• 검색 결과가 없습니다.

Root Bark of Morus Alba Suppresses the YAP Activity through Activation of Classical Hippo Signaling Pathway

N/A
N/A
Protected

Academic year: 2021

Share "Root Bark of Morus Alba Suppresses the YAP Activity through Activation of Classical Hippo Signaling Pathway"

Copied!
7
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)

서 론

세포 내 Hippo signaling 경로는 세포의 증식과 사멸을 조절 함으로써 조직과 장기의 크기를 조절한다1). 조직의 재생에서 핵심 적인 역할을 담당할 뿐 만 아니라 최근에는 암의 발달과정과 전이 에 대한 역할이 밝혀지면서 그 관심이 높아지고 있다. Hippo signaling의 최종 효과자인 YAP과 TAZ는 보조전사인자 단백질로 서 조직의 항상성과 암의 발달과정에 중요한 역할을 하는 것으로 보고되었다2,3). 종양에서 YAP과 TAZ는 암줄기세포의 재프로그래 밍, 종양의 진행 및 전이를 유도하는 것으로 알려져 있다4-7). 포유류에 존재하는 Hippo(Hpo) 전달경로 효소 중 Hpo에 해당 하는 것은 STE20-like 1/2 (Mst1/2) kinase이다. Mst는 세포 내 capase에 의하여 조각나거나 이량체 형성, 자가인산화 과정을 거 치면 활성화되며8,9), 활성화된 Mst는 large tumour suppressor

1/2 (LATS1 / 2)를 인산화시킨다. 인산화된 LATS1/2는 Hippo pathway의 효과기인 Y-associated protein (YAP) 및 WW Domain-containing Transcription Factor (TAZ)를 인산화시킴 으로써 불활성화시킨다5,10). YAP와 TAZ는 모두 Hippo 경로에 의 해 인산화 의존적 방식으로 저해된다11).

많은 단백질들이 Hippo 전달 경로의 상류에서 작용하는 것으로 보고되고 있으며12,13), 이러한 Hippo pathway effector의 비정상적 인 과발현과 핵심 kinases의 조절 장애는 다양한 인간 질병에서 빈 번하게 관찰 되어왔다. YAP/TAZ는 암과 재생의학 분야에서 매력적 인 표적이며, 이들의 활성을 조절하는 약물은 세포증식 질환이나 퇴 행성 질환에 응용될 수 있는 약물후보군이 될 수 있을 것이다.

뽕나무 뿌리 속껍질인 상근피 (the root bark of Morus alba; RMA)는 동의보감에서, “폐기(肺氣)로 숨이 차고, 가슴이 그 득한 것과 수기(水氣)로 부종이 생긴 것을 치료하며, 담(痰)을 삭이

상근피의 Hippo 신호전달 경로 활성화를 통한 YAP 억제 효능

조유나#·최다빈#·정한솔*

부산대학교 한의학전문대학원 응용의학부

Root Bark of Morus Alba Suppresses the YAP Activity through Activation of Classical Hippo Signaling Pathway

You Na Cho

#

, Da Bin Choi

#

, Han Sol Jeong*

School of Korean Medicine, Division of Applied Medicine, Pusan National University

This study aims to evaluate the effects of the root bark of Morus alba (RMA) on the regulation of the Hippo-YAP pathway. Hippo-YAP signaling is a critical regulator in controlling organ size and tissue homeostasis. Hippo, the serine/threonine kinase phosphorylate the LATS. Phosphorylated LATS then phosphorylates and inactivates the YAP and TAZ, which are two closely related transcriptional co-activator. Here we report RMA activates the Hippo signaling, thereby inhibits the YAP/TAZ activity. First, we examine the cytotoxic effects of RMA by MTT assay. RMA was cytotoxic at concentrations higher than 50 μg/ml in HEK293A cells. The reporter gene assay was performed to measure the activity of TEAD, a key transcription factor that controls cell growth and proliferation. RMA significantly suppressed the luciferase activity. By phos-taq gel shift assay, and western blotting, we showed that RMA enhanced the phosphorylation of YAP in wild type cells, but not in LATS1/2 knock out cells, which means RMA activates classical Hippo pathway. RMA induced the cytoplasmic sequestration of YAP. RMA also suppressed the mRNA expression of CTGF and CYR61; the two major YAP dependent genes. Taken together, RMA is considered to be a good candidate for proliferative disease such as cancer, by facilitating cell death through activating the Hippo signaling pathway.

keywords : Hippo-YAP, Cancer, Phos-taq, Root bark of Morus alba

* Corresponding author

Han-Sol Jeong, School of Korean Medicine, Division of Applied Medicine, Pusan National University, 49 Busandaehak-ro, Mulgeum-eup, Yangsan-si, Gyeongsangnam-do, 50612, Rep. of Korea

·E-mail : [email protected] ·Tel : +82-51-510-8461

·Received : 2019/07/05 ·Revised : 2019/08/15 ·Accepted : 2019/08/20

ⓒ The Society of Pathology in Korean Medicine, The Physiological Society of Korean Medicine pISSN 1738-7698 eISSN 2288-2529 http://dx.doi.org/10.15188/kjopp.2019.08.33.4.191 Available online at https://kmpath.jams.or.kr

# Both authors contributed equally to this work

(2)

고 갈증을 멎게 하며…”라고 기록되어 있다14).

