BASIC RESEARCH PAPER
Insulin-degrading enzyme secretion from astrocytes is mediated by an
autophagy-based unconventional secretory pathway in Alzheimer disease
Sung Min Sona,b, Moon-Yong Chaa, Heesun Choia, Seokjo Kanga, Hyunjung Choia, Myung-Shik Leec, Sun Ah Parkd, and Inhee Mook-Junga,b
aDepartment of Biochemistry & Biomedical Sciences, Seoul National University College of Medicine, Seoul, Korea;bNeuroscience Research Institute, Seoul National University College of Medicine, Seoul, Korea;cDepartment of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea;dDepartment of Neurology, Soonchunhyang University Bucheon Hospital, Bucheon, Korea
ARTICLE HISTORY
Received 30 March 2015 Revised 8 February 2016 Accepted 23 February 2016
ABSTRACT
The secretion of proteins that lack a signal sequence to the extracellular milieu is regulated by their transition through the unconventional secretory pathway. IDE (insulin-degrading enzyme) is one of the major proteases of amyloid beta peptide (Ab), a presumed causative molecule in Alzheimer disease (AD) pathogenesis. IDE acts in the extracellular space despite having no signal sequence, but the underlying mechanism of IDE secretion extracellularly is still unknown. In this study, we found that IDE levels were reduced in the cerebrospinalfluid (CSF) of patients with AD and in pathology-bearing AD-model mice. Since astrocytes are the main cell types for IDE secretion, astrocytes were treated with Ab. Ab increased the IDE levels in a time- and concentration-dependent manner. Moreover, IDE secretion was associated with an autophagy-based unconventional secretory pathway, and depended on the activity of RAB8A and GORASP (Golgi reassembly stacking protein). Finally, mice with global haploinsufficiency of an essential autophagy gene, showed decreased IDE levels in the CSF in response to an intracerebroventricular (i.c.v.) injection of Ab. These results indicate that IDE is secreted from astrocytes through an autophagy-based unconventional secretory pathway in AD conditions, and that the regulation of autophagy is a potential therapeutic target in addressing Ab pathology.
KEYWORDS
Alzheimer disease; amyloid beta; autophagy; autophagy-based unconventional secretion; insulin-degrading enzyme
Introduction
Alzheimer disease (AD) is characterized by senile plaques, neu-rofibrillary tangles, and neuronal cell death.1Abnormal aggre-gates of the amyloid-beta peptide (Ab) are deposited in the extracellular senile plaques and are associated with neurode-generation in AD.2In AD brains, intracellular and extracellular Ab accumulation occurs because of the imbalance between the production of Ab and its removal (clearance) from the brain. IDE (insulin-degrading enzyme) is a major endogenous Ab degrading enzyme that mediates Ab clearance, and its levels and enzymatic activity are negatively correlated with the size of the amyloid plaques and AD pathology.3In AD brains, IDE is mainly detected in astrocytes,4and located in the cytosol and
intracellular compartments such as mitochondria and peroxi-somes.5However, it is also known to play a role in the
extracel-lular milieu via the secretory pathway.6 IDE has no signal
peptide sequence for secretion through the conventional secre-tory pathway, and despite many studies demonstrating that IDE is secreted and/or associated with the cell surface, little is known about the underlying secretory mechanism.
Macroautophagy (hereafter referred to as autophagy) is a fundamental biological process in eukaryotes,7 and has an
impact on essential biological processes in human health including aging, cancer, neurodegenerative disease, immunity, and metabolic disorders.8,9Autophagy is currently best known as a degradative pathway that delivers cytoplasmic material and organelles to the lysosomes for degradation.10 All autophagy-related processes include the formation of double-membrane structures called the autophagosomes, and are induced by the inhibition of MTOR (mechanistic target of rapamycin [serine/ threonine kinase]) signaling pathway. Autophagosomes and their contents undergo clearance upon fusion with endosomes (amphisomes) or lysosomes (autolysosomes) for degradation and recycling (autophagic flux).7,10 However, recent studies show that autophagy also has a role in nonautophagic pro-cesses, especially in the secretory pathway.11In eukaryotic cells, the autophagy-based secretory pathway (autosecretion12) regu-lates the unconventional secretion of several cytosolic proteins such as IL1B (interleukin 1, beta), IL18, HMGB1 (high mobility group box 1), and VWF (von Willebrand factor), as well as ATP.13-15 There are 3 principal features defining autophagy-based secretion: 1) proteins lacking a signal sequence, 2) contri-bution of autophagy-related (ATG) genes, and 3) association with GORASP (Golgi reassembly and stacking protein).16
CONTACT Inhee Mook-Jung [email protected] Department of Biochemistry and Biomedical Sciences, Seoul National University College of Medicine, 28 Yungun-dong, Jongro-gu, Seoul, 110-799, Korea
Color versions of one or more of thefigures in the article can be found online at www.tandfonline.com/kaup. Supplemental data for this article can be accessed on thepublisher’s website.
© 2016 Taylor & Francis
In the brains of patients with AD and animal models, patho-logical autophagic vacuoles (AVs) are accumulated through increased induction via the AMPK-MTOR pathway and dys-function in the autophagy-lysosomal degradation.17-19 Main-taining autophagic flux is important for cell survival, and dysregulated autophagy is expected to accelerate AD progres-sion; however, the mechanism is not yet fully understood. In this study, we found that Ab increased IDE secretion from astrocytes in a time- and concentration-dependent manner, and Ab-induced IDE secretion was associated with autophagy. In addition, in vitro and in vivo data suggests that autophagic flux is important in IDE secretion. GORASP and RAB8A also had a role in IDE secretion. To determine the IDE secretion lev-els in vivo, the cerebrospinalfluid (CSF) was analyzed because the CSF has more physical contact with the brain than any otherfluid in the body, as it is not separated from the brain by the tightly regulated blood brain barrier (BBB). We found that the mice with global haploinsufficiency of an ATG7 (Atg7C/¡
mice) showed decreased IDE activities and expression levels in CSF in response to an intracerebroventricular (i.c.v.) injection of Ab, indicating that this Ab-induced IDE secretion is medi-ated by autophagy. Investigating the role of autophagy on IDE secretion in the AD brain revealed that 1.5-mo-old Tg6799 mice, an AD mouse model,20 showed increased IDE secretion in the CSF compared to the littermate control mice. The CSF of 7-mo-old Tg6799, however, showed reduced IDE level, and dysfunction in the lysosome. Finally, CSF from patients with AD showed decreased IDE activity and level, and this reduction was correlated with cognitive impairment in AD patients using clinical dementia rating (CDR) and mini-mental state examina-tion (MMSE) scores. Overall, these results indicate that IDE is secreted from astrocytes through autophagy-based secretory pathway in AD, and regulation of autophagy is a potential ther-apeutic target in Ab pathology.
Results
Ab induces extracellular secretion of functional IDE from astrocytes
Previous studies have reported astrocytes as a main source for IDE in AD pathology;4 therefore, we determined whether
Ab regulates IDE levels in the extracellular space of astrocytes. Exogenous Ab1-42, but not Ab42-1 (reverse form of Ab1-42;
revAb), increased IDE secretion from the mouse primary astro-cytes and human astrocytoma cells, U373MG, in a time- and dose-dependent manner (Fig. 1Ato C for primary astrocytes; Fig. S1A and B for U373MG cells). To determine whether the IDE secretion is regulated by Ab, Ide siRNA was transfected into astrocytes. Ab increased IDE secretion in the scrambled siRNA-transfected cells, but not the Ide siRNA-transfected cells (Fig. S1C and D). To examine whether the IDE secreted by Ab treatment has a function as insulysin (an insulin-degrading function), an IDE enzymatic activity assay was adopted. Increased fluorescence intensity generated by the cleavage of fluorometric IDE substrates in the Ab-treated, astrocyte-condi-tioned media (Ab-ACM) was detected (Fig. 1D). When bacitra-cin A, an IDE inhibitor, was added to the Ab-ACM, the fluorescence intensity was decreased, while thiorphan, a MME
(membrane metallo-endopeptidase) inhibitor, did not alter the increased fluorescence intensity by Ab (Fig. 1D), indicating that Ab-ACM contains functional IDE that degrades insulin. In an alternative approach, Ab degradation assay was per-formed. When the Ab-ACM was incubated with recombinant Ab peptide, the level of the remaining Ab peptide was reduced
(Fig. 1E and F). Furthermore, the reduced Ab levels after
incu-bation with the Ab-ACM were restored when either bacitracin A or insulin (competing partner of Ab to IDE) was added
(Fig. 1F). These data demonstrate that Ab-induced IDE,
secreted from astrocytes, functions as a protease.
