interacts with OsMEK2 [71,
73]. Therefore OsMPK1 and OsMEK2 are taken part in ABA signaling as
a MAPK-cascade components. Because OsMPK1 is induced by ABA
and low-temperature stress and OsMEK1 is induced by cold stress, it is
viable that OsMEK1-OsMPK1 is involved in the ABA and cold mediated
signaling pathway [72, 74].
Comparable to Arabidopsis, the rice genome is expected to encode 75
MAP3Ks, 8 MAP2Ks, and 17 MAPKs [75, 76, 77]. Recent research showed
interactome analysis containing MAP2Ks, MAPKs [73]. From these results
38
genes under ABA treatment, SPL3 might be function with OsMEK2 and
SPL3 controls ABA signaling via phosphorylation of
MAPK cascades regulating plant developments such as
root development and leaf senescence
Previous studies showed that diverse genes function in spotted leaf
phenotype. SPL11 protein includes a U-box domain and an armadillo (ARM)
repeat domain, which were respectively functioned in yeast and mammalian
to be taken part in ubiquitination and protein-protein interaction [19]. SPL28
occurs to be involved in the control of vesicular trafficking, and impaired
SPL28 causes the initiation of hypersensitive response (HR)-like lesion,
causing the leaf senescence [20]. Furthermore, the formation of spotted leaf
is related to highly accumulation of ROS. When ROS production surpasses
the scavenging capacity, ROS act as cytotoxins to generate necrotic lesions,
leading to accelerated cell death [78, 79]. Plants overcome oxidative stress
with the generation of scavenging enzymes such as catalases decomposing
H2O2. In Arabidopsis, CAT1 is controlled by ABA, and MKK1-MPK6
regulate H2O2 metabolism via CAT1 [80]. Moreover, MEKK1, the
Arabidopsis MAPK kinase kinase, knockout plant accumulates high level of
ROS and develops local lesion similar with programmed cell death (PCD)
40
overexpression plants displayed spontaneous hypersensitive response
(HR)-like spot on leaves, accumulation of defense-related genes and
upregulation of phenolic compounds and phytoalexins. As a result, these
transgenic plants gained enhanced resistance to a Magnaporthe grisea [43].
OsEDR1-suppressing / knockout plants have enhanced resistance to
bacterial blight disease caused by Xanthomonas oryzae pv. oryza (Xoo).
This resistance was connected to accumulation of salicylic acid (SA) and
jasmonic acid (JA), expression of SA- and JA- related genes and inhibited
accumulation of ACC, the direct precursor of ethylene, and expression of
ethylene related genes [47].
In this study showed that two kinds of ROS such as H2O2 and singlet
oxygen were highly accumulated in spl3 mutant under continuous light
condition displaying reddish brown spot on the leaves surface (Fig.2).
Furthermore, under ABA-containing media spl3 mutant showed less defect
of root development compared to wild type(Fig. 5), suggesting that SPL3
regulates ABA-mediated signaling via phosphorylation of MAPK cascades
REFERENCES
1. Hoisington DA, Neuffer MG, Walbot V (1982) Disease Lesion Mimics in Maize .1. Effect of Genetic Background, Temperature, Developmental Age, and Wounding on Necrotic Spot Formation with Les1. Developmental Biology 93: 381-388.
2. Walbot V (1991) Maize Mutants for the 21st-Century. Plant Cell 3: 851-856. 3. Wolter M, Hollricher K, Salamini F, Schulze-Lefert P (1993) The Mlo Resistance
Alleles to Powdery Mildew Infection in Barley Trigger a Developmentally Controlled Defense Mimic Phenotype. Molecular & General Genetics 239: 122-128.
4. Johal GS, Hulbert SH, Briggs SP (1995) Disease Lesion Mimics of Maize - a Model for Cell-Death in Plants. Bioessays 17: 685-692.
5. Takahashi A, Kawasaki T, Henmi K, Shii K, Kodama O, et al. (1999) Lesion mimic mutants of rice with alterations in early signaling events of defense. Plant Journal 17: 535-545.
6. Yin ZC, Chen J, Zeng LR, Goh ML, Leung H, et al. (2000) Characterizing rice lesion mimic mutants and identifying a mutant with broad-spectrum resistance to rice blast and bacterial blight. Molecular Plant-Microbe Interactions 13: 869-+.