또한 RMA에는 Diels-Alder-type adducts와 다양한 flavonoids, 2-arylbenzofurans과 stilbenes 과 같은 bioactive한 compounds들이 함유되어 있다15). 이전의 연구들에 따르면 RMA 는 다양한 항염16,17), 항산화18), 항암효능19,20)이 있는 것으로 보고되 고 있다.

본 연구에서는 이러한 효능이 보고된 RMA가 최근 암발생 억 제 경로로 주목받고 있는 Hippo pathway에 영향을 미치는지 연구 하였고, RMA가 전형적인 Hippo경로를 활성화시킴으로써 발암촉진 보조전사인자인 YAP의 활성을 떨어뜨림을 확인하여 본 학회지에 보고하는 바이다.

재료 및 방법

1. RMA 추출물 제조

뽕나무뿌리껍질인 상근피는 ㈜내몸에닿(울산, 대한민국)으로부 터 구입하였다. 상근피 2kg을 MeOH에 침지하여 상온에서 7일간 3회 추출하였다. 추출용액을 Whatman No. 2 여과지로 여과한 다 음 38-45℃에서 감압농축하여 MeOH 추출물을 90.7 g (4.5%)을 얻었다. 그 후 MeOH 추출물 50 g을 증류수에 현탁시켜 CHCl3, EtOAc, n-BuOH 순으로 분획 후 농축하여 CHCl3 분획물 (15 g), EtOAc 분획물 (1.4 g), n-BuOH (15 g)및 H2O 분획물 (24 g)을 얻었다. 이 중 가장 강한 활성을 갖는 EtOAc분획을 가지고 실험을 진행하였다.

2. 시약 및 항체

EZ-CYTOX (Cat. No. EZ-1000)는 ㈜ 대일랩서비스(서울,대한 민국)에서 구입하였다. 일차 항체인 GAPDH(FL-335), YAP(sc-101199)은 Santa Cruz Biotechnology, Inc (Dallas, TEX, USA)로부터 구입하였고, YAP(14074), pYAP-S127(4911), LATS1(3477), pLATS-T1079(8654), YAP/TAZ-D24E4(8418)는 Cell Signaling Technology, Inc. (Danvers, MA, USA)에서 구입 하였다. 이차 항체인 anti-Rabbit Alexa Fluor 488 (A-11008)과 anti-mouse Alexa Fluor 488 (A-11001)과 DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride) (D1306)는 Life Technologies Corporation (Carlsbad, CA, USA)로부터 구 입하였다. TRIzol® Reagent (#15596026)은 Life Technologies Corporation (Carlsbad, CA, USA)로부터 구입하였으며, iScript

™ cDNA Synthesis Kit (#1708891)는 Bio-rad (Hercules, CA, USA) 로부터 구입하였다.

3. 세포배양 및 생존율 측정

HEK293 세포는 Korean Cell Line Bank (서울, 대한민국)으

로부터 구입하였다. 세포는 DMEM에 10% FBS,

penicillin-streptomycin (100 U/mL)을 첨가하여 37℃, 5 % CO2

조건의 습윤 incubator에서 배양하였다. 세포 생존율은 EZ-CYTOX를 이용하여 제조사의 프로토콜을 따라 측정하였다. 과 정을 간략히 기술하면 DMEM 100 μl와 EZ-Cytox 10 μl를 섞어서

blank로 사용하였다. 세포를 96 well plate에 1 X 104/mL의 수로 분주하고 다양한 농도의 RMA를 처리하여 16시간 incubation 하 였다. 이 후 각 well에 10 μl의 EZ-Cytox를 첨가한 후 2시간 CO2

incubator에서 반응시키고 이 후 microplate leader기로 450 nm 에서 흡광도를 측정함으로써 세포생존율을 관찰하였다.

4. Reporter Constructs, Reporter Cell line, Luciferase Assay TEAD 전사인자의 활성도를 측정하기 위하여 TEAD binding domain을 함유한 reporter cell line을 제작하였다. 간략히 기술 하면 TEAD binding domain인 GGAATG를 함유한 oligo (5’- CAATGGAATGCGTGGAATGCATGGAATGCGTGGAATGCAGGTAC -3’)를 luciferase reporter gene luc2가 있는 pGL4.26 vector (Promega, E8441)에 삽입하여 cloning하였다. TEAD binding domain을 삽입한 pGL4.26 vector를 HEK293 cell에 transfection시킨 후 hygromycin을 이용하여 transfection된 세 포만을 선별하였다. 선별된 세포를 초고속 유세포 자동분리분석기 (FACS Aria III, BD)에서 96 well plate에 single cell로 sorting 한 후 단일 클론을 만들었고, 그 중 luciferase 활성이 가장 높은 클론을 선별하여 reporter cell line을 구축하였다.

