• 검색 결과가 없습니다.

Production and Characterization of Human Immunodeficiency Virus Integrase Fused with a Maltose-Binding Protein

N/A
N/A
Protected

Academic year: 2021

Share "Production and Characterization of Human Immunodeficiency Virus Integrase Fused with a Maltose-Binding Protein"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

맥아당결합 단백질에 융합된 면역결필 바이러스 인테그라제의 생산 및 분석

김도진오유택신차균*

중앙대학교 산업대학 (Received October 25. 1997)

P r o d u c t i o n a n d C h a r a c t e r i z a t i o n o f H u m a n I m m u n o d e f i c i e n c y V i r u s I n t e g r a s e F u s e d

w i t h a M a l t o s e - B i n d i n g P r o t e i n

D o J i n K im , Y o u - T a k e O h a n d C h a - G y u n S h in * College o f In d u stria l Studies, Chung-Ang University, A n su n g 456-756, Korea

Abstract~Retroviral integrase is required for integration of viral DNA into the host cell chromosome.

Human immunodeficiency virus type-1 integrase was partially purified as a part of a fusion protein linked to a maltose-binding protein and characterized in terms of an endonucleolytic activity. The concentration of the fusion protein purified through an amylose column was about 12 mg/m/, in ­ dicating that the solubility of the fusion protein is highly increased by the presence of a maltose- binding protein, considering that the integrase protein alone is poorly solubilized. The en­

donucleolytic activity of the fusion protein was detected at 0.1 to 1.0 mM MiV ion. but not at any concentrations tested of Mg"나 ion.

Keywords □ Fusion protein, integrase. maltose-binding protein, endonucleolytic activity.

인간면역결핍바이러스는인간외T-임파구에 침투 원형질에서 바이러스의R N A 유전자를D N A

전자로견환하고. D N A 유전자가핵으로둘어가서T-

임파구의유전자를끊고그사이에중합하게된다. 이러

바이러스D N A 유전자의중합은바•이러스의복제와

생성을위하여필요불가결한과정이며, 이과정을중개

하는것이바이러스외특유외효소인integrase이다.*^

바이러스D N A중합과정에서integrase직선형

바이러스D N A유전자의양쪽3' 말단부분에서각기

개의nucleotide제거하고, 개의nucleotide 짧아진끝을이미사다리태로절단해놓은숙주세포의 유전자에 연결시킨다. 연결되지않은 5^ 말단은숙주세 포의 유전자복구효소들에의하여개의nucleotide

• 본 논문에 관한 문의는 이 저자에게로

( 전화) 0334-70-3067 (팩스) 0334-675-0409

절단된숙주세포의유전자에연결됨으로써, 바이

러스D N A t 전자가완전히숙주세포의유전자에중합

하게된다."* 바이러스D N A숙주세포의유전자에 합될 , 바이러스D N A둘어가는숙주세포D N A 부위는벌다른특이성이없다. 그러나, 면역결핍바이 러스의integrase바이러스D N A 끝외핵산을 제거하는활성은면역결핍바이러스외 D N A에서만 타난다 면역결핍 바이러스의 integrase유전자 바이러스유전자pc)l끝부분에 존재하며, 감염된 세포에서 바이러스외 다른 효 소둘과 함께 po-

lyprotein일부분으로생성된다. 바이러스조립과정

에서바이러스외 단백분해효소에 외하여polyprotein

에서절단되어바이러스입자안에포함된다.®'" 박테러 아에서발현시켜 정제한면역결핍 바이러스의 활성은

바이러스D N A 끝외 염기서열을 닮은이중가닥oli-

gonucleotide한쪽가닥외5' 말단을방사능으로

46

(2)

융합단백질의 일부로써의 인테그라제 톡성 47

식하고 integrase처러할. 개의핵산이 3' 말단 에서 제거되는 것을 이용한 endonucleolytic clea- vage 활성으로측정한다 ®

면역결핍바이러스의 integrase 단백질은구조 능상에서 N-말단영역 , 중앙영역 , C-말단영역으로구분 된다〶9■10) N-말단영역에는 각기 개의 histidine cysteine Zn-finger 부분이존재하나, Zn단백질 효소적활성이나구조외변화에별다른영향을주지 않는다. 그러나, 이영역은 integrase dimerization 관 하 고 있으며, 이부분이제거되면, 효소적활성을 상실한다® 중앙영역은효소적활성이직접적으로발현 되는부분으로, 이부분외염기서열은유사한다른바이 러스둘의 integrase에서도 거의 일처되고 있다. C-말단영역은 DNA결합하는부분으로소수성을 니고었다. 박테리아에서발현하여생성한 integrase 용해성이 매우낮으며, 용액중에서불안정하여쉽게 전으로떨어져서활성을상실하여 연구에많은어려움 주고있다. 본연구에서는용해성이좋은맥아당결합 단백질에 integrase 붙인 융합단백질로써 in- tegrase생성하고, 융합단백질이보이는 integra- se endonucleolytic 활성을분석하였다.