7. Mizobuchi R, Hirabayashi H, Kaji R, Nishizawa Y, Yoshimura A, et al. (2002) Isolation and characterization of rice lesion-mimic mutants with enhanced resistance to rice blast and bacterial blight. Plant Science 163: 345-353.
8. Mori M, Tomita C, Sugimoto K, Hasegawa M, Hayashi N, et al. (2007) Isolation and molecular characterization of a Spotted leaf 18 mutant by modified activation-tagging in rice. Plant Molecular Biology 63: 847-860.
42
barley mlo gene: A novel control element of plant pathogen resistance. Cell 88: 695-705.
11. Jambunathan N, Siani JM, McNellis TW (2001) A humidity-sensitive Arabidopsis copine mutant exhibits precocious cell death and increased disease resistance. Plant Cell 13: 2225-2240.
12. Lorrain S, Lina BQ, Auriac MC, Kroj T, Saindrenan P, et al. (2004) Vascular associated death1, a novel gram domain-containing protein, is a regulator of cell death and defense responses in vascular tissues. Plant Cell 16: 2217-2232.
13. Noutoshi Y, Kuromori T, Wada T, Hirayama T, Kamiya A, et al. (2006) Loss of Necrotic Spotted Lesions 1 associates with cell death and defense responses in Arabidopsis thaliana. Plant Molecular Biology 62: 29-42. 14. Balague C, Lin BQ, Alcon C, Flottes G, Malmstrom S, et al. (2003) HLM1, an
essential signaling component in the hypersensitive response, is a member of the cyclic nucleotide-gated channel ion channel family. Plant Cell 15: 365-379.
15. Rostoks N, Schmierer D, Mudie S, Drader T, Brueggeman R, et al. (2006) Barley necrotic locus nec1 encodes the cyclic nucleotide-gated ion channel 4 homologous to the Arabidopsis HLM1. Molecular Genetics and Genomics 275: 159-168.
16. Mosher S, Moeder W, Nishimura N, Jikumaru Y, Joo SH, et al. (2010) The Lesion-Mimic Mutant cpr22 Shows Alterations in Abscisic Acid Signaling and Abscisic Acid Insensitivity in a Salicylic Acid-Dependent Manner. Plant Physiology 152: 1901-1913.
17. Dietrich RA, Richberg MH, Schmidt R, Dean C, Dangl JL (1997) A novel zinc finger protein is encoded by the arabidopsis LSD1 gene and functions as a negative regulator of plant cell death. Cell 88: 685-694.
18. Wang LJ, Pei ZY, Tian YC, He CZ (2005) OsLSD1, a rice zinc finger protein, regulates programmed cell death and callus differentiation. Molecular Plant-Microbe Interactions 18: 375-384.
19. Zeng LR, Qu S, Bordeos A, Yang C, Baraoidan M, et al. (2004) Spotted leaf11, a negative regulator of plant cell death and defense, encodes a
U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 16: 2795-2808.
20. Qiao Y, Jiang W, Lee J, Park B, Choi MS, et al. (2010) SPL28 encodes a clathrin-associated adaptor protein complex 1, medium subunit micro 1 (AP1M1) and is responsible for spotted leaf and early senescence in rice (Oryza sativa). New Phytol 185: 258-274.
21. Chen XF, Hao L, Pan JW, Zheng XX, Jiang GH, et al. (2012) SPL5, a cell death and defense-related gene, encodes a putative splicing factor 3b subunit 3 (SF3b3) in rice. Molecular Breeding 30: 939-949.
22. Schaeffer HJ, Weber MJ (1999) Mitogen-activated protein kinases: Specific messages from ubiquitous messengers. Molecular and Cellular Biology 19: 2435-2444.
23. Widmann C, Gibson S, Jarpe MB, Johnson GL (1999) Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev 79: 143-180.
24. Ligterink W, Hirt H (2001) Mitogen-activated protein [MAP] kinase pathways in plants: versatile signaling tools. Int Rev Cytol 201: 209-275.
25. Sturgill TW, Ray LB (1986) Muscle proteins related to microtubule associated protein-2 are substrates for an insulin-stimulatable kinase. Biochem Biophys Res Commun 134: 565-571.
26. Knopf JL, Lin LL, Lin AY, Wartmann M, Seth A, et al. (1993) Cpla2 Is Phosphorylated and Activated by Map Kinase. Journal of Cellular Biochemistry: 270-270.
27. Jonak C, Okresz L, Bogre L, Hirt H (2002) Complexity, cross talk and integration of plant MAP kinase signalling. Current Opinion in Plant Biology 5: 415-424.
28. Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, et al. (2003) BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription
44
30. Nakagami H, Pitzschke A, Hirt H (2005) Emerging MAP kinase pathways in plant stress signalling. Trends in Plant Science 10: 339-346.
31. Bruce A.T. Adie JnPr-Pr, Manuel M. Pe´ rez-Pe´ rez,Marta Godoy, Jose´ -J. Sa´ nchez-Serrano,Eric A. Schmelz, and Roberto Solano (2007) ABA Is an Essential Signal for Plant Resistance to Pathogens Affecting JA Biosynthesis and the Activation of Defenses in Arabidopsis. The Plant Cell 19: 1665–1681.
32. Ton J, Flors V, Mauch-Mani B (2009) The multifaceted role of ABA in disease resistance. Trends Plant Sci 14: 310-317.
33. Wasilewska A, Vlad F, Sirichandra C, Redko Y, Jammes F, et al. (2008) An update on abscisic acid signaling in plants and more. Mol Plant 1: 198-217.
34. Hoth S, Morgante M, Sanchez JP, Hanafey MK, Tingey SV, et al. (2002) Genome-wide gene expression profiling in Arabidopsis thaliana reveals new targets of abscisic acid and largely impaired gene regulation in the abi1-1 mutant. J Cell Sci 115: 4891-4900.
35. Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, et al. (2002) Monitoring the expression pattern of around 7,000 Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct Integr Genomics 2: 282-291.
36. Koornneef M, Reuling G, Karssen CM (1984) The Isolation and Characterization of Abscisic-Acid Insensitive Mutants of Arabidopsis-Thaliana. Physiologia Plantarum 61: 377-383.
37. Leung J, Bouvierdurand M, Morris PC, Guerrier D, Chefdor F, et al. (1994) Arabidopsis Aba Response Gene Abi1 - Features of a Calcium-Modulated Protein Phosphatase. Science 264: 1448-1452.
38. Meyer K, Leube MP, Grill E (1994) A Protein Phosphatase 2c Involved in Aba Signal-Transduction in Arabidopsis-Thaliana. Science 264: 1452-1455. 39. Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene
ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12: 599-609.
ABA-insensitivity in Arabidopsis thaliana. Plant and Cell Physiology 41: 541-547.
41. Nakamura S, Lynch TJ, Finkelstein RR (2001) Physical interactions between ABA response loci of Arabidopsis. Plant Journal 26: 627-635.
42. Han SH, Sakuraba Y, Koh HJ, Paek NC (2012) Leaf variegation in the rice zebra2 mutant is caused by photoperiodic accumulation of tetra-cis-lycopene and singlet oxygen. Mol Cells 33: 87-97.
43. Kim JA, Agrawal GK, Rakwal R, Han KS, Kim KN, et al. (2003) Molecular cloning and mRNA expression analysis of a novel rice (Oryzasativa L.) MAPK kinase kinase, OsEDR1, an ortholog of Arabidopsis AtEDR1, reveal its role in defense/stress signalling pathways and development. Biochem Biophys Res Commun 300: 868-876.
44. Kusume A, Sasahira T, Luo Y, Isobe M, Nakagawa N, et al. (2009) Suppression of Dendritic Cells by HMGB1 Is Associated with Lymph Node Metastasis of Human Colon Cancer. Pathobiology 76: 155-162.
45. Huang QN, Shi YF, Yang Y, Feng BH, Wei YL, et al. (2011) Characterization and Genetic Analysis of a Light-and Temperature-sensitive Spotted-leaf Mutant in Rice. Journal of Integrative Plant Biology 53: 671-681.
46. Yoshimura A, Ideta O, Iwata N (1997) Linkage map of phenotype and RFLP markers in rice. Plant Mol Biol 35: 49-60.
47. Shen X, Liu H, Yuan B, Li X, Xu C, et al. (2011) OsEDR1 negatively regulates rice bacterial resistance via activation of ethylene biosynthesis. Plant Cell Environ 34: 179-191.
48. Kim JA, Cho K, Singh R, Jung YH, Jeong SH, et al. (2009) Rice OsACDR1 (Oryza sativa accelerated cell death and resistance 1) is a potential positive regulator of fungal disease resistance. Mol Cells 28: 431-439. 49. Ning J, Li X, Hicks LM, Xiong L (2010) A Raf-like MAPKKK gene DSM1
mediates drought resistance through reactive oxygen species scavenging in rice. Plant Physiol 152: 876-890.