5. LATS1/2 Knock Out 세포 제작

Hippo-YAP signaling pathway에서 YAP의 인산화를 초래하 는 결정적 kinase인 LATS1과 LATS2를 CRISPR method를 이용 하여 Knock out시켰다. 제작법을 간략히 기술하면 다음과 같다.

CRISPR RGEN Tools web site

(http://www.rgenome.net/cas-designer/)를 이용하여 LATS1/2 중 N’terminal에 가까운 sequence 중에서 single guide RNA sequence를 디자인하였다. Single guide RNA sequence는 다음 과 같다. LATS1(#1): 5’- GCAGCCATCTGCTCTCGTCG-3’;

LATS1(#2): 5’- GGAGGTGGAGTTGTACCTCT-3’; LATS2(#1):

5’- GTAGGACGCAAACGAATCGC-3’; LATS2(#2): 5’- TAGCCCCTGAACCGAAGACT-3’. Single guide RNA sequence 는 px459와 Lenti CRISPR V2 vector에 삽입하여 클로닝하였다.

Plasmid sequencing을 통하여 디자인한 guide RNA sequence가 삽입된 것을 확인한 후 HEK 293 cell에 transfection을 시켰고, puromycin을 이용하여 transfection된 세포를 선별하였다. 이 후 선별된 세포를 초고속 유세포 자동분리분석기 (FACS Aria III, BD) 에서 96 well plate에 single cell로 sorting 한 후 단일 클론을 만 들었고, western blot을 통하여 LATS가 완전히 사라진 클론을 얻 어 LATS1/2 double knock out 클론의 제작을 완성하였다.

6. Western blot

6 well plate에 HEK294 cell을 1 × 106/well의 개수로 분주하 여 실험을 진행하였다. 단백질은 mild lysis buffer (10 mM Tris, pH 7.5, 2 mM EDTA, 100 mM NaCl, 1% Triton X-100, 50 mM NaF)를 이용하여 분리하였다. 6 well plate를 얼음 위에 놓 고, mild lysis buffer를 200 μl씩 넣고, 4℃ cold room shaker 에서 10분간 lysis 시켰다. Lysis된 세포들을 모은 후 14,000 rpm

(3)

에서 15분간 원심분리하여 상층액을 모은 후 Bradford 방법으로 정량하였다. 이 후 동량의 단백질을 sample buffer에 넣고 분주하 여 SDS-page gel로 전기영동하였다. 분리된 단백질들을 gel에서 PVDF membrane으로 transfer하였고, 이 후 membrane은 5%

non-fat dry milk로 1시간 동안 blocking 한 후 primary antibody와 함께 4℃에서 overnight하여 incubation시켰다. 다음 날 TBST로 3회 세척한 후 HRP가 결합된 secondary antibodies 와 상온에서 1시간 반응을 시키고, TBST로 4회 세척한 후 ECL을 이용하여 band를 확인하였다.

7. RT-PCR

Total RNA는 RNeasy Mini Kit (Qiagen, Hilden, Germany)

이용하여 제조사의 방법에 따라 추출하였다.

Spectrophotometer를 이용하여 RNA의 농도를 측량한 후, iScript ™ cDNA Synthesis Kit를 이용하여 cDNA를 합성하였고, specific primer를 이용하여 real time PCR방법을 통하여 cDNA 를 증폭하였다. PCR은 qPCR 2X premix (SYBR Green) (Enzynomics, Daejeon, Republic of Korea)를 이용하였다. PCR 에 사용된 primer는 다음과 같다. CTGF sense; 5’- TGGAGATTTTGGGAGTACGG-3’; CTGF anti-sense; 5’- CAGGCTAGAGAAGCAGAGCC-3’; CRY61 sense; 5’- AGCCTCGCATCCTATACAACC-3’; CRY61 anti-sense 5’- TTCTTTCACAAGGCGGCACTC-3’.

8. Confocal microscopy

12 well plate에 glass cover slip을 덮고, HEK293 WT과 LATS1/2 KO 세포를 1 × 105/well의 수로 분주하고 48시간을 incubation 하였다. 이 후 50, 100 ㎍/㎖의 RMA를 8시간 처리한 후 세포를 PBS로 세적하고, 4% formaldehyde solution으로 10분 간 고정하였다. PBS로 세척한 후 0.1% Triton X-100/PBS solution으로 세포막의 투과성을 확보하였다. 이 후 1시간 동안 3% BSA/PBS solution으로 blocking 한 후 세포를 YAP antibody(1:200 dilution)로 4℃에서 overnight incubation하였 다. 다음날 anti-Rabbit Alexa Fluor 488 antibody로 1시간 동안 반응시킨 후 PBS로 washing하였고, 이어서 ProLong® Gold Antifade Mountant with DAPI로 mounting한 후 nail polish로 sealing하였다. 다음날 Zeiss LSM 700 Laser Scanning Confocal microscope로 이미지를 촬영하였다.