Ab-induced IDE secretion is associated with an autophagy-based unconventional secretory pathway To examine the mechanism of Ab-induced IDE secretion, tran-script levels of IDE after Ab treatment were measured by RT-PCR and qRT-PCR (quantitative real-time RT-PCR). Ab did not alter Ide mRNA levels in astrocytes (Figs. 2A and B). Since IDE has no signal sequence for secretion, we further investigated the secretory mechanism of IDE. To examine the IDE secretion via an unconventional secretory pathway, BFA (brefeldin A), a blocker of conventional secretion, was added along with Ab. BFA failed to inhibit Ab-induced IDE secretion, and even increased IDE secretion (Fig. S1E and F). Because MMP9 (matrix metallopeptidase 9), another Ab-degrading enzyme, has a signal sequence, BFA inhibited MMP9 secretion in the Ab treatment (Fig. S1G). Our results also confirmed that the secretion of HMGB1, a previously known protein secreted through unconventional secretory pathway,13 increased after BFA treatment, similarly to IDE (Fig. S1H). Because BFA induced the endoplasmic reticulum (ER) stress (indicated by increased DDIT3 levels; Fig. S1E and I) and increased IDE secretion (Fig. S1E and F), we investigated the role of ER stress on IDE secretion. We found that treatment with TUDCA, a chemical chaperone which can reduce ER stress,21 inhibited Ab-induced IDE secretion from primary astrocytes (Fig. S1J). Recent reports have shown that autophagy plays a role in unconventional protein secretion in mammalian cells.11,13,14,22
To examine whether Ab-induced IDE secretion is associated with autophagy, we utilized several autophagic modulators. We found that Ab-induced autophagy is activated in astrocytes
(Fig. 2C and D; Fig. S2A and B), and that Ab modulated the
AMP-activated protein kinase (PRKA)-MTOR signal pathway, which in turn can regulate autophagy induction (Fig. S2C).17 When 3-methyladenine (3MA), an autophagy inhibitor, was added along with Ab, Ab-induced IDE secretion was signifi-cantly inhibited by 3MA (Fig. 2C and D; Fig. S2A), but not MMP9 (Fig. S1G). These data were confirmed by inhibiting autophagy with Atg5 siRNA (Fig. 2E). To activate autophagy, rapamycin, a functional autophagy inducer that inhibits MTOR, was applied to astrocytes, resulting in increased IDE secretion from astrocytes (Fig. 2F). To investigate whether IDE exists in the autophagosomes, IDE and LC3 were stained with their specific antibodies and then visualized using confocal microscopy and super resolution microscopy. Immunocyto-chemistry data showed that IDE was located in the autophago-somes (Fig. 2G and H). Taken together, these data imply that
Ab-induced IDE secretion is tightly regulated by the autophagy pathway.
IDE is degraded through the proteasome pathway
Since the treatment with proteasome inhibitor, MG132, increased the IDE levels (Fig. 2F), IDE might be a substrate for
the proteasome. To examine this possibility, astrocytes were cotreated with MG132 and Ab, resulting in increased IDE lev-els both intracellularly and extracellularly (Fig. S3A and B). Moreover, treatment with MG132 alone also increased IDE lev-els compared to vehicle treatment (Fig. S3A and B), indicating that basal IDE levels were regulated by the proteasome pathway.
Figure 1.Ab induces extracellular secretion of functional IDE from primary astrocytes. (A, B) Increased IDE levels secreted from the primary astrocytes with Ab treatment, in a concentration-(A) and time-(B) dependent manner. Treatments were 0.5, 1 or 2mM of Ab for 24 h (A), and 1 mM of Ab for 1, 3, 12 or 24 h (B). Blots are representative of at least 3 independent experiments. (C) Measurement of IDE levels in the media from primary astrocytes by ELISA. (D) IDE enzymatic activity in media containing 1mM Ab and/or several inhibitors (Thiorphan [10 mM], Bacitracin A [10 mM]) for 24 h. Baci. A, Bacitracin A. (E) Cell-free Ab degradation assay. rIDE, recombinant IDE protein (0.3 ng/mL). The arrowhead indicates remaining Ab levels. Data were obtained from at least 3 replicates for each group (N D 3 experiments). (F) Ab degradation assay with several drugs. Ins, insulin (0.5mM); Baci. A, bacitracin A (10 mM). Data were obtained from at least 3 replicates for each group (N D 3 experiments). Values are mean§ SEM, P< 0.05;, P< 0.01; and, P< 0.001 vs. vehicle-treated cells; #, P < 0.05 vs. cells treated with Ab.
Figure 2.Ab-induced IDE secretion from primary astrocytes is associated with the autophagy-mediated unconventional secretion pathway. (A) RT-PCR analysis of Ide mRNA levels under Ab treatment conditions. (B) Quantification of Ide mRNA levels by qPCR. (C) Increased LC3-II levels in astrocytes by Ab treatment demonstrate the role of autophagy in Ab-induced IDE secretion; 3-MA (1 mM) was administered to vehicle- or Ab-treated cells. (D) Quantitative analysis ofFig. 2C(ND 4 experiments). (E) Western blot analysis of IDE levels in the media from Atg5 knockdown primary astrocytes. Representative images are shown, and data are represented as mean§ SEM from 4 independent experiments (ND 4 experiments). (F) Western blot analysis of secreted IDE levels from astrocytes after the treatment with inhibitors and/or activators in the presence of Ab (1 mM for 24 h). Rap, rapamycin (2 mM for 6 h); MG, MG132 (5 mM for 6 h). Representative images are shown, and data are represented as mean § SEM from 3 independent experiments (ND 3 experiments). (G) 3D-SIM reconstruction images of IDE expression in the autophagosomes. The 3D-SIM image was taken in a z-direction with a thickness of 0.150mm, reconstructed into a 3D volume image. Scale bar represents 10 mm in the image with confocal microscopy. Low panels (a1, a2, and a3) show enlarged images using 3D-SIM. The b1 and b2 panels show lines offluorescence tracing from images in a3. (H) The Pearson colocalization coefficient for IDE and LC3. The Pearson coefficient was derived from 3 independent experiments with 3 fields per experiment, for a total of 9 fields contributing to the cumulative result., P< 0.05; and, P< 0.01 vs. vehicle-treated cells; #, P < 0.05; and ##, P < 0.01 vs. cells treated with Ab. n.s. indicates not significant.
Autophagicflux is important for Ab-induced IDE secretion To determine the effect of the autophagy-lysosomal pathway on Ab-induced IDE secretion, we investigated the change in lyso-somal function following treatment with Ab. When levels of ATP6V0A1 (ATPase, HC transporting, lysosomal V0 subunit a1) and the mature form of CTSD (cathepsin D) were analyzed by western blotting (WB), we found that treatment with 1mM Ab resulted in increased astrocytic expression of the mature form of CTSD (Fig. 3A). Dupont et al. (2011)13reported that
the secretion of IL1B, a substrate for autophagy-based secre-tion, was inhibited under conditions of lysosomal dysfuncsecre-tion, as induced by treatment with bafilomycin A1(Baf; an inhibitor
of vacuolar ATPase, which prevents lysosomal acidification and autophagosomal cargo degradation). To further examine the Ab-induced IDE secretory pathway, Baf was used to block fusion between the autophagosome and the lysosome. If IDE is a substrate for autophagy-lysosomal degradation, Baf may increase total IDE levels intracellularly and extracellularly. When a monomeric redfluorescent protein-green fluorescent protein (mRFP-GFP) tandem fluorescence-tagged LC3 (Tf-LC3) construct was transfected to U373MG cells, Baf treatment increased the yellow signal (produced by the mRFP-GFP fusion form), indicating that the fusion of autophagosomes with lyso-somes is blocked (Fig. 3B). Baf treatment decreased IDE secre-tion from astrocytes (Fig. 3C), suggesting that autophagicflux is important for IDE secretion and IDE is not a substrate for the autophagy-lysosomal pathway (Fig. 3C). In addition, by live-cell imaging, we observed that IDE colocalized with the autophagosome (MDC-positive) and lysosome (LysoTracker Red-positive), and that Ab accelerated the colocalization of IDE with the lysosome (Fig. S4A and B). To determine the involvement of lysosome function in Ab-induced IDE secre-tion, restoration of the lysosome function was challenged by PP242, a well-known ATP-competitive MTOR inhibitor that activates the lysosomal function.23 When PP242 was added together with Ab, the signal intensity of BODIPY FL pepstatin A, afluorescent probe for CTSD,24 increased (Fig. 3D and E), suggesting that PP242-induced lysosome activation in astro-cytes. PP242 restored IDE secretion, which was decreased by Baf treatment (Fig. 3F and G). Considered together, these data indicate that autophagicflux is important for Ab-induced IDE secretion.