46
51. Yang X, Yang YN, Xue LJ, Zou MJ, Liu JY, et al. (2011) Rice ABI5-Like1 regulates abscisic acid and auxin responses by affecting the expression of ABRE-containing genes. Plant Physiol 156: 1397-1409.
52. Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61: 651-679. 53. Miyakawa T, Fujita Y, Yamaguchi-Shinozaki K, Tanokura M (2013) Structure
and function of abscisic acid receptors. Trends Plant Sci 18: 259-266. 54. Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, et al. (2010) The Mg-chelatase H
subunit of Arabidopsis antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition. Plant Cell 22: 1909-1935.
55. Liu Y (2012) Roles of mitogen-activated protein kinase cascades in ABA signaling. Plant Cell Rep 31: 1-12.
56. De Smet I, Zhang H, Inze D, Beeckman T (2006) A novel role for abscisic acid emerges from underground. Trends Plant Sci 11: 434-439.
57. Fukaki H, Tasaka M (2009) Hormone interactions during lateral root formation. Plant Mol Biol 69: 437-449.
58. Brocard IM, Lynch TJ, Finkelstein RR (2002) Regulation and role of the Arabidopsis abscisic acid-insensitive 5 gene in abscisic acid, sugar, and stress response. Plant Physiol 129: 1533-1543.
59. Brady SM, Sarkar SF, Bonetta D, McCourt P (2003) The ABSCISIC ACID INSENSITIVE 3 (ABI3) gene is modulated by farnesylation and is involved in auxin signaling and lateral root development in Arabidopsis. Plant J 34: 67-75.
60. Brocard-Gifford I, Lynch TJ, Garcia ME, Malhotra B, Finkelstein RR (2004) The Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 encodes a novel protein mediating abscisic acid and sugar responses essential for growth. Plant Cell 16: 406-421.
61. Shkolnik-Inbar D, Bar-Zvi D (2010) ABI4 Mediates Abscisic Acid and Cytokinin Inhibition of Lateral Root Formation by Reducing Polar Auxin Transport in Arabidopsis. Plant Cell 22: 3560-3573.
of the HD-Zip I gene Oshox22 in ABA-mediated drought and salt tolerances in rice. Plant Mol Biol 80: 571-585.
63. Du H, Wu N, Fu J, Wang S, Li X, et al. (2012) A GH3 family member, OsGH3-2, modulates auxin and abscisic acid levels and differentially affects drought and cold tolerance in rice. J Exp Bot 63: 6467-6480.
64. Takasaki H, Maruyama K, Kidokoro S, Ito Y, Fujita Y, et al. (2010) The abiotic responsive NAC-type transcription factor OsNAC5 regulates stress-inducible genes and stress tolerance in rice. Mol Genet Genomics 284: 173-183.
65. Ben-Ari G (2012) The ABA signal transduction mechanism in commercial crops: learning from Arabidopsis. Plant Cell Rep 31: 1357-1369.
66. Agrawal GK, Rakwal R, Iwahashi H (2002) Isolation of novel rice (Oryza sativa L.) multiple stress responsive MAP kinase gene, OsMSRMK2, whose mRNA accumulates rapidly in response to environmental cues. Biochem Biophys Res Commun 294: 1009-1016.
67. Agrawal GK, Agrawal SK, Shibato J, Iwahashi H, Rakwal R (2003) Novel rice MAP kinases OsMSRMK3 and OsWJUMK1 involved in encountering diverse environmental stresses and developmental regulation. Biochem Biophys Res Commun 300: 775-783.
68. Xiong L, Yang Y (2003) Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. Plant Cell 15: 745-759.
69. De Vleesschauwer D, Yang Y, Cruz CV, Hofte M (2010) Abscisic acid-induced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice involves MAP kinase-mediated repression of ethylene signaling. Plant Physiol 152: 2036-2052.
70. Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, et al. (2003) BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription
48 Mol Cells 23: 108-114.
72. Xie G, Kato H, Imai R (2012) Biochemical identification of the OsMKK6-OsMPK3 signalling pathway for chilling stress tolerance in rice. Biochem J 443: 95-102.
73. Singh R, Lee MO, Lee JE, Choi J, Park JH, et al. (2012) Rice mitogen-activated protein kinase interactome analysis using the yeast two-hybrid system. Plant Physiol 160: 477-487.