결 과

1. 세포생존율

RMA가 세포생존율에 어떤 영향을 미치는지 살펴보고자 EZ-CYTOX를 이용하여 세포생존율을 검사하였다. 그림 1에서 보 는 결과와 같이 RMA는 50 μg/ml 농도에서부터 세포독성을 나타 냈다. 200 μg/ml이상의 농도에서 세포생존율은 50% 미만이어서 이 후 실험은 가장 높은 농도를 100 μg/ml으로 설정하고 진행하 였다.

Fig. 1. Cell viability. We treated the indicated amount of RMA to HEK 293 cells for 24h. Cell viability was measured by EZ-cytox kit according to the protocol of the manufacturer. Cell viability was significantly decreased in the RMA treated cells at concentrations higher than 50 μg/ml.

2. TEAD transcriptional activity측정 (luciferase assay) FBS는 G-Protein-Coupled Receptor를 통하여 YAP/TAZ의 활성을 높이는 것으로 잘 알려져 있다21). 본 연구에서는 YAP과 결 합하여 이들의 oncogenic 효능을 유도하는 것으로 잘 알려진 TEAD의 transcriptional activity를 측정하고자, TEAD binding domain을 함유한 reporter cell line (HEK293A)을 구축하였다.

TEAD binding domain이 잘 작동하는지 FBS를 처리하여 가장 활 성이 높은 cell line을 골랐다. FBS처리 후 luciferase activity가 높아지는 것은 6시간부터 두드러졌다(Fig. 2A). 세포를 1X 105/ml 로 분주한 후 다음 날 24간 동안 serum starvation 시켜 TEAD 활성을 떨어뜨렸다. 24시간 후 FBS 10% DMEM으로 배양액을 교 환한 후 RMA를 농도별로 16시간 처리하였다. 다음날 아침 세포를 harvest하여 luciferase activity가 얼마나 감소하였는지 측량함으 로써 약물의 TEAD transcriptional activity 억제 효능을 조사하 였다. 흥미롭게도 50 μg/ml 에서 세포생존율이 떨어진 것과는 달 리 TEAD transcriptional activity는 10 μg/ml 농도에서부터 현 저히 떨어졌다(Fig. 2B).

3. YAP의 인산화에 미치는 영향

RMA가 전형적인 Hippo signaling pathway에 영향을 미치는 지 조사하기 위하여 Hippo signaling pathway 가운데 YAP/TAZ 의 바로 상위에 있는 serine threonine kinase인 LATS1과 LATS2를 CRISPR method를 통하여 다른 sgRNA CRISPR를 이용 한 knock out 클론 두 개를 제작하였다(Fig. 3A). RMA를 농도별 로 wild type (WT)과 LATS1/2 knock out 세포에 16시간 처리한 후 세포 내 YAP의 인산화를 관찰하기 위하여 phos-taq gel shift assay와 phospho-YAP(S127)과 phsopho-ACC(S79)에 대한 western blot를 시행하였다. 조사 결과 50, 100 μg/ml를 처리하 였을 경우 YAP의 전반적인 인산화가 증가되어 있었고(Fig. 3B phos-taq; WT), LATS1/2의 대표적인 인산화 자리인 YAP 단백질 의 serine 127번의 인산화도 증가되어 있었다(Fig. 3B p-YAP(S127); WT). 반면 LATS1/2 KO 세포에서는 YAP의 인산 화가 관찰되지 않았으며(Fig. 3B phos-taq; LATS1/2 KO), p-YAP(S127)의 인산화도 전혀 일어나지 않았다(Fig. 3B p-YAP(S127); LATS1/2 KO). 흥미롭게도 에너지 스트레스를 유도

(4)

하였을 때 LATS의 상위에서 YAP을 인산화시키는 것으로 보고된

22) AMPK의 기질인 p-ACC(S79)의 인산화는 WT과 KO 군에서 모 두 일어났다.

Fig. 2. Luciferase assay in HEK 293A cells transfected with the synthetic TEAD reporter 4X-lux. A. luciferase activity was increased after 6h of FBS treatment. B. Cells were maintained with serum free media for 24h before the treatment of RMA. After 16h treatment, cells were incubated with 10% FBS containing DMEM for 6 h. Representative results of a single experiment with n = 2 biological replicates; three independent experiments had been done. ***p<0.001 ; one way ANOVA was applied.

Fig. 3. RMA acts through LATS to phosphorylate YAP. A. LATS1 and LATS2 were knocked out by CRISPR method. B. RMA induces YAP phosphorylation in a LATS1/2-dependent manner in HEK293A cells. RMA also phosphorylate ACC (a well-known AMPK substrates). YAP-PT;

YAP-phos-taq gel shift assay.