The SlyX domain of IDE regulates IDE secretion by protecting degradation through the lysosome
Then, how can IDE protein escape from the lysosome without degradation? Previous studies demonstrate that the SlyX motif, a novel amino acid motif (853EKPPHY858) close to the C termi-nus of IDE, determines IDE secretion–and yet, the mechanism by which it does so remains elusive.25To examine whether the SlyX domain of IDE has a role in protection from lysosomal degradation, protein stability was measured with IDE wild type (IDE WT) or SlyX domain-deletion mutant (IDE DS)-trans-fected U373MG cells. When cycloheximide (CHX) was added into U373MG cells, IDE DS degraded faster than IDE WT
(Fig. 4A). Moreover, we found that following Ab treatment,
IDE DS levels in the cells decreased—this can be reversed by
inhibition of the lysosomes (Fig. 4B and C). Secretion of IDE DS decreased more than that of IDE WT under both basal and Ab treatment conditions (Fig. 4D and E). These data indicate that the SlyX domain of IDE regulates Ab-induced IDE secre-tion by preventing its lysosomal degradasecre-tion.
Ab-induced IDE secretion is mediated by RAB8A activity Several factors regulate the secretion of IDE. A previous study reports multiple roles of small GTPase RAB proteins in the secretory pathway.26 In particular, RAB8A is known as one of
the main regulators of membrane fusion and exocytosis.13,27To
determine whether RAB8A regulates IDE secretion from astro-cytes, we treated the Rab8a and Rab5 (as control) siRNA-trans-fected cells with Ab (Fig. 5Aand S5A). In Rab8a, but not Rab5, knockdown cells, IDE secretion was reduced significantly under Ab treatment conditions (Fig. 5A), suggesting that RAB8A was required for the enhanced IDE secretion caused by Ab treat-ment. To investigate the association of RAB8A protein with Ab-induced IDE secretion, the protein levels and the cellular localization of RAB8A were examined. When astrocytes were treated with Ab, the RAB8A protein level was unchanged (Fig. S5B). However, RAB8A protein clustered in the cytoplasm following Ab treatment (Fig. S5C). In this condition, RAB8A surprisingly colocalized with LC3-positive organelles, the auto-phagosomes (Fig. S5D). Furthermore, RAB8A dominant nega-tive (DN) construct (RAB8AS22N) inhibited Ab-induced IDE
secretion (Fig. 5B), indicating that RAB8A plays an important role in Ab-induced IDE secretion. Then, how does Ab affect RAB8A to modulate IDE secretion? Hooff et al. (2010) report that RAB prenylation, which is the addition of GGPP (geranyl-geranylpyrophosphate) to a RAB protein, is necessary to regu-late the activity of RAB proteins because RAB protein should be inserted into membranes to activate various biochemical pathways.28 Since Ab leads to the inhibition of prenylation in the neurons according to a previous study,29 we examined whether Ab regulates prenylation of RAB8A in astrocytes. When Ab was applied to astrocytes, unprenylated RAB8A was increased, and conversely, prenylated RAB8A was decreased (Fig. S5E). This effect was restored by GGPP treatment (Fig. S5E). In addition, Ab-induced IDE secretion was reduced by cotreatment with GGPP (Fig. 5C), suggesting that the increased unprenylation of RAB8A induced IDE secretion. To confirm these results, we established RAB8A prenylation-defi-cient mutant cells (RAB8AC204A) (Fig. S5F and G). When the prenylation-deficient mutant of RAB8A was expressed, IDE secretion increased over that in RAB8A wild type (WT)-expressing cells (Fig. 5D). These data indicate that IDE secre-tion is mediated by RAB8A activity, and that Ab increases IDE secretion from astrocytes by the inhibition of RAB8A prenylation.
GORASP regulates Ab-induced IDE secretion by regulating autophagy
Since previous studies have reported that GORASP proteins control unconventional secretion of Acb1 in yeast and IL1B in macrophages,13,30,31 we examined whether GORASP (GOR-ASP1 and GORASP2 in mammals) regulate Ab-induced IDE
Figure 3.Autophagicflux is important for Ab-induced IDE secretion. (A) Change in lysosomal proteins in primary astrocytes following treatment with Ab (1 mM for 24 h). FL, full-length; m, mature form; CTSD, cathepsin D. CANX is a loading control for the membrane fraction. Representative images are shown, and data are represented as mean§ SEM from 3 independent experiments (N D 3 experiments). (B) Determination of autophagic flux using the Tf-LC3 construct. U373MG cells were preincubated with or without 10 nM Baf for 2 h, then exposed to 1mM Ab for 24 h. Cells were treated with rapamycin (Rap) for 6 h. The mRFP-positive dots indicate only mRFP-LC3 sig-nals (autolysosome), and the yellow signal indicates colocalization of GFP and mRFP sigsig-nals (defects in autophagic maturation). Scale bar represents 10mm. Values repre-sent the number of positive dots for red signals and yellow signals, and are mean§ SEM of 50 different cells in each independent experiment (N D 3). (C) Western blot analysis of IDE secretion after treatment with the lysosome inhibitor, Baf. L.E. indicates long exposure. (D) Lysosomal activity was determined with LysoTracker Red probe or BODIPY-FL-Pepstatin probe (for detection of active CTSD). The white arrows represent active CTSD signals, and Ab-induced lysosomal clustering. Scale bar represents 10mm. (E) Quantitative analysis ofFig. 3D(ND 3 experiments). (F) Secreted IDE levels under the lysosome-modulating conditions (Baf, PP242 or Baf C PP242). Baf (10 nM for 2 h), PP242 (5mM for 2 h) (G) Quantitative analysis ofFig. 3F(ND 3 experiments). B, Baf; P, PP242., P< 0.05;, P< 0.01; and, P< 0.001 vs. vehicle-treated cells; #, P< 0.05; ##, P < 0.01; and ###, P < 0.001 vs. cells treated with Ab; x, P < 0.05; and xx, P < 0.01 vs. cells treated with Ab C Baf; &&, P < 0.01 vs. cells treated with Baf.
secretion. Double knockdown of Gorasp1 and Gorasp2 inhib-ited IDE secretion from astrocytes (Fig. 5E). To determine if any particular GORASP is required for IDE secretion, siRNA for Gorasp1 or Gorasp2 was transfected into astrocytes. Both GORASP1 and GORASP2 reduced Ab-induced IDE secretion, indicating that both are important for IDE secretion (Fig. S6A and B). To examine how the GORASP protein regulates IDE secretion, involvement of autophagy was examined because previous studies reported that GORASP2 controls autophagy initiation in macrophages.13When the effect of knockdown of Gorasp1 and Gorasp2 in astrocytes was examined, the LC3-II level was reduced, and the SQSTM1 (sequestosome 1) level increased in the Gorasp1, 2 double-knockdown astrocytes
(Fig. 5F). In addition, when the Tf-LC3 construct was
trans-fected to scrambled siRNA- or Gorasp1, 2 siRNA-transtrans-fected cells, Gorasp1, 2 double-knockdown cells showed decreased
mRFP and yellow dot numbers with Ab and/or Baf treatments (Fig. S6C and D). When the autophagy inducers such as rapa-mycin were applied to Gorasp1, 2 double-knockdown cells, we found that Gorasp1, 2 double-knockdown cells showed decreased LC3-II levels compared to scrambled siRNA-trans-fected cells (Fig. S6E). These data indicate that GORASP regu-lates IDE secretion by modulating autophagy.
Autophagy-insufficient mouse brains show decreased IDE levels in the CSF, with Ab-injection
The above in vitro data showed increased IDE secretion from Ab-treated astrocytes, mediated by an autophagy-based uncon-ventional secretory pathway. Consistent with the in vitro data, we examined whether Ab-induced IDE secretion occurs via the autophagy-based secretory pathway in vivo using mice with
Figure 4.The SlyX domain of IDE regulates IDE degradation through lysosomes. (A) Protein stability in IDE wild-type (IDE WT) and SlyX domain-deletion mutant (IDE DS)-transfected U373MG cells after cycloheximide (CHX) treatment., P< 0.01 vs. IDE protein levels immediately (0 h) after CHX treatment. (B) The increased degradation of IDEDS through lysosomes in the Ab treatment (1 mM for 24 h). Baf (10 nM for 2 h). (C) Quantitative analysis ofFig. 4B(ND 3 experiments)., P< 0.01 vs. vehicle-treated, IDEDS-GFP-transfected cells; ##, P < 0.01 vs. IDE DS-GFP-transfected cells treated with Ab. (D) The reduced secretion of IDE DS compared to IDE WT protein. (E) Quantitative analysis ofFig. 4D(ND 3 experiments)., P< 0.05; and, P< 0.01 vs. vehicle-treated cells; #, P < 0.05; and ##, P < 0.01 vs. cells treated with Ab; &, P < 0.05 vs. IDE WT-GFP-transfected cells, treated with Ab.