실험방법

시약사용기기- 제한효소 (BamHI, Hindlll), T4 DNA ligase. T4 polynucleotide kinase (T4 PNK), pMalc2, amylose resin등은 New England Biolabs사에서구입하였다. DNA Sequencing kit United States Biochemicals사에서구입하고, Isop- ropylthiogalactopyranoside (IPTG), agarose, am- pidllin등은 Sigma사에서 구입하였다. [ /4-ATP (3,000 Ci/mmol lCi = 37GBq)는 머국Amershain 사에서구입하였고. Sephadex G25 column Phar- macia사에서구입하였다. 사용된기기로는세포의 괴를위하여 미국 Misonix사의초옴파파쇄기 (Soni- cator XL2020) 사용하였으며, 박테리아의 배양은 한국 비전과학사의 진탕배양기를 이용하였다. Oli- gonucleotide한국바이오니아에서합성하였고, 사용 하기전에 RAGE 제하였다.

발현벡터의체작밟현- 발현벡터를제작하기위 하여 면역결핍바이러스 integrase유전자를 함유하는 pQEIN 제한효소 BamHI Hindlll 처리하고

agarose 전기영동한, 0.9 b DNA 절편을 glass milk 사용하여 분리하였다. 벡터 pMalc2 BamHI Hindlll리하여 6.7 Kb DNA 절편을 분리하고, integrase유전자와섞고 T4 DNA ligase 함께 16°C에서 4 시간처러하고반응물을박테러아(£.

coli. XLl-blue)에넣어 42°C에서 3 분간처리하여 질전환시켰다. Ampicillin 존재하에 성장하는 균주들 폴라스머드를 추출하여 제한효소로 처러하여 in- tegrase유전;^]•틀함유하는균주률선정하고, 재조합된 발현벡터에 integrase유전자가 벡터에 in-frame으로 재조함되었음을 DNA 염기서열분석으로 최종 확인하 였다. 융합단백질외 발현은발현벡터를함유하는균주 100 ug/m/ ampicillin함유하는 LB배지에서 광도가 595 nm에서 0.6때까지배양한, 최종농도 0,3 mM되도록 IPTG넣고 3 시간배양하여 유도하였다. 단백질의발현유무는배양액 1 m/을원심 분리하여 얻은균주체률전기영동염색액에 넣고가열 , SDS-PAGE 전기영동으로확인하였다.

웅함단백질의 정제- Integrase 함유하는융합단 백질의대량정제를위하여발현벡터룰함유하는균주의

500m/ 배양액을위에서와같은조건에서 발현을유도

하고. 발현이확인된균주의 pellet 5 ml완충용액 A (10mM sodium phosphate, [pH 7.2], ImM p- mercaptoethanol (P-MeOH), Im M EDTA, 1M NaCl)에현탁한, 초옴파파쇄기을이용해서 세포률 파괴하였다. 파괴된세포시료틀 4°C에서 40,000 X g 20 분간원심분리을하여 4.5 m/ 정도의상등액을얻은 다옴. 같은부피의완층용액 B (10 mM sodium phos­

phate, (pH 7.2], 1 mM p-MeOH, 1 mM EDTA)로 섞어 희석하였다. 머러 준버한 0.3m/의 amylose resin함유하는컬럼에희석액을통과시키고, 5 m/의 완층용액 C (10 mM sodium phosphate, [pH 7.2], 1 mM P-MeOH, 0.5 M NaCl, 1 mM EDTA, 0.25 %

Tween 20)로서 컬럼을층분히 씻어주었다. 150u/의 완층용액 EKlOmM sodium phosphate, (pH 7.2], 1 mM p-MeOH, 0.5 M NaCl, 1 mM EDTA)을 step- wise형태로 10통과하여 융함단백질을 추출하였다.