74. Wen JQ, Oono K, Imai R (2002) Two novel mitogen-activated protein signaling components, OsMEK1 and OsMAP1, are involved in a moderate low-temperature signaling pathway in rice. Plant Physiol 129: 1880-1891. 75. Agrawal GK, Iwahashi H, Rakwal R (2003) Rice MAPKs. Biochem Biophys Res
Commun 302: 171-180.
76. Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, et al. (2006) Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci 11: 192-198.
77. Rao KP, Richa T, Kumar K, Raghuram B, Sinha AK (2010) In silico analysis reveals 75 members of mitogen-activated protein kinase kinase kinase gene family in rice. DNA Res 17: 139-153.
78. Ahmad P, Sarwat M, Sharma S (2008) Reactive oxygen species, antioxidants and signaling in plants. Journal of Plant Biology 51: 167-173.
79. Apel K, Hirt H (2004) Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology 55: 373-399. 80. Xing Y, Jia W, Zhang J (2008) AtMKK1 mediates ABA-induced CAT1
expression and H2O2 production via AtMPK6-coupled signaling in Arabidopsis. Plant J 54: 440-451.
81. Liu Y, Ren D, Pike S, Pallardy S, Gassmann W, et al. (2007) Chloroplast-generated reactive oxygen species are involved in hypersensitive response-like cell death mediated by a mitogen-activated protein kinase cascade. Plant J 51: 941-954.
초록
이 연구는 잎에 적갈색의 반점이 생기는 spotted leaf 3 돌연변이체를 이용하여 spl3 유전자를 지도기초분리 (Map-based cloning) 하고, 다양한 비생물학적 스트레스 처리 결과 나타나는 spl3 유전자의 분자 생물학적 기능을 나타낸 논문이다. 이러한 표현형은 식물체의 분얼기 이후 오래된 잎에서부터 적갈색 반점이 시작된다. spl3 돌연변이체는 지속적 광조건 (continuous light)을 처리했을 때 잎의 반점이 일반 조건에서 자란 식물보다 빠르게 생성되는 것을 확인하였다. 이러한 반점이 생성될 때 활성산소(ROS)의 생성량을 측정해보고자 DAB staining 과 SOSG 를 실시하였는데 그 결과 정상벼(wildtype)보다 spl3돌연변이체에서 활성산소가 더 많이 축적된 것을 알 수 있었다. spl3 의
단순열성표현형을 조절하는 유전자를 찾기 위해 지도기초분리 (map-based cloning)를 실시하였고, 최종적으로 좁혀진 161.2kb 의 후보 지역에서 12 개의 후보 유전자가 존재하였고, 확인 결과 MAPK kinase kinase(MAPKKK)를 코딩하는 Os03g06410 유전자의 첫 번째 exon 의 1 개의 염기가 결실된 deletion mutation 이 되었음을 발견하였다. spl3 유전자가 다양한 비생물학적 스트레스의 신호 전달에 관여하는 MAPKKK 의 역할을 하기 때문에 정상벼에서 비생물학적 스트레스를 처리 한 이후 시간별로 SPL3 유전자의 발현을 확인하였다. 또한 SPL3 유전자의 부위별 발현량을 확인하였는데 잎에서 발현량이 가장 많음을 알
50
정상형보다 ABA 호르몬에 저항성을 가지는 표현형을 보였다. 잎에서도 chlorophyll level 이 spl3 돌연변이와 T-DNA Knockout 식물체에서 정상형보다 높은 수준으로 유지되는 것을 확인하였다. ABA insensitive 표현형을 가지는 유전자들의 발현량을 측정하였는데 ABI1 과 ABL1 의 유전자가 ABA 처리전에는 비슷한 발형량을 보였지만 ABA 처리 후 정상형 식물체에서는 발현량이 증가하고 spl3 돌연변이체에서는 상대적으로 적은 발현량을 보였다. 이것은 SPL3 단백질이 MAPKKK 이기 때문에 하위에 존재하는 MAPKK 나 MAPK 를 통한 신호 전달을 통하거나, 본 연구에서 밝혀지지 않은 다른 신호 전달 체계를 거쳐 ABI1
혹은 ABL1 유전자의 발현량을 조절 한다는 결과로 판단된다. 따라서 이 논문은
spotted leaf 3 와 같이 잎에 적갈색의 반점이 보이는 돌연변이체 연구에 중요하게 쓰일 것으로 기대되며 나아가 MAPKKK 의 비생물학적 스트레스, 특히 ABA 와 관련된 새로운 생리학적 기능을 제시한다.