global haploinsufficiency of an essential autophagy gene (Atg7C/
¡mice). The brains from Atg7C/¡ mice showed reduced Atg7
mRNA and protein levels (Fig. 6A and B), decreased LC3-II lev-els, and increased SQSTM1 levlev-els, a substrates for autophagic protein degradation, as previously reported (Fig. 6B and C).32
With the i.c.v. injection of Ab into the 2- to 3-mo-old- Atg7C/C and Atg7C/¡mice for 2 wk, increased autophagy (represented by an increase in LC3-II levels) in the brains of Atg7C/C mice, but not Atg7C/¡mice were detected (Fig. 6B and C). IDE levels (and activity) were detected in the CSF because CSF has more physical
Figure 5.Ab-induced IDE secretion is mediated by RAB8A activity and GORASP. (A) WB analysis of secreted IDE levels in the media from Rab5 or Rab8a knockdown pri-mary astrocytes under treatment with Ab or vehicle. Representative images are shown, and data are represented as mean § SEM from 3 independent experiments (N D 3 experiments). (B) Association of Ab-induced IDE secretion with RAB8A activity in primary astrocytes. RAB8A DN indicates a dominant-negative mutant form of RAB8A (RAB8AS22N) (ND 3). (C) Effect of prenylated proteins on Ab-induced IDE secretion (1 mM for 24 h). (D) Effect of RAB8A on Ab-induced IDE secretion, with a RAB8A preny-lation-deficient mutant. Ab (1 mM) treatment was applied to RAB8A WT or RAB8AC204A-transfected astrocytes for 24 h (ND 3). (E) WB analysis of IDE secretion from Atg5
knockdown and Gorasp (Gorasp1 and Gorasp2) double-knockdown astrocytes. Ab (1 mM for 24 h); Baf (10 nM for 2 h) (N D 4). (F) Inhibition of autophagy in Gorasp1,2 double-knockdown astrocytes (ND 3). GOLGA2 was used as a marker for Golgi apparatus., P< 0.05; and, P< 0.01 vs. vehicle-treated cells; #, P < 0.05; ##, P < 0.01; and ###, P< 0.001 vs. cells treated with Ab.
contact with the brain than any otherfluid. By ELISA and enzy-matic activity assay for IDE in the CSF, Ab-injected Atg7C/¡ mice showed a significant reduction in the IDE level and activity as compared to Atg7C/Cmice (Fig. 6D and E). These data suggest that Ab-induced IDE secretion is mediated by autophagy in vivo. IDE activity is inversely correlated with age in AD mice Previous studies have demonstrated accumulated autophagy in AD brains, and suggested that dysregulated autophagy regulates the progression of AD.17,33Because IDE secretion is associated with Ab-induced autophagy from the aforementioned data, the regulation of IDE secretion in Tg6799 mice, an AD mouse model,20 was examined. Since the Tg6799 mice are known to overexpress Ab, have amyloid plaque deposition in the subicu-lum at 2 mo of age, and exhibit reduced synaptic markers, neu-ronal loss, and memory impairment at 6 mo of age,20
1.5-mo-old (before plaque formation) and 7-mo-1.5-mo-old (after plaque for-mation) Tg6799 mice were used in this study. Both 1.5-mo-old (young) and 7-mo-old (old) Tg6799 mice showed increased Ab and autophagy levels (Fig. 7A), but only the old Tg6799 mice
showed defects in the lysosomes (decreased ATP6V0A1 and CTSD mature form) (Fig. 7A). Electron microscopy analysis showed increased AVs in the old Tg6799 mice (Fig. S7A). To examine the secreted IDE levels, ELISA and enzymatic activity assays for the IDE protein were performed on the CSF from the Tg6799 mice and littermate control mice. IDE activity and protein levels increased in the CSF of the young Tg6799 mice, however, the old Tg6799 mice showed decreased IDE activity and levels in the CSF (Fig. 7B and C). Based onFigure 3in this study, IDE secretion is increased when the lysosomal function is intact to form autolysosomes in the young Tg6799 mice
(Fig. 7A). As the lysosomal function is defective in the old
Tg6799 mice (Fig. 7A), autophagic flux is inhibited, and Ab-induced IDE secretion is reduced, followed by accumulation of Ab and AVs in the brain (Fig. S7A).
Decreased enzymatic activity of IDE in the CSF of patients with AD
Since previous reports show accumulated autophagosomes and dysfunction in lysosomes in the AD-afflicted brain,33,34 IDE
Figure 6.Autophagy-insufficient mouse brains show decreased IDE levels in the CSF under Ab-injection conditions. (A) The analysis of Atg7 mRNA level by qPCR in the cortex and hippocampus of vehicle-injected Atg7C/Cand Atg7C/¡mice (2- to 3-mo-old, ND 6 each group)., P< 0.01;, P< 0.001 vs. vehicle-injected Atg7C/Cmice. (B) WB analysis of LC3, SQSTM1, or ATG7 expression in vehicle or Ab-injected Atg7C/Cand Atg7C/¡mice. DDIT3 was used to measure the level of ER stress. (C) Quantita-tive analysis ofFig. 6B. (D) IDE enzymatic activities in the CSF of vehicle or Ab-injected Atg7C/Cand Atg7C/¡mice. (E) Results of quantification of IDE levels detected with ELISA in the CSF of vehicle or Ab-injected Atg7C/Cand Atg7C/¡mice. (ND 6 each group), P< 0.05;, P< 0.01;, P< 0.001 vs. vehicle-injected Atg7C/Cmice; #,
activity and levels in the CSF of patients with AD were mea-sured. When the IDE activity and levels in the CSF from AD patients (Table S1A and B) were measured, both activity and levels of IDE decreased in the CSF of AD patients (Fig. 8A and E). These results showed a significant positive correlation with MMSE scores (Fig. 8B and F), and, although not significant, a negative correlation tendency with CDR in the AD groups
(Fig. 8C and G). There was no difference between genders
(Fig. 8D and H). These results indicate that AD patients have
reduced IDE protein levels and decreased enzymatic activity of the same, in their CSF, and that these correlate with cognitive impairment.
Discussion
In this study, we found that IDE secretion from astrocytes under conditions of AD pathology is regulated by autophagy
(Fig. 8I). IDE is well known as a major protease for
Ab degradation, and the regulation of functional IDE secre-tion is important in AD progression. Prior to our work, it was known that, as IDE has no signal sequences, it is secreted from the microglia via an exosome-associated unconventional secretory pathway under statin treatment.35 To determine whether Ab-induced IDE secretion is associated with exo-somes in astrocytes, both exoexo-somes and nonexosome fractions
were isolated from vehicle- or Ab-treated ACM. Ab increased the IDE secretion both in the exosomes and nonexosome frac-tions (Fig. S8A and B), indicating that the secretory pathway for IDE is mediated by both exosome- and nonexosome- asso-ciated pathways. Next, to determine whether Ab-induced IDE secretion is caused by cell death, cell death assays were per-formed. 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) and calcein-AM assays were performed (Fig. S9A and B). We found that treatment with 1 or 2mM of Ab for 24 h did not induce cell death in astrocytes. The mito-chondrial uncoupling agent, CCCP, induced cell death as indi-cated by a positive control cell death assay. To confirm this result, TdT-mediated dUTP nick-end labeling (TUNEL) assay was performed (Fig. S9C). Consistent with the results of MTT and calcein-AM assay, Ab did not induce cell death in this study. These results indicate that Ab-induced IDE secretion is not caused by cell death. We examined the mechanisms underlying IDE secretion, especially under AD conditions, and found that Ab increased functional IDE secretion in a time- and dose-dependent manner, and that this Ab-induced IDE secretion was blocked by autophagy inhibition. Because a fundamental role of autophagy is the clearance of protein aggregates and pathogens, we investigated whether IDE secre-tion is regulated by the autophagy-lysosome pathway. When lysosomes were disrupted by the lysosomal inhibitor Baf, IDE
Figure 7.IDE activity is inversely correlated with age in AD mice. (A) Lysosomal dysfunction in the brain of the 7-mo-old Tg6799 mice (old Tg), and in 1.5-mo-old Tg6799 (young Tg) mice. LT, age matched littermate controls; Tg, Tg6799; CTSD, cathepsin D. CANX is a loading control for the membrane fraction of the brain tissue, and GAPDH is a loading control for the total lysates. (B) IDE enzymatic activities in the CSF of 1.5-mo-old and 7-mo-old Tg6799 mice (and littermate controls). (C) Results of quanti fica-tion of IDE levels detected with ELISA in the CSF of LT and Tg mice. Values are mean§ SEM, P< 0.05; and, P< 0.01 vs. young LT; #, P < 0.05; and ##, P < 0.01 vs. old LT. RFU, relativefluorescence unit.
secretion was blocked, and inversely, cotreatment with a lyso-some activator, PP242, restored IDE secretion. These data indicate that autophagic flux is important for IDE secretion. From our in vivo data using AD-model mice, we found that the IDE activity and levels increased in the CSF of the young (1.5-mo-old) Tg6799 mice, while the old (7-mo-old) Tg6799 mice showed decreased IDE activity and protein levels in the CSF. These were consistent with the in vitro data because the old Tg6799 mice brains showed lysosomal dysfunction (decreased ATP6V0A1 and matured form of CTSD levels or increased AVs shown in EM images based on previous stud-ies) (Fig. 7; Fig. S7).36 In addition, patients with AD showed decreased IDE activity and levels in the CSF, and this reduc-tion is correlated with cognitive impairment (Fig. 8). These data suggest that because the defect in the lysosome is a causa-tive risk factor for AD, modulation of the lysosomal activity
may serve as a novel therapeutic target in AD treatment by regulating IDE secretion.