수집된 분획에 존재하는 단백질의 분포는 SDS-

PAGE 전기영동으로확인하고, 융합단백질이다량으로

있는부분만을따로모아, Biospin30통과시켜서 충용액에존재하는 maltose고농도외 염룰제거하였 . 단백질의양을 Bradford assay 방법으로즉정하고,

(3)

정제된융합단백질을소분하여 -70T보관하였다. 합단백질의 integrase활성과의 비교를위하여 사용된 histidine 표식된 integrase본실험설에서 이미발표 방범에따라정제하였다.

이 중 가 닥 oligonucleotide 기 질 의 제 작 - 융합단백질 존재히는 integrase활성의측정에사용될기질로 , 방사능으로표식된이중가닥 oligonucleotide 기질 다옴과같이 제작하였다. 먼저 면역결핍바이러스의 U5-LTR 끝부분과같은염기서열을갖는 20 mer 크기 2 개의 oligonucleotide (K16 [U5-LTR, + strand], 5-TGTGGAAAATCTCTAGCAGT-3^ K17 [U5- LTR, -strand], 5-ACTGCTAGAGATTTTCCACA- 30 PAGE 정제하였다. 정제된 K16방사능으로 식하기위하여, 15pmol K16, 50uCi (y*-P]-ATP 1 unit T4 polynuclotide kinase 40 u/의반응용액 (70 mM Tris-HCl [pH 7.4], 10 mM MgCU,5 mM dithiothreitol)에서 15 분간 37°C에서 반응시키고, 종농도로 10 mM EDTA. 100 mM NaCl 되도록 EDTA NaCl첨가하고, 85°C에서 15분간가열하였 . 상보적인염기서열을갖는 K17 (30 pmol)을첨가한 . 3 분간끓인다옴천천히 식혀서, 상보적인 결합이 일어나게하였다. 방사능으로표식된기질둘과반응하지 않은방사능은 Sephadex G25 컬럼를통과시켜서분리 하였다.

웅 함 단 백 질 의 integrase활 성 의 측 정 - 융합단백질의 integrase활성은바이러스 LTR끝외염기서열을 20 bp이중가닥 oligonucleotide한쪽가닥의 3' 말단의 2 개의 nucleotide 제거되는 endonudeo- lytic 활성을측정하여조사하였다. 방사능으로표식된 0.1 pmol 이중가닥 oligonucleotide 기질과 30 pmol 합단백질 (MBP-IN)을 10 U부피의기본 반응완충액 (10 mM Tris-HCl [pH 7.4))에실험에서표시된 분을가감하여서 90분간 33/에서반응시켰다. 반응정지 용액 (95% formamide, 20 mM EDTA, 0.05% bro- mophenolblue, 0.05% xylene cyanol FF) 4 u/을 가하여반응을정지시켰다. 반응한생성물의확인은 응물을 20 % 번성 acrylamide gel에서전기영동하고. 젖은 gel X-ray 필림에노출하여측정하였다.*®

결 과 고 찰

발 현 벡 터 의 제 작 밝현 - 면역결핍바이러스의 in-

Fig. 1 — Genetic map of a ftision protein expression vec­

tor (pMal-IN) coding a maltoseHbinding protein and a HIV-1 integrase.

tegrase 유전자는바이러스 pol 유전자의 3' 말단지역 존재하며, 바이러스자가복제할때에 GarPol po- lyprotein C-말단에 일부분으로써 생산되어 바이러 조럽과정에서단백분해효소에의하여절단됨으로써 활성을 갖는다.®본연구에서 integrase 유전자는 이미 본실험실에서 integrase 발현벡터로써 발표한 pQEIN에서얻었다.*^* 맥아당결합단백질에융합된 in- tegrase 발현벡터는 pQEIN BamHI Hin- dlll처러하여 얻은 0.9Kb DNA 절편을 pMalc 2옮겨서제작하고재조합된발현벡터틀 pMal-IN 명명하고, 최중적으로 DNA 염기서열을분석하여

integrase 유전자가맥아당단백질외끝부분에 정확하

연결되었음을 확인하였다 (Fig. 1). 이벡터는 in- tegrase유전자가맥아당결합단백질의유전자 (MalE) 뒤부분에직접연결되어 있어분자량 74,000Da 융합단백질이 IPTG처리된균주에서생성되게한 . pMal-IN융합단백질을발현하는가를조사하 위하여 맥아당결합단백질외 유전자만을함유하는 발현벡터 (pMalc2)와융함단백질의 벡터 (pMal-IN) 균주들을각기 IPTG가한것과안한것의단백 생성을비교하였다 (Fig. 2). IPTG첨가하지 배양에서는 맥아당결합단백질이나, 용합단백질이 거의 생성되지않아단백질의 발현이 lac repressor 의하여억제되고있으나 (lanes 2 and 4), IPTG 첨가한배앙에서는맥아당결합단백질과융합단백질이

매우높은수준으로생성되고있옴을보여준다 (lanes

3 and 5).