4. YAP의 activity에 미치는 영향

인산화 될 경우 YAP단백질은 세포질에 유리되어 핵내 세포증

식과 항세포사멸을 시키는 유전자의 전사를 유도하는 전사인자인 TEAD와 상호작용이 떨어짐으로써 YAP target gene의 발현을 감 소시킨다. RMA가 YAP의 활성에 미치는 영향을 조사하기 위하여 confocal microscope를 통하여 YAP 단백질의 위치를 추적한 결 과 예상한 바와 같이 YAP의 인산화를 유도한 RMA는 WT세포에서 YAP을 핵 내에서 세포질로 유리시킨 반면, LATS KO 세포에서는 YAP의 세포질 유리가 현저하게 억제되고 핵 내에 머물러 있었다 (Fig. 4A).

YAP이 인산화 될 경우 핵 내에서 세포질로 유리되어 핵 내 세포증식과 연관된 주요한 전사인자인 TEAD와의 결합이 감소됨으 로써 YAP dependent gene의 발현이 감소된다. RMA는 YAP dependent gene 인 connective tissue growth factor (CTGF)와 cysteine-rich angiogenic inducer 61(CYR61)의 발현을 현저히 감소시킨 반면 LATS1/2 KO 세포에서는 이들 유전자의 발현을 덜 감소시켰다. 상대적인 발현량 또한 LATS1/2 KO 세포에서 높았으 며, 특히 CTGF의 발현량의 차이가 유의성 있게 두드러졌다(Fig.

4B). 이 결과는 그림 3에서와 같이 RMA가 전형적인 Hippo pathway를 통하여 YAP을 인산화시키면서 이들의 활성을 억제하 고 있음을 시사한다.

Fig. 4. RMA inhibit YAP activity. A. RMA induces cytoplasmic translocation of YAP in WT cells; however, in LATS1/2 KO cells, YAP markedly located in the nucleus even at the high concentration of RMA.

Cells were attached onto the polylysine-coated coverglasses. RMA treated or control cells were then fixed and stained with the YAP, and with Alexa Fluor 488-conjugated antibody. Cell nuclei were stained with DAPI. B.

RMA suppresses the expression of YAP target genes CTGF and CYR61.

The cells were treated with 50, 100 μg/ml of RMA for 8h, and their CTGF and CYR61 expression were measured by quantitative real-time PCRs.

3replicates are included in this experiment. ***p<0.001; one way ANOVA

was applied.

(5)

고 찰

세포의 숫자를 조절하는 것은 장기의 발달과정에서 필수적인 기능이다. 특히 암과 같은 증식질환에서는 이러한 조절기능이 깨져 있다. 초파리의 연구에서 처음 발견된 Hippo 신호전달 경로는 세 포의 증식과 사멸을 조절함으로써 장기의 크기를 조절하는 핵심적 인 경로로 알려졌다23,24). 이후 진행된 광범위한 유전적 생화학적 연구 결과 포유류 Mst1/2 (Hippo homolog)는 Sav1과 함께 Lats1/2 kinase를 인산화시키고, Lats1/2 역시 Mob1이라는 단백 질에 의하여 활성화되어 Yes-associated protein (YAP)과 transcriptional coactivator with PDZ-binding motif (TAZ)를 직접 인산화시킴으로써 불활성화시킨다11,25). 장기의 크기를 조절하 거나 종양의 발달과정에서의 YAP의 기능은 형질전환 마우스 모델 을 사용하여 포유류에서 확인되었다26,27). YAP과 TAZ는 세포질과 핵 사이를 왕래하는 보조전사인자로 여러 전사인자들, 특히 TEA domain family members (TEAD)와 결합하여 세포증식과 세포자 멸에 길항작용을 하는 유전자의 발현을 유도하는 것으로 알려져 있 4). YAP과 TAZ의 상위에 있는 Hippo kinase 시스템이 활성화 되면 LATS1, LATS2를 인산화시키고, 인산화된 LATS1/2는 이어 서 YAP/ TAZ를 인산화시킴으로써 불활성화시킨다. 반면 Hippo kinase 시스템이 활성화되지 않았을 경우 인산화되지 않은 YAP/TAZ는 핵 안으로 들어가 세포증식과 연관된 표적 유전자를 발현시킨다28).

다양한 암에서 YAP/TAZ의 과도한 활성화가 보고되고 있으 며, YAP/TAZ를 조절하는 후성유전학적 변화도 우세한 것으로 보아 YAP/TAZ로 인한 전사활성은 종양의 발달과 지속에 중요한 역할을 하는 것으로 보인다2,28). YAP/TAZ를 과발현시키면 EMT 과정을 통하여 정상상피세포를 전이된 암세포로 전환시키며, 줄 기세포의 특성을 초래하기도 한다6,29-31). 특히 YAP/TAZ는 종양 의 cancer-stem-cell fraction에서 활성화되어 있으며, 종양의 형성과 전이, 항암제에 대한 내성획득에서도 주요한 역할을 담당 한다30,32,33).