It is surprising that IDE can be secreted from astrocytes via the autophagy-lysosome pathway. How can IDE proteins escape the acidic and harsh environment of the lysosome without degra-dation? The lysosomal lumen contains approximately 60 differ-ent soluble hydrolases, which are active in the acidic environment of the lumen (pH 4.5–5.0).37
Many lysosomal pro-teins, such as lysosomal-associated membrane protein 1 (LAMP1) and cathepsins, are protected from lysosomal degrada-tion by post-transladegrada-tional modificadegrada-tions such as mannose-6-phosphate tagging or hyper-glycosylation. Since IDE does not have these modification sites, we investigated mechanisms other than lysosomal degradation. We found that the SlyX domain (EKPPHY) of IDE contributes to the Ab-induced IDE secretion by preventing its lysosomal degradation (Fig. 4), although the
Figure 8.Decreased enzymatic activity and protein levels of IDE in the CSF of patients with AD. (A) IDE enzymatic activities in the CSF of control subjects and patients with AD (ND 10 in each group). RFU, relative fluorescence unit. (B) IDE activity data from the CSF show a correlation with the MMSE score (r D 0.4657, P value D 0.0385). (C) IDE activities in the CSF of AD patients show a tendency of negative correlation with AD group CDR scores (rD ¡0.0809, P D 0.4120). (D) Gender difference in IDE enzy-matic activities. (E) IDE expression levels in the CSF of control subjects and patients with AD (ND 10 in each group). (F) The levels of IDE proteins in the CSF correlate with the MMSE score (rD 0.5155, P value D 0.0200). (G) Like IDE activity, IDE protein levels in the CSF of AD patients show a negative correlation with CDR scores calcu-lated in the AD groups (rD ¡0.4042, P D 0.2467). (H) Gender difference in IDE levels in the CSF. Values are mean § SEM, P< 0.05;, P< 0.01. ‘n.s.’ means not signifi-cant. (I) Schematic diagram of this study. Ab increases IDE secretion from astrocytes via an autophagy-based unconventional secretory pathway, and Ab-induced IDE secretion depends on the activity of RAB8A and GORASP. In the AD brain, lysosomal dysfunction occurs and, as a result, Ab-induced IDE secretion is inhibited because autophagicflux is important for IDE secretion. Reduced IDE levels may result in increased levels of extracellular Ab and contribute to the progression of AD pathogenesis.
mechanism by which it does so is not yet known. Indeed, the SlyX domain is present in other proteins (HS3ST/heparan sulfate proteoglycans and PLSCR1 [phospholipid scramblase 1]), and these proteins are reportedly secreted via the unconventional secretory pathways.38,39We will, in a future study, try to identify the binding partner on the SlyX domain of IDE, and establish whether such a structure may confer a protective effect to IDE during lysosomal degradation. In this study, we found that IDE might be a substrate for the proteasome. Treatment with MG132, a proteasome inhibitor, increased both intracellular and extracellular IDE levels, as well as LC3-II levels (Fig. S3A and B). An association between the proteasome and autophagy has been noted in previous studies,40 and we further found that MG132 treatment increased LC3-II levels in astrocytes. These results sug-gest that MG132 treatment increased IDE secretion both by increasing IDE protein levels and by autophagy induction. In a future study, we will check whether MG132 regulates key pro-teins of secretory autophagy (such as RAB8A or GORASP), as well as total autophagy levels. Results of this study have shown that application of 1 mM Ab reduces proteasome activity by approximately 20% (data now shown) and activates autophagy in astrocytes; thus, IDE may escape degradation by the protea-some and autophagic secretion from astrocytes treated with Ab.
What are the regulatory factors for the autophagy-based secretion of IDE? We focused on the RAB proteins because they play multiple roles in the secretory pathway.26 According
to our data, among the RAB proteins, RAB8A was important for IDE secretion. Specifically, IDE secretion was mediated by RAB8A activity, and Ab increased IDE secretion from astro-cytes by the inhibition of RAB8A prenylation. Although it is indirect evidence, previous studies have shown that statin treat-ment increases IDE secretion, and inhibits protein prenyla-tion.35,41 Whether IDE secretion by statin treatment occurs through same pathway as Ab treatment should be investigated. Further, how IDE inside the lysosome is transported to the extracellular medium needs to be determined. Previous studies reported the topological inversion properties of autophagy, fer-rying molecules from the cytosol to the lumen of secretory vesicles, however, this wanes quickly with time.42,43In addition,
the core secretory machinery for vesicle exocytosis consists of SNAREs (N-ethylmaleimide-sensitive factor attachment pro-tein receptors) and sec1/STXBP/Munc18-like propro-teins.44 The
marker protein of secretory lysosomes as the major vesicular compartment for Ca2C-regulated exocytosis from astrocytes45is VAMP7/TI-VAMP (vesicle associated membrane protein 7).46 Verderio et al. (2012)47 report that VAMP7 is the SNARE of secretory lysosomes contributing to ATP secretion from astro-cytes. Considering that ATP is a cytosolic protein, which can be secreted from astrocytes following Ab treatment,48
and that ATP is known as a protein secreted via an autophagy-based unconventional secretory pathway,49VAMP7 might play a role as a regulatory factor for Ab-induced autophagy-based secre-tion of IDE. In a future study, we will investigate the effect of possible regulatory factors on IDE secretion from astrocytes.
Astrocytes play a critical role in maintaining neuronal homeostasis by providing energy, eliminating waste, and regu-lating ionicflux.50Furthermore, astrocytes are well-positioned both metabolically and anatomically to play an important homeostatic role under basal conditions, as well as in
pathological conditions such as AD. Astrocytes are activated to degrade Ab at an early stage of AD. For the removal of extracel-lular Ab, astrocytes take up Ab bound to membrane receptors via endocytosis,51and degrade Ab in the lysosomes. In a recent study, enhancing astrocytic lysosome biogenesis facilitates Ab clearance, and attenuates AD pathogenesis.52Our results sug-gest another mechanism for the blockade of Ab toxicity by astrocytes. In other words, we found that Ab could be degraded by inducing IDE secretion from astrocytes via autophagy-based secretory pathway under AD conditions. In previous studies, IDE is expressed in several cell types in brain such as neurons and endothelial cells as well as astrocytes,53,54 however,
Dorfman et al.4show that astrocytes are the main cell types for IDE in AD pathology. In addition, when neurons, astrocytes or endothelial cells were treated with Ab, we found that only astrocytes increased IDE secretion (Fig. S10). For detection of secreted IDE in vivo, we used the CSF of humans and mice as previously described.55 CSF is a translucent body fluid that occupies the subarachnoid space and the ventricular system around the brain.56 CSF protects the brain by providing mechanical and immunological defense. CSF can be obtained via a lumbar puncture, and is probably the most informative biomarker for the prognosis of neurodegenerative diseases. As a result, proteins or peptides that may be directly reflective of brain-specific activities, as well as of disease pathology, would most likely diffuse into the CSF, rather than into any other bodilyfluid. These proteins and metabolites can serve as excel-lent biomarkers of AD as well as other neurodegenerative diseases.56
The regulation of Ab levels is of great interest for its thera-peutic potential in AD. Apart from the interference with Ab generation, a promising alternative may be the enhancement of Ab degradation by targeting Ab-degrading enzymes.57
Many reports highlight the impact of decreased Ab clearance from the central nervous system in late-onset AD.58Thus, regulating autophagy-based secretion of IDE by modulating lysosomal activity in astrocytes may lead to new therapeutic approaches for sporadic AD.
Materials and methods Study participants
The subject population for this study included patients from the Soonchunhyang University Bucheon Hospital, South Korea, with a diagnosis of probable AD along with healthy controls. Participants were diagnosed by National Institute of Neurologi-cal and Communicative Disorders and Stroke–Alzheimer Dis-ease and Related Disorders Association criteria and CDR of 0.5 (mild AD)– 3.0 (severe AD). Clinical evaluation included med-ical history, physmed-ical examination, MMSE, and CDR. All those with available biochemical measures were included in the study, resulting in 10 subjects with AD and 10 healthy controls (IRB No. SCHBC_IRB_2012-124) (Table S1A and B).