/. Pharm. Soc. Korea

(4)

융합단백질의 일부로써의 인테그라제 톡성 49

1 2 3 4 5 9 10 11 12

97.4 66.2 55.0 40.0

31.0

21.5

-MBP-IN

-MBP

Fig. 2 Induction of a MBP-IN fusion protein in the bac­

terial cultures. Bacterial strains were grown at 37°C in LB media containing ampicillin until ab­

sorbances at 595 nm reach to 0.6. IPTG was added to the cultures to a final concentration of 0.3 mM. After a further 3 hr. bacterial cells were collected and analyzed. Lane 1, protein molecular size markers in kDa lanes 2 and 3.

strain containing pMalc2 lanes 4 and 5. strain containing pM aH N lanes 3 and 5. IPTG added.

용합단백질의정제- 융합단백질의정제는융합단백 질의일부인맥아당결합단백질이 amylose잔기에결합 하는성질을이용하였다.융합단백질의 생성이 인된배양외박테리아펠렛을 1 M NaCl함유하는 산완충용액에서 초음파파쇄기로파괴하여세포내의 백질돌이 세포밖으로나오도록하고 원심분리 상등 액을 amylose resin통과시켜서결합된단백질들을 맥아당용액으로 추출하였다 (Fig. 3). 융합단백질의 amylose 잔기에대한결합은매우효과적으로, 원심분 상등액에 있던 많은융합단백질돌은 amylose resin통과한여과액에서는상당부분결합하고, 소량 만이남아었다 (lanes 1 and 2). Amylose resin

분히세척 10mM 맥아당용액으로결합된단백질들

추출하였을, 두번째세번째분획에서가장 추출되었다 (lanes 4 and 5). 세번째분획외 경우

섞여었는 5 % 정도의박테리아의 단백질을포함하

농도가 12mg/m이다. 이러한용해도는기존에 integrase생산에 이용되는다른방법들에서의 in- tegrase용해성과 비교하여 4 높온 것이다. Integrase일반용액에서 용헤성이 매우낮다. 따라 . 여러번의컬럼을거처는전형적인생화학적인방법 의한정제는매우어렵다. 이러한이유에서현재 연구자들은사용하는방법흔두가지특정이있다.

Fig. 3 — Purification of a MBP-IN fusion protein using an amylose affinity chromatography. A bacterial pel­

let from a 500 m/ culture treated with IPTG was resuspended and sonicated. The clear su­

pernatant was collected and passed through an amylose column. Lane 1. supernatant lane 2, flow-through lane 3. washout lanes 4-12, elu- ate in 10 mM maltose.

, histindine 표식을이용한 affinity 정제방범으로, integrase 단백질의 또는뒷부분에 개외 his-

tidine잔기를붙여서니켈이붙은컬럼을이용하여

번의 컬럼 정제과정만으로도상당히 순수한단백질을 얻는다. 둘째, 박테리아를분쇄하는용액에 계면 활성제로 CHAPS첨가하였다. 이계면활성제는 his- tidne표식을 함유하는 integrase 용해성을 높여준 . CHAPS 이외의다른많은계면활성제들이 조사되 었으나, 단백질을번성시키지않고 CHAPS보다용해성 높이는것은보고되지않고있다/ ^ 그러나. 이런 법도 integrase용해성을 3 mg/m/ 이상높이기어렵 때문에단백질구조연구에많은어려움이있다. 또한 integrase활성억제제의탐색이나단백질외구조

구를위한대량생산에는 CHAPS매우고가이기

문에 histidine표식을이용하는방범의 사용이 제한되 고었어, 새로운방법의 개발이요구되고있다. 따라서, 용해성좋은맥아당단백질을이용하여 CHAPS 용하지않고 integrase고농도외 융합단백질의 형태 생산하는것도이러한문제점을극복하는하나의 텍이었다. 본실험에서는융합단백질의효소적 성을조사하기위하여세번째분획의단백질들을 2 mg/

m/희석하여융합단백질의 integrase활성을분석 하였다.