따라서 YAP/TAZ의 활성을 떨어뜨리는 약물은 기존 항암제와 병용 투여할 경우 항암제 내성발생을 억제할 것으로 기대할 수 있 을 것이다. 본 연구진은 YAP/TAZ의 핵내 파트너인 TEAD의 활성 을 측정하는 reporter gene assay가 가능한 stable cell line을 구축하였고, 이를 가지고 실험실 내에서 보유하고 있는 한약추출물 을 가지고 스크리닝 한 결과 가장 우수한 효능이 보이는 상근피 (RMA)를 가지고 실험을 진행하였다. 먼저 RMA의 세포 생존율에 미치는 영향을 조사한 결과 50 μg/ml 이상의 농도에서 유의미한 세포생존율 감소를 확인하였다(Fig. 1). 흥미롭게도 RMA는 10 μ g/ml의 농도에서부터 TEAD transcriptional activity를 현저하게 떨어뜨렸다(Fig. 2B). 이에 RMA가 Hippo-YAP signaling을 조절 하는 능력의 정도를 조사하였다. YAP의 인산화 능력을 조사하기 위하여 HEK293A 세포에 농도별로 RMA를 처리한 후 YAP의 인산 화를 phos-taq gel shift assay법을 통하여 검사하였다. 단백질의 전체적인 인산화 정도를 관찰하는 유용한 방법인 phos-taq gel shift assay에서 인산화 된 단백질이 phos-tag gel의 전기영동에

서 느리게 이동하므로, 상위에서 발현된 것은 전반적인 인산화가 많이 되었음을 의미한다34). RMA를 16시간 처리했을 때 50 μg/ml 의 농도에서부터 YAP의 인산화를 유도하는 것을 확인하였다(Fig.

3B phos-taq; WT). YAP의 인산화에 가장 결정적 역할을 하는 것 은 hippo signaling pathway의 하류에 있는 LATS1/2 kinase이 11). 이에 LATS1/2에 의한 인산화 site 중 가장 대표적인 serine 127의 인산화여부를 관찰한 결과, 예상했던 바와 같이 RMA는 고 농도(50, 100 μg/ml)에서 p-YAP(S127)의 인산화를 효율적으로 유 도하였다(Fig. 3B p-YAP(S127); WT). 본 연구진에서는 약물이 전 형적인 hippo signaling pathway에 영향을 미치는지 확인하고자 CRISPR method를 이용하여 LATS1과 LATS2 단백질을 knock out 시켰고, western blot을 통하여 knock out 되어 있음을 확인 하고, 실험을 진행하였다(Fig. 3A). WT 세포에서 YAP의 인산화를 유도했던 RMA는 LATS1/2 KO 세포에서는 YAP의 인산화를 전혀 유도하지 못했고, p-YAP(S127)의 발현도 전혀 하지 못하였다(Fig.

3B). 이는 RMA의 YAP을 인산화시키는 능력이 전형적인 Hippo-LATS-YAP의 경로를 따르고 있음을 시사한다. 흥미롭게도 RMA는 AMPK의 대표적 substrate인 p-ACC(S79)의 발현을 증가 시켰으며(Fig. 3B), 이는 AMPK를 활성화시키는 능력이 있음을 시 사한다. 세포내 에너지 대사에서 핵심적인 조절인자인 AMPK는 대 표적인 catabolic 인자로 잘 알려져 있다35). AMPK가 활성화될 경 우 Hippo경로 의존적, 또는 비의존적으로 YAP이 인산화되는 것으 로 보고되었다22,36). 본 연구에서 RMA는 WT과 LATS1/2 KO 세포 에서 모두 AMPK를 활성화시켰으나, WT에서는 YAP을 인산화 시 킨 반면, LATS KO세포에서는 YAP의 인산화를 전혀 시키지 못하 였다(Fig. 3B). 이는 AMPK 신호가 LATS의 상위에 있으며, RMA 의 AMPK활성 능력이 LATS 의존적으로 YAP의 인산화를 유도하 고 있음을 시사한다.

LATS1/2에 의하여 인산화 될 경우 YAP은 불활성화되는데, 특히 serine 127번 (S127)의 인산화는 14-3-3과 결합할 부위를 만들고, 14-3-3와 결합된 YAP은 세포질에 유리되어 핵 안으로 들 어가지 못한다11,27). 또한 serine 381 (S381)의 인산화는 casein kinase1에 의한 인산화를 유도함으로써 phosphodegron을 활성화 시켜 SCFbeta TRCP E3 ligase를 동원시킴으로써 유비퀴틴화를 통한 YAP의 분해를 촉진시킨다37). 인산화 되지 않았을 경우 YAP 은 핵 내로 이동하여 TEAD family transcription factors (TEAD1-4)과 결합함으로써, 세포증식과 항세포사멸에 연관된 유전 자의 발현을 촉진시킨다38).