CSF preparation
For preparation of the CSF samples from AD and control sub-jects, CSF was obtained through lumbar punctures, which were
performed between 8 and 10 a.m. subsequent to an overnight fast. After collection of 5 mL in a polypropylene tube, the CSF was centrifuged, and aliquoted into 1.0-mL polypropylene tubes. The tubes were stored at -80C until analysis was per-formed. Isolation of the CSF from mice was performed as described previously.59
Animals
The Tg6799 mice (formerly JAX Stock No. 008730) overexpress the mutant human APP (amyloid b precursor protein) form with the Swedish (K670N, M671L), Florida (I716V), and London (V717I) familial AD (FAD) mutations, and human PS1 harboring 2 FAD mutations, M146L and L286V.20 Non-transgenic littermate controls (B6SJL) were used for the experi-ments. All mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA), and the animals were treated and maintained in the Seoul National University’s mouse facility. Atg7C/¡and Atg7C/Cmice (N D 12 each group) were kindly provided by Dr. Myung-Shik Lee (Sungkyunkwan University School of Medicine, Korea).32Ab or phosphate-buffered saline (PBS) was administered via i.c.v. injections into 2- to 3-mo-old-Atg7C/¡ and Atg7C/C mice as previously described with some modification.60 Briefly, the mice received a single i.c.v.
injection into the lateral ventricles using a Hamilton syringe (Fisher Scientific Co, Pittsburgh, Pennsylvania, USA) 2 weeks before the experiments were performed, while being secured in a stereotactic apparatus (Harvard Apparatus, Holliston, MA). The coordinates according to bregma were ¡0.9 mm lateral, ¡0.1 mm posterior, and ¡3.1 mm below. All experi-ments involving animals were performed according to proto-cols approved by the Seoul National University Institutional Animal Care and Use Committee (SNU IACUC) guidelines. Cell cultures, drug treatments, and transfection
The human astroglioma U373MG cells (ATCC, HTB-17), human neuroblastoma SH-SY5Y cells (ATCC, CRL-2266) and mouse brain endothelial cell line BEND3 (ATCC, CRL-2299) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich, D6546) containing 10% fetal bovine serum (FBS), 0.1 mg/mL penicillin/streptomycin and 2 mM L-gluta-mine (Sigma-Aldrich, G7513) at 37C under humidified 5% CO2air. The U373MG cells (5£ 105cells) were plated onto
6-well plates. Primary neurons were prepared from E18 ICR mouse embryos, and primary astrocytes were prepared from newborn (P1) ICR mice as described previously.48 Astrocytes underwent 2 passages for the experiments. Cells were treated with several reagents alone, or cotreated with Ab followed by a 24 h incubation. The reagents used in this study were the fol-lowing: thiorphan (T6031), bacitracin A (B0125), insulin (I2643), 3MA (M9281), MG132 (M7449), GGPP (G6025), PP242 (P0037), bafilomycin A1/Baf (B1793), chloroquine
(C6628) from Sigma-Aldrich; and rapamycin (LC Laboratories, R-5000). The cDNAs in this study were purchased from Ori-gene (IDE-GFP; RG220700) or AddOri-gene (24898 for Rab8a; 24899 for Rab8aS22N) and the siRNAs were purchased from Bioneer Inc. (Daejeon, Korea). cDNA and siRNA were trans-fected into the cells using Lipofectamine 2000 (11668027) and
RNAimax (13778) from Invitrogen according to the manufac-turer’s instructions or by electroporation (ECM 830 Square Wave Electroporation System, Harvard Apparatus).
Western blot analysis
Harvested cell pellets and mouse brain lysates were prepared as described elsewhere.61 The antibodies for the western blot analysis were: anti-LC3B antibody (1:2,000; MBL, M152-3; and Cell Signaling Technology, 2775); anti-Beta-amyloid (Ab) 1-16 (6E10) antibody (1:5000; Biolegend, 803016); RAB8A (6975), ATG5 (12994), ATG7 (8558), anti-CANX (calnexin) (2433), anti-p-PRKAA1/2 (T172) (2535), anti-PRKAA1/2 (2532), anti-p-RPS6KB (T389) (9205) and RPS6KB (2708) (1:2000, Cell Signaling Technology); DDIT3 (DNA damage-inducible transcript 3) (sc-575), anti-MMP9 (sc-6840), anti-GORASP2 (sc-271840), anti-GORASP1 (sc-19481), anti-ATP6V0A1 (sc-28801), anti-CTSD (sc-6486), anti-RAB5A (sc-309) and anti-GFP antibody (sc-9996) (1:1,000; Santa Cruz Biotechnologies Inc.); anti-IDE (ab32216), GAPDH (ab9485), TSG101 (ab83), anti-LAMP1 (ab25245), and anti-HMGB1 antibody (ab18256) (1:2,000; Abcam); anti-GOLGA2 (golgin A2) (1:4,000; BD Bio-Science, 610822); anti-SQSTM1 (P0067), and anti-ACTB (actin, beta) (A1978) (1:4,000; Sigma-Aldrich). Immunoreac-tivity was determined by chemiluminescence (GE Healthcare, RPN2108). The chemiluminescence signal was detected with a digital image analyzer (LAS-3000; Fuji, Tokyo, Japan).
Preparation and quantification of Ab
Ab was prepared as previously described.17 Most of the Ab
used exists as oligomers and some monomers. For quantifica-tion of Ab, sandwich enzyme-linked immunosorbent assay (ELISA) was performed as described for Ab quantification.61
Ab degradation assays
Ab degradation assays were performed as previously described, with some modification.35 Briefly, primary astrocytes or
U373MG cells grown in a 6-well plate to 70% confluency were incubated with Ab42 or DMSO (vehicle) for 24 h. After PBS
(Sigma-Aldrich, P4417) washing, cells were incubated for an additional 6 h in serum-free OPTI-MEM (GIBCO, 31985-070). The supernatant fraction (vehicle- or Ab-ACM) was then col-lected after centrifugation and incubated with 1 mM Ab for 12 h at 37C in the absence or presence of 10mg/mL bacitracin A, 0.3 ng/mL recombinant IDE (rIDE) (R&D Systems, 31985-070), or 0.5mM insulin. The remaining Ab levels were quanti-fied by western blot analysis with 6E10 antibody, which can detect both Ab40and Ab42peptides.
Trichloroacetic acid (TCA) precipitation
For analyzing protein in the medium, we performed TCA pre-cipitation as previously described.61 Briefly, cell medium was centrifuged at 5,000 rpm for 5 min to remove cell debris and subjected to TCA precipitation (up to 10%) (Sigma-Aldrich,
T6399). By TCA precipitation with media, 40X concentrated samples were loaded on the SDS-PAGE gels.
IDE enzymatic activity assay and IDE level measurement The IDE enzymatic activity in the CSF or media was deter-mined per the manufacturer’s protocol (Calbiochem, CBA079). Briefly, 5 mL of the CSF from mouse and 50 mL of the CSF from human were diluted with PBS, and loaded into in a 96-well plate, which contained an affinity-purified polyclonal anti-body that recognizes IDE (Calbiochem, CBA079). Following 1-h incubation, substrate was added and incubated for 2 to 4 h at 37C in the dark. The fluorescence was measured using an excitation wavelength of 320 nm and an emission wavelength of 405 nm. The relativefluorescence unit represents total IDE activity in the media or CSF without normalizing to IDE pro-tein levels. Cell media were concentrated with Amicon Ultra fil-ter (UFC510024, Millipore, Billerica, MA). To defil-termine the protein level of IDE in the media and CSF, ELISA was per-formed according to the manufacturer’s protocol (Mybio-source, MBS018913 and MBS725082).
Partial purification of lysosomes
Partial isolation of lysosomes was performed as previously described.62 Briefly, cells were resuspended in a hypotonic
buffer (10 mM KCl, 30 mM Tris, pH 7.5, 5 mM MgOAc, 1 mM b-mercaptoethanol) and dissociated by piston strokes. Homo-genates were centrifuged at 1,000 X g to precipitate the nuclei, then the supernatant fractions were collected and centrifuged at 100,000 X g for 1 h at 4C.
Measurement of lysosomal activity
The lysosomal activity was determined as per the manufac-turer’s protocol (pepstatin A-BODIPY-conjugate [Molecular Probes, P12271] and LysoTracker Red [Molecular Probes, L7528]).
Isolation and characterization of exosomes
Exosomes and nonexosome fractions in the media from astro-cytes were prepared as described earlier.63
Cell viability assay
To measure cell viability, we performed MTT, calcein-AM and TUNEL assays (Promega, G7130) as previously described.64To analyze the TUNEL assay results, similar cell numbers from each group were analyzed (nD 300). Data are represented as the mean§ SEM from 3 independent experiments (N D 3).