융합단백절의integrase 활성- 트로

(5)

TI 0

N

20mer

ISm er

Fig. 5 — Effect of various buffer components on en- donucleolytic activity of a MBP-IN fusion pro­

tein. The basic reactions were formulated in the presence of Im M Mn'*■' as described in Fig. 4. Additional components were added to the reaction as follows lane 1. oligonucleotide only lane 2. histidine-tagged IN lanes 3-13.

MBP-IN lane 4. Mr/'*' omitted lanes 5-7. 10, 20 and 50 mM -MeOH lanes 8-10, 10. 20 and 50 mM CaCl2- lanes 11-13, 1, 3 and 5 mM EDTA respectively.

/. Pharm. Soc. Korea

Fig. 4 — Endonucleolytic activity of a MBP-IN fusion protein in the presence of metal ions. (A) Schematic diagram of endonucleolytic reaction.

(B) Endonucleolytic activity of a MBP-IN. Pro­

teins (MBP-IN or hisitine-tagged IN) of 30 pmol were incubated at 33"C for 90 min with radiolabelled duplex oligonucleotide of 0.1 pmol in 10 mM TrisHCl (pH 7.4) containing the com­

ponents indicated below lane 1. oli­

gonucleotide only lane 2, histidine-tagged IN with 1 mM Mn : lane 3-11. MBP-IN lanes 4- 7. 0.1. 0.5. 1 and 10mM M n" " : lanes 8-11. 0.1.

0.5. 1 and 10 mM respectively.

바이러스 integrase활성은바이러스 DNA 서열을닮은이중가닥의 oligonucleotide이용하여 즉정 있다.^ ^' uffro에서 integrase이중가 oligonucleotide한쪽가닥의 3' 말단에 있는 개외잔기를선택적으로쌀라낸다. 본연구에서는쌀라 가닥의 oligonucleotide 5' 말단을 방사능으로 표식하고 3' 말단외잔기가쌀라져서짧아지는 oli­

gonucleotide 크기변화를관측함으로써 융합단백 질외 integrase 활성을측정하였다 (Fig. 4A). 러트 로바이러스 integrase조효소로알려진 망간과 그네슘의 농도를 변화시키면서 integrase endo­

nucleolytic 활성을 조사하였을 . 0.1 — 1.0 mM 에서는 상당한 활성을 나타내었으나. 경우 어떠한 농도에서도 활성을 보이지 못하고있다 (Fig 4B lanes 4-11). 이결과는융합단백질의 in-

A

TGTGGAAAATCTCTAGCAGT ACACCTTTTAGAGATCGTCA

IN

TGTGGAAAATCTCTAGCA-oh

ACACCTTTTAGAGATCGTCA + GT-oh

2 3 4 5 6 7 8 9 10 11

tegrase 활성은 망간을조효소로 필요로하여. his- tidine표식된 integrase 같은 성질을 보여주고있 다."하또한 10 mM ■"또는 Mg우■"에서는 oligonu- cleotide 잔기듈이 하나썩 쌀려짐으로써. inte- grase활성이억제된가운데섞여있는 nuclease 활성이 작용함을 보여준다(Fig. 4B lanes 7 and 11). 이러한비특이적인 절단은본연구에 이용된 in-

tegrase들이단계과정만으로정제되어박테라아에

유래된 nuclease integrase시료속에 포함되어 나타나는 것으로사료된다. 융합단백질의 integrase 활성의 적합한발현조건을조사하기 위하여활성 정반응에 P-mercaptoethanol, CaCla,또는 EDTA 등을 첨가해 보았을 . p-mercaptoethan이을 20

mM 수준까지 첨가한경우가좋은활성을보여준다

(Fig. 5 lanes 5-7). 최중농도로 1 mM EDTA 가는 부분적 활성을 보여주며, 그이상의 농도에서는 반응용액중의망간이온을완전히 제거하여 반응을 제한다.