YAP의 인산화를 촉진시키는 RMA는 WT 세포에서 예상했던 바와 같이 핵 내에 위치한 YAP을 세포질로 유리시킨 반면, LATS1/2 KO 세포에서는 동일한 농도의 RMA처리에도 불구하고 YAP은 세포질로 유지되지 못하고 핵 내에 머물러 있었다(Fig.

4A). YAP dependent gene인 CTGF나 CRY61의 발현 역시 RMA 의 처리에 의하여 감소하였으나, LATS1/2 KO 세포에서는 WT에 비하여 이들의 발현 감소는 훨씬 미약하였다(Fig. 4B).

이상의 결과 RMA는 종양의 생성, 전이, 항암제 내성, 암줄기 세포능력획득과 밀접한 연관이 되고 있어 최근 주목받고 있는 전형 적인 hippo signaling pathway를 활성화시킴으로써 YAP을 인산

(6)

화 시킴으로써 불활성화시켰다. 따라서 향 후 RMA는 YAP의 과발 현과 연관된 암의 예방, YAP의 과발현으로 인한 항암제 내성획득 시 내성극복 약물로서의 개발가능성을 지니고 있다고 판단되며, 다 양한 암세포주 실험과 동물실험과 같은 전임상 심화 연구를 통하여 그 효용성을 검증해 나갈 것이다.

감사의 글

본 연구는 부산대학교 기본연구지원사업 (2년)의 지원을 받아 수행되었음.

References

1. Pan D. The hippo signaling pathway in development and cancer. Developmental cell. 2010;19(4):491-505.

2. Harvey KF, Zhang X, Thomas DM. The Hippo pathway and human cancer. Nat Rev Cancer. 2013;13(4):246-57.

3. Zhao B, Li L, Lei Q, Guan KL. The Hippo-YAP pathway in organ size control and tumorigenesis: an updated version. Genes & development. 2010;24(9):862-74.

4. Mo JS, Park HW, Guan KL. The Hippo signaling pathway in stem cell biology and cancer. EMBO reports.

2014;15(6):642-56.

5. Moroishi T, Hansen CG, Guan KL. The emerging roles of YAP and TAZ in cancer. Nat Rev Cancer.

2015;15(2):73-9.

6. Yimlamai D, Christodoulou C, Galli GG, Yanger K, Pepe-Mooney B, Gurung B, et al. Hippo pathway activity influences liver cell fate. Cell. 2014;157(6):1324-38.

7. Xin M, Kim Y, Sutherland LB, Murakami M, Qi X, McAnally J, et al. Hippo pathway effector Yap promotes cardiac regeneration. Proceedings of the National Academy of Sciences of the United States of America.

2013;110(34):13839-44.

8. Graves JD, Gotoh Y, Draves KE, Ambrose D, Han DK, Wright M, et al. Caspase-mediated activation and induction of apoptosis by the mammalian Ste20-like kinase Mst1. Embo J. 1998;17(8):2224-34.

9. Lee KK, Yonehara S. Phosphorylation and dimerization regulate nucleocytoplasmic shuttling of mammalian STE20-like kinase (MST). The Journal of biological chemistry. 2002;277(14):12351-8.

10. Piccolo S, Dupont S, Cordenonsi M. The biology of YAP/TAZ: hippo signaling and beyond. Physiological reviews. 2014;94(4):1287-312.

11. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, et al.

Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth

control. Genes & development. 2007;21(21):2747-61.

12. Yu FX, Guan KL. The Hippo pathway: regulators and regulations. Genes & development. 2013;27(4):355-71.

13. Mo JS. The role of extracellular biophysical cues in modulating the Hippo-YAP pathway. Bmb Rep.

2017;50(2):71-8.

14. Heo, J, Dongeuibogam. Seoul: Bupin publish co. p 2010:

2007.

15. Yang Y, Tan YX, Chen RY, Kang J. The latest review on the polyphenols and their bioactivities of Chinese Morus plants. Journal of Asian Natural Products Research. 2014;16(6):690-702.

16. Lim HJ, Jin HG, Woo ER, Lee SK, Kim HP. The root barks of Morus alba and the flavonoid constituents inhibit airway inflammation. Journal of ethnopharmacology. 2013;149(1):169-75.

17. Wu YX, Kim YJ, Kwon TH, Tan CP, Son KH, Kim T.

Anti-inflammatory effects of mulberry (Morus alba L.) root bark and its active compounds. Nat Prod Res.

2018:1-4.

18. Chang LW, Juang LJ, Wang BS, Wang MY, Tai HM, Hung WJ, et al. Antioxidant and antityrosinase activity of mulberry (Morus alba L.) twigs and root bark. Food Chem Toxicol. 2011;49(4):785-90.

19. Eo HJ, Park JH, Park GH, Lee MH, Lee JR, Koo JS, et al.

Anti-inflammatory and anti-cancer activity of mulberry (Morus alba L.) root bark. BMC complementary and alternative medicine. 2014;14:200.