Separation of prenylated and unprenylated RAB protein RAB protein prenylation was examined by extraction of preny-lated proteins with Triton X-114 (Sigma-Aldrich, X114) as pre-viously described.29
Examination of LC3-II translocation
To analyze green fluorescent protein (GFP)-LC3, red fluores-cent protein (RFP)-LC3, and tandem-fluorescence LC3 (Tf-LC3), plasmids encoding GFP-LC3, RFP-LC3, and Tf-LC3 (a gift of Dr. Lee, Sungkyunkwan University, Korea) were transfected into astrocytes. The appearance of RFP-LC3 and GFP-LC3 puncta was visualized on a confocal laser-scanning microscope (FV10i-w; Olympus, Tokyo, Japan).
RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was extracted from astrocytes treated with vehicle or Ab using TRIzol reagent (Life Technologies, 15596-026). The following sense and antisense primers were used for mouse Ide: 5- TCTCCTTCCAAGTCAGCTGGT -3 (sense), 5- TTGG AAGGCCTCTTCTGTCAT -3 (antisense).
Quantitative real-time PCR (qPCR)
To examine the levels of mouse Ide mRNA, qPCR was performed as previously described.64The following sense and antisense pri-mers were used: 50-TACCTCCGCTTGCTGATGACTG-30 (sense), 50-ACAGGAGCTGAGGTATGAAGGC-30 (antisense) for Ide; 50-ACAGCCGCATCTTCTTGTGCAGTG-30(sense), 50 -GGCCTTGACTGTGCCGTTGAATTT -30(antisense) for Gapdh.
3D-SIM (super resolution structured illumination microscopy)
To check the colocalization of IDE and autophagosomes, we used the super-resolution structured illumination microscopy (SIM; Nikon N-SIM). 3D-SIM images were taken for eachfixed cell by moving the stage in the z-direction with a step size of 0.150 mm. The sequential z-sections were reconstructed to a 3D-SIM image (z-axis; brain slice thickness »5.0 § 0.4 mm) and the 3D-deconvolution with thea blending function using NIS-E software (Nikon, Tokyo, Japan) was created. Images were taken by an Eclipse Ti-E research inverted microscope (Nikon, Tokyo, Japan) with Nikon’s CFI Apo TIRF 100£ oil objective lens (NA 1.49) and iXon DU-897 EMCCD camera (Andor Technology, Tokyo, Japan) at 512£ 512 pixel resolu-tion. Multicolorfluorescence was acquired using a diode laser (488 nm, 561 nm) and exposure times of 40 ms, electron micro-scopic (EM) gain of 150, conversion gain of 1£ were applied. The image was processed with NIS-E software and later exported to the Adobe Photoshop program.
Immunostaining
Immunocytochemical staining was performed as described pre-viously.21 Briefly, the fixed cells were incubated with mouse anti-IDE (1:300) or anti-LC3B (1:300) or anti-RAB8A (1:300) primary antibodies in PBST (PBS with 0.2% Triton X-100 [Sigma-Aldrich, T8787]) buffer overnight at 4C. After several washes, the cells were incubated with secondary antibody, and images were taken on a confocal laser scanning microscope (FV10i-w).
Electron microscopy (EM)
Brain tissues of Tg6799 mice and the littermate control mice werefixed overnight in a mixture of cold 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) and 2% paraformaldehyde in 0.1 M phosphate or cacodylate buffer (pH 7.2) and embed-ded with epoxy resin. The epoxy resin-mixed samples were loaded into capsules and polymerized at 38C for 12 h and 60C for 48 h. Thin sections were sliced on an ultramicrotome (RMC MT-XL; RMC Products, Tucson, AZ, USA) and col-lected on a copper grid. Appropriate areas for thin sectioning were cut at 65 nm and stained with saturated 4% uranyl acetate and 4% lead citrate before examination on a transmission elec-tron microscope (JEM-1400; JEOL, Tokyo, Japan) at 80 kV.
Data analysis and statistics
For western blots, protein levels were normalized to pan forms or a housekeeping protein, such as ACTB or GAPDH. All data were expressed as means§ standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism5 (San Diego, CA, USA). The Student t test was used for 2-group com-parisons, and one-way analysis of variance (ANOVA) followed by the Tukey-Kramer multiple comparison test was used to compare 3 or more groups. P values of< 0.05 were considered statistically significant.
Abbreviations
3-MA 3-methyladenine AD Alzheimer disease Ab amyloid beta
AMPK AMP-activated protein kinase APP amyloid beta precursor protein ATG autophagy related
AVs autophagic vacuoles
ATP6V0A1 ATPase, HC transporting, lysosomal V0 sub-unit a1
ACM astrocyte-conditioned media ACTB actin, beta
BBB blood brain barrier BFA brefeldin A Baf bafilomycin A1
CANX calnexin;
CSF cerebrospinalfluid CDR clinical dementia rating
CQ chloroquine
CHX cycloheximide CTSD cathepsin D
DDIT3 DNA damage inducible transcript 3 DMEM Dulbecco’s modified Eagle’s medium ELISA enzyme-linked immunosorbent assay EM electron microscopy
FBS fetal bovine serum
GORASP Golgi reassembly stacking protein GGPP geranylgeranylpyrophosphate
GORASP KD GORASP1 and GORASP2 double-knockdown
cell
GAPDH, glyceraldehyde-3-phosphate dehydrogenase
GOLGA2 golgin A2
HMGB1 high mobility group box 1 IDE insulin-degrading enzyme i.c.v. intracerebroventricular IL1B interleukin 1, beta IL18 interleukin 18
LC3A/B microtubule associated protein 1 light chain 3 alpha/beta
LRP1 LDL receptor related protein 1
MTOR mechanistic target of rapamycin (serine/threo-nine kinase)
MMSE mini-mental state examination MMP9 matrix metalloproteinase 9 MDC monodansylcadaverine PBS phosphate-buffered saline
RPS6KB ribosomal protein S6 kinase 70kDa
RT-PCR reverse transcription polymerase chain reaction qPCR quantitative real-time PCR
SIM super-resolution structured illumination microscopy
SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
Tf-LC3 monomeric RFP (mRFP)-GFP tandem fluores-cence tagged LC3
TCA trichloroacetic acid TSG101 tumor susceptibility 101 VWF von Willebrand factor WB western blotting
Disclosure of potential conflicts of interest
No potential conflicts of interest were disclosed.
Funding
This work was supported by grants from the NRF
(2015R1A2A1A05001794, 2014M3C7A1046047, 2015M3C7A1028790) and MRC (2012R1A5A2A44671346) for I.M-J.