트로바이러스 integrase끝에개외 nucleo- tide제거된 바이러스 DNA숙주세포의 DNA 자신의바이러스 DNA비특이적부위를끊고연결시

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3

#

• • •

• - •

(6)

융합단백질의 일부로써의 인테그라제 특성 51

키는 중합활성이 있다. In uiYro에서 이활성은 en­

donucleolytic 활성의하여개외 nucleotide 거되고, 방사능으로 표식된 oligonucleotide 다른 oligonucleotide중간부위에 비톡이적으로끊고. 결함으로써 방사능으로표식된 oligonucleotide 기가증가하는것으로측정할있다. 맥아당결합단백 질과의 융함단백질로존재하는 integrase histidi- ne으로표식된 integrase비하여 endonucleolytic 활성이뛰어나지는못하다. 그러나. 맥아당결합단백질 과의융합단백질을사용한반응들에서 DNA기질의 20 mer 위부분에중합된생성물이강하게나타나므로. integrase endonucleolytic 활성에 외하여 절단된 oligonucleotide다른 DNA둘어가는중함활성은 융함단백질이강한것으로사료된다(Fig. 5 lane 2 vs lanes 3. 5-7. and 11).

면역결핍바이러스의 integrase효소활성은단백질 중앙영역에서 나타난다. 그러나, N-말단영역이나, C-말단영역을부분적으로제거한돌연변이들도효소활 성을쉽게상실하여 전체적인단백질외 구조가중요하 1619) 이것은효소활성이이상외 integrase 결합된중함체에서만나타나기때문으로. 중합체외 성을위한단백질사이외결합은 N-말단영역을통하여 일어난다.^^ 따라서. 융합단백질이나 histidine표식 integrase경우중합체 형성을위한 N-말단구조 순수성이 펄요하다. 현재많이사용되는 histidine 으로표식된 integrase경우 N-말단에 12^20 도의아미노산이 추가되나. 효소활성의 발현에는거의 영향을주지않고있다."" "® ""* 분자량이 42,700 Da 아당결합단백질이 N-말단에결합된 integrase경우 정상적인중합체의형성이어려울것으로사료되나. 분적인 효소활성을보이는 것으로보아융합단백질외 구조에많은흥미를갖게한다. 또한, 이러한결과는 in- tegrase 감염된 바이러스에서 생성될 polyp-

rotein일부로생성되어바이러스조럽과정에단백분

해효소에외하여절단되어활성을갖는것으로알려지 고있으나. polyprotein형태에서나. 부분적으로절단 형태에서도활성을나타낼수도있옴을시사한다.

감 사 의 말 씀

본연구는 1996년도중앙대학교학술연구지원버에

하여이루어졌기에이에감사드럽니다.

1) Brown. P. O. Integration of retroviral D N A . Curr. Topics Microbiol Im m unol. 157, 19 (1990).

2) Bushm an, F. D.. Fugiwara, T. and Craigie, R. ■ R e tro v iral D N A in te g ratio n directed by i n ­ tegration protein in vitro. Science 249, 1555 (1990).

3) Craigie, R.. Fugiwara, T. and B ushm an , F. D. '■

The IN protein of M oloney m u rin e leukem ia virus processes the viral D N A ends a n d ac­

complishes their integration in vitro. Cell 62, 829 (1990).

4) Katz, R. A.. M erkel G. W .. Kulkosky, J., L^is, J.

and Skalka. A. M. The avian retroviral IN pro­

tein is both necessary a n d sufficient for in ­ tegrative recombination in vitro. Cell 63, 87 (1990).

5) V ink. C.. v an G ant. D. C., Elgersma, Y. and Plasterk. R. H . A. '■ H u m a n immunodeficiency virus integrase protein requires a subterm inal position of its viral D N A recognition sequence for efficient cleavage. I Virol 65. 4636 (1991).

6) B ushm an. F. D. and Craigie, R. Activities of h u m a n im m un ode ficien cy v iru s (H IV ) in te ­ gration protein in vitro Specific cleavage an d integration of H IV D N A . Proc. N a tl Acad. Sci.

U SA 88. 1339 (1991).

7) Sherm an. P. A. and Fyffe. J . A. ■ H u m a n im ­ m unodeficiency v irus integration protein ex­

pressed in Escherichia coli possesses selective D N A cleaving activity. Proc. N atl. Acad. Sci.

U SA 87. 5119 (1990).

8) LaFemina, R. L.. Callahan. P. L. and Cordingley.

M. G. ■ Substrate specificity of recombinant H u ­ m an immunodeficiency virus integrase protein. /.

Virol. 65. 5624 (1991).

9) Kulkosky, J.. Jones. K. S., Katz, R. A., Mack. J.