20. Kikuchi T, Nihei M, Nagai H, Fukushi H, Tabata K, Suzuki T, et al. Albanol A from the root bark of Morus alba L. induces apoptotic cell death in HL60 human leukemia cell line. Chem Pharm Bull (Tokyo).

2010;58(4):568-71.

21. Yu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell.

2012;150(4):780-91.

22. Mo JS, Meng Z, Kim YC, Park HW, Hansen CG, Kim S, et al. Cellular energy stress induces AMPK-mediated regulation of YAP and the Hippo pathway. Nat Cell Biol.

2015;17(4):500-10.

23. Zhao B, Lei QY, Guan KL. The Hippo-YAP pathway:

new connections between regulation of organ size and cancer. Curr Opin Cell Biol. 2008;20(6):638-46.

24. Kango-Singh M, Singh A. Regulation of Organ Size:

Insights From the Drosophila Hippo Signaling Pathway.

Dev Dynam. 2009;238(7):1627-37.

25. Hao YW, Chun A, Cheung K, Rashidi B, Yang XL.

(7)

Tumor suppressor LATS1 is a negative regulator of oncogene YAP. Journal of Biological Chemistry.

2008;283(9):5496-509.

26. Camargo FD, Gokhale S, Johnnidis JB, Fu D, Bell GW, Jaenisch R, et al. YAP1 increases organ size and expands undifferentiated progenitor cells. Current Biology. 17(23):2054-60.

27. Dong J, Feldmann G, Huang J, Wu S, Zhang N, Comerford SA, et al. Elucidation of a universal size-control mechanism in Drosophila and mammals.

Cell. 2007;130(6):1120-33.

28. Johnson R, Halder G. The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment. Nature reviews Drug discovery.

2014;13(1):63-79.

29. Hong JH, Hwang ES, McManus MT, Amsterdam A, Tian Y, Kalmukova R, et al. TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Science.

2005;309(5737):1074-8.

30. Cordenonsi M, Zanconato F, Azzolin L, Forcato M, Rosato A, Frasson C, et al. The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell. 2011;147(4):759-72.

31. Chan SW, Lim CJ, Guo K, Ng CP, Lee I, Hunziker W, et al. A role for TAZ in migration, invasion, and tumorigenesis of breast cancer cells. Cancer Res. 2008;

68(8):2592-8.

32. Basu-Roy U, Bayin NS, Rattanakorn K, Han E, Placantonakis DG, Mansukhani A, et al. Sox2 antagonizes the Hippo pathway to maintain stemness in cancer cells. Nature communications. 2015;6:6411.

33. Bartucci M, Dattilo R, Moriconi C, Pagliuca A, Mottolese M, Federici G, et al. TAZ is required for metastatic activity and chemoresistance of breast cancer stem cells. Oncogene. 2015;34(6):681-90.

34. Zhao B, Li L, Wang L, Wang CY, Yu J, Guan KL. Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes &

development. 2012;26(1):54-68.

35. Shackelford DB, Shaw RJ. The LKB1-AMPK pathway:

metabolism and growth control in tumour suppression.

Nat Rev Cancer. 2009;9(8):563-75.

36. Wang W, Xiao ZD, Li X, Aziz KE, Gan B, Johnson RL, et al. AMPK modulates Hippo pathway activity to regulate energy homeostasis. Nat Cell Biol. 2015;17(4):490-9.

37. Zhao B, Li L, Tumaneng K, Wang CY, Guan KL. A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF beta-TRCP. Genes &

development. 2010;24(1):72-85.

38. Zhao B, Ye X, Yu J, Li L, Li W, Li S, et al. TEAD mediates YAP-dependent gene induction and growth control. Genes & development. 2008;22(14):1962-71.

수치

Fig.  1.  Cell  viability.  We  treated  the  indicated  amount  of  RMA  to  HEK  293 cells for 24h
Fig.  2.  Luciferase  assay  in  HEK  293A  cells  transfected  with  the  synthetic TEAD reporter 4X-lux

참조

관련 문서

In this study, to investigate how applying a critical pathway to stomach cancer patients affects their recovery and treatment, the clinical effect of the critical

 Often found connected to other molecules on the outsides of cells --- cellular recognition, cell signaling, cell

Futhermore, if the consultation activity is performed through the development of various methods on the Gestalt Group Art Therapy in personal and

Since every classical or virtual knot is equivalent to the unknot via a sequence of the extended Reidmeister moves together with the forbidden moves, illustrated in Section 2,

웹 표준을 지원하는 플랫폼에서 큰 수정없이 실행 가능함 패키징을 통해 다양한 기기를 위한 앱을 작성할 수 있음 네이티브 앱과

_____ culture appears to be attractive (도시의) to the

The index is calculated with the latest 5-year auction data of 400 selected Classic, Modern, and Contemporary Chinese painting artists from major auction houses..

1 John Owen, Justification by Faith Alone, in The Works of John Owen, ed. John Bolt, trans. Scott Clark, &#34;Do This and Live: Christ's Active Obedience as the