P. G. and Skalka. A. M. • Residues critical for re­

troviral integrative recom bination in a region th a t is highly conserved am ong retroviral/re- trotransposon integrases and bacterial sequence transposases. M o l Cell Biol. 12. 2331 (1992).

10) Vink, C., Groeneger, A. A. M . an d Plasterk. R.

H . A. ■ Identification of the catalytic and DNA- binding region of the h u m a n immunodeficiency virus type 1 integrase protein. Nucleic A cid Res.

(7)

21 1419 (1993).

11) V ink, C. and Plasterk, R. H. A. ■ Activities of fe­

line immunodeficiency virus integrase protein produced in Escherichia coli. }. Virol 68, 1468 (1994).

12) Jenkins. T. M., Hickman. A. B.. Dyda. F.. Ghir- lando, R .. Davies. D. R. and Craigie, R. C a­

talytic domain of h u m an iiimiunodeficiency virus type 1 integrase Identification of soluble m utant by systematic replacement of hydrophobic resi­

dues. Proc.. N a tl Acad. Sci. U SA 92. 6057 (1995).

13) O h . J.-W . and Shin. C.-G. '■ Purification and characterization of the H um an immunodeficiency virus type 1 integrase expressed in Escherichia coli M o l Cells. 6, 96 (1996).

14) K ellerm an , T. C. an d Ferenci, T. M altose b in d in g protein from E. coli. M ethods in E n - zymology 90. 459 (1982).

15) G uan, C.. Li. P.. Riggs. P. D. and Inouye. H. Vectors th a t facilitate the expression and p u ­ rification of foreign peptides in Escherichia coli by fusion to maltose-binding protein. Gene 67. 21

(1987).

16) B u sh m an . F. D .. E ngelm an. A .. Palmer. L.

Wingfield. P. and Craigie. R. Domains of the integrase protein of h u m an immunodeficiency v irus type 1 responsible for polynucleotidyl transfer and zinc binding. Proc. Natl. Acad. Sci.

U SA 90. 3428 (1993).

17) K atzm an. M. and S u d o l M. - In vitro activities of purified V isna virus integrase. J. Virol. 68.

3558 (1994).

18) Balakrishnan, M .. Zastrow, D. and Jonsson. C.

B. C atalytic activities of the h u m a n T-cell leukem ia virus type II integrase. Virology 219, 77 (1996).

19) Drelich. M .. W ilhelm , r. and Mous, J. Iden­

tification of am ino acid residues critical for en­

donuclease and integration activities of HIV-1 IN protein in vitro. Virology 188. 459 (1992).

20) Jones. K. S.. Coleman. J .. Merkel, G. W., Laue.

T. M . and Skalka, A. M . Retroviral integrase functions as a m ultim er and can tu rn over ca- talytically. /. Biol Chem. 267, 16037 (1992).

/. Pharm. Soc. Korea

수치

Fig.  1 — Genetic map of a ftision  protein expression  vec­
Fig. 3 — Purification of a MBP-IN  fusion  protein using an  amylose affinity chromatography
Fig.  5 — Effect  of  various  buffer  components  on  en- en-donucleolytic  activity  of a  MBP-IN  fusion  pro­

참조

관련 문서

As a result of the study, it was confirmed that only human resource competency had a positive(+) effect on the intercompany cooperation method of IT SMEs,

co-treatment with hispidulin and TGF-β up-regulated the protein of expression E-cadherin and occludin against TGF-β-induced in MCF-7 and HCC38 cells.. The

Blake insists that human beings recover their own divinity and that human beings seek a state of higher Innocence or a state of dynamic morality passing

Second, it was found that human rights education plays a controlling role in human rights sensitivity and human rights awareness (equal rights, right to

치아발생과 같은 기관의 발생과 석회화(mi neral i zati on)와 관련이 있는 BMPR-IB와 EF-handcal ci um bi ndi ng protei n은 APi n의 과발현을 유도한 경우에 는

Inhibitory effects of the concentration of methanol extracts from Plantago Asiatica against the COX-2 protein expression and iNOS expression of the MDA-MB-231 human

qRT-PCR for VSMC synthetic phenotype protein, cellular retinol binding protein 1(CRBP-1) and connexin 43, from thoratic aorta showed that CRBP-1 expression was increased by 70%

ƒ Define a type Department with a field name and a field head which is a reference to the type Person, with table people as scope:. create type Department ( create