References
[1] Walsh DM, Selkoe DJ. Deciphering the molecular basis of memory failure in Alzheimer’s disease. Neuron 2004; 44:181-93; PMID:15450169; http://dx.doi.org/10.1016/j.neuron.2004.09.010 [2] Selkoe DJ. Cell biology of protein misfolding: the examples of
Alzheimer’s and Parkinson’s diseases. Nat Cell Biol 2004; 6:1054-61; PMID:15516999; http://dx.doi.org/10.1038/ncb1104-1054 [3] Vekrellis K, Ye Z, Qiu WQ, Walsh D, Hartley D, Chesneau V, Rosner
MR, Selkoe DJ. Neurons regulate extracellular levels of amyloid beta-protein via proteolysis by insulin-degrading enzyme. J Neurosci 2000; 20:1657-65; PMID:10684867
[4] Dorfman VB, Pasquini L, Riudavets M, Lopez-Costa JJ, Villegas A, Troncoso JC, Lopera F, Casta~no EM, Morelli L. Differential cerebral deposition of IDE and NEP in sporadic and familial Alzheimer’s dis-ease. Neurobiol Aging 2010; 31:1743-57; PMID:19019493; http://dx. doi.org/10.1016/j.neurobiolaging.2008.09.016
[5] Duckworth WC, Bennett RG, Hamel FG. Insulin degradation: progress and potential. Endocr Rev 1998; 19:608-24; PMID: 9793760
[6] Qiu WQ, Ye Z, Kholodenko D, Seubert P, Selkoe DJ. Degradation of amyloid beta-protein by a metalloprotease secreted by microglia and other neural and non-neural cells. J Biol Chem 1997; 272:6641-6; PMID:9045694; http://dx.doi.org/10.1074/jbc.272.10.6641
[7] Mizushima N, Levine B, Cuervo AM, Klionsky DJ. Autophagyfights disease through cellular self-digestion. Nature 2008; 451:1069-75; PMID:18305538; http://dx.doi.org/10.1038/nature06639
[8] Mizushima N, Levine B. Autophagy in mammalian development and differentiation. Nat Cell Biol 2010; 12:823-30; PMID:20811354; http://dx.doi.org/10.1038/ncb0910-823
[9] Deretic V, Levine B. Autophagy, immunity, and microbial adapta-tions. Cell Host Microbe 2009; 5:527-49; PMID:19527881; http://dx. doi.org/10.1016/j.chom.2009.05.016
[10] Klionsky DJ. Autophagy: from phenomenology to molecular under-standing in less than a decade. Nat Rev Mol Cell Biol 2007; 8:931-7; PMID:17712358; http://dx.doi.org/10.1038/nrm2245
[11] Subramani S, Malhotra V. Non-autophagic roles of autophagy-related proteins. EMBO Rep 2013; 14:143-51; PMID:23337627; http://dx.doi.org/10.1038/embor.2012.220
[12] Deretic V, Jiang S, Dupont N. Autophagy intersections with conven-tional and unconvenconven-tional secretion in tissue development, remodel-ing and inflammation. Trends Cell Biol 2012; 22:397-406; PMID:22677446; http://dx.doi.org/10.1016/j.tcb.2012.04.008 [13] Dupont N, Jiang S, Pilli M, Ornatowski W, Bhattacharya D, Deretic
V. Autophagy-based unconventional secretory pathway for extracel-lular delivery of IL-1beta. Embo J 2011; 30:4701-11; PMID:22068051; http://dx.doi.org/10.1038/emboj.2011.398 [14] Torisu T, Torisu K, Lee IH, Liu J, Malide D, Combs CA, Wu XS,
Rovira II, Fergusson MM, Weigert R, et al. Autophagy regulates endothelial cell processing, maturation and secretion of von Wille-brand factor. Nat Med 2013; 19:1281-7; PMID:24056772; http://dx. doi.org/10.1038/nm.3288
[15] Martins I, Wang Y, Michaud M, Ma Y, Sukkurwala AQ, Shen S, Kepp O, Metivier D, Galluzzi L, Perfettini JL, et al. Molecular mecha-nisms of ATP secretion during immunogenic cell death. Cell Death Differ 2014; 21:79-91; PMID:23852373; http://dx.doi.org/10.1038/ cdd.2013.75
[16] Jiang S, Dupont N, Castillo EF, Deretic V. Secretory versus degrada-tive autophagy: unconventional secretion of inflammatory mediators. J Innate Immun 2013; 5:471-9; PMID:23445716; http://dx.doi.org/ 10.1159/000346707
[17] Son SM, Jung ES, Shin HJ, Byun J, Mook-Jung I. Abeta-induced for-mation of autophagosomes is mediated by RAGE-CaMKKbeta-AMPK signaling. Neurobiol Aging 2012; 33:1006 e11-23; http://dx. doi.org/10.1016/j.neurobiolaging.2011.09.039
[18] Yang DS, Stavrides P, Mohan PS, Kaushik S, Kumar A, Ohno M, Schmidt SD, Wesson D, Bandyopadhyay U, Jiang Y, et al. Reversal of autophagy dysfunction in the TgCRND8 mouse model of Alzheimer’s disease ameliorates amyloid pathologies and memory deficits. Brain 2011; 134:258-77; PMID:21186265; http://dx.doi.org/ 10.1093/brain/awq341
[19] Boland B, Kumar A, Lee S, Platt FM, Wegiel J, Yu WH, Nixon RA. Autophagy induction and autophagosome clearance in neurons: relationship to autophagic pathology in Alzheimer’s disease. J Neu-rosci 2008; 28:6926-37; PMID:18596167; http://dx.doi.org/10.1523/ JNEUROSCI.0800-08.2008
[20] Oakley H, Cole SL, Logan S, Maus E, Shao P, Craft J, Guillozet-Bongaarts A, Ohno M, Disterhoft J, Van Eldik L, et al. Intra-neuronal beta-amyloid aggregates, neurodegeneration, and neu-ron loss in transgenic mice withfive familial Alzheimer’s disease mutations: potential factors in amyloid plaque formation. J Neurosci 2006; 26:10129-40; PMID:17021169; http://dx.doi.org/ 10.1523/JNEUROSCI.1202-06.2006
[21] Son SM, Byun J, Roh SE, Kim SJ, Mook-Jung I. Reduced IRE1alpha mediates apoptotic cell death by disrupting calcium homeostasis via the InsP3 receptor. Cell Death Dis 2014; 5:e1188; PMID:24743743; http://dx.doi.org/10.1038/cddis.2014.129
[22] Nilsson P, Loganathan K, Sekiguchi M, Matsuba Y, Hui K, Tsubuki S, Tanaka M, Iwata N, Saito T, Saido TC. Abeta secretion and plaque formation depend on autophagy. Cell reports 2013; 5:61-9; PMID:24095740; http://dx.doi.org/10.1016/j.celrep.2013.08.042 [23] Zhou J, Tan SH, Nicolas V, Bauvy C, Yang ND, Zhang J, Xue Y,
Codogno P, Shen HM. Activation of lysosomal function in the course of autophagy via mTORC1 suppression and
autophagosome-lysosome fusion. Cell Res 2013; 23:508-23; PMID:23337583; http:// dx.doi.org/10.1038/cr.2013.11
[24] Lee JH, Yu WH, Kumar A, Lee S, Mohan PS, Peterhoff CM, Wolfe DM, Martinez-Vicente M, Massey AC, Sovak G, et al. Lysosomal proteolysis and autophagy require presenilin 1 and are disrupted by Alzheimer-related PS1 mutations. Cell 2010; 141:1146-58; PMID: 20541250; http://dx.doi.org/10.1016/j.cell.2010.05.008
[25] Glebov K, Schutze S, Walter J. Functional relevance of a novel SlyX motif in non-conventional secretion of insulin-degrading enzyme. J Biol Chem 2011; 286:22711-5; PMID:21576244; http://dx.doi.org/ 10.1074/jbc.C110.217893
[26] Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2001; 2:107-17; PMID:11252952; http://dx.doi.org/ 10.1038/35052055
[27] Bravo-Cordero JJ, Marrero-Diaz R, Megias D, Genis L, Garcia-Grande A, Garcia MA, Arroyo AG, Montoya MC. MT1-MMP proin-vasive activity is regulated by a novel Rab8-dependent exocytic path-way. Embo J 2007; 26:1499-510; PMID:17332756; http://dx.doi.org/ 10.1038/sj.emboj.7601606
[28] Hooff GP, Wood WG, Muller WE, Eckert GP. Isoprenoids, small GTPases and Alzheimer’s disease. Biochimica et biophysica acta 2010; 1801:896-905; PMID:20382260; http://dx.doi.org/10.1016/j. bbalip.2010.03.014
[29] Mohamed A, Saavedra L, Di Pardo A, Sipione S, Posse de Chaves E. beta-amyloid inhibits protein prenylation and induces cholesterol sequestration by impairing SREBP-2 cleavage. J Neurosci 2012; 32:6490-500; PMID:22573671; http://dx.doi.org/10.1523/JNEUROSCI.0630-12.2012
[30] Duran JM, Anjard C, Stefan C, Loomis WF, Malhotra V. Unconven-tional secretion of Acb1 is mediated by autophagosomes. J Cell Biol 2010; 188:527-36; PMID:20156967; http://dx.doi.org/10.1083/ jcb.200911154
[31] Manjithaya R, Anjard C, Loomis WF, Subramani S. Unconventional secretion of Pichia pastoris Acb1 is dependent on GRASP protein, peroxisomal functions, and autophagosome formation. J Cell Biol 2010; 188:537-46; PMID:20156962; http://dx.doi.org/10.1083/ jcb.200911149
[32] Lim YM, Lim H, Hur KY, Quan W, Lee HY, Cheon H, Ryu D, Koo SH, Kim HL, Kim J, et al. Systemic autophagy insufficiency compro-mises adaptation to metabolic stress and facilitates progression from obesity to diabetes. Nat Commun 2014; 5:4934; PMID:25255859; http://dx.doi.org/10.1038/ncomms5934
[33] Nixon RA. The role of autophagy in neurodegenerative disease. Nat Med 2013; 19:983-97; PMID:23921753; http://dx.doi.org/10.1038/ nm.3232
[34] Harris H, Rubinsztein DC. Control of autophagy as a therapy for neurodegenerative disease. Nat Rev Neurol 2012; 8:108-17; http://dx. doi.org/10.1038/nrneurol.2011.200
[35] Tamboli IY, Barth E, Christian L, Siepmann M, Kumar S, Singh S, Tolksdorf K, Heneka MT, L€utjohann D, Wunderlich P, et al. Statins promote the degradation of extracellular amyloid {beta}-peptide by microglia via stimulation of exosome-associated insulin-degrading enzyme (IDE) secretion. J Biol Chem 2010; 285:37405-14; PMID:20876579; http://dx.doi.org/10.1074/jbc.M110.149468 [36] Nixon RA. Autophagy, amyloidogenesis and Alzheimer disease. J
Cell Sci 2007; 120:4081-91; PMID:18032783; http://dx.doi.org/ 10.1242/jcs.019265
[37] Settembre C, Fraldi A, Medina DL, Ballabio A. Signals from the lyso-some: a control centre for cellular clearance and energy metabolism. Nat Rev Mol Cell Biol 2013; 14:283-96; PMID:23609508; http://dx. doi.org/10.1038/nrm3565
[38] Nickel W, Rabouille C. Mechanisms of regulated unconventional protein secretion. Nat Rev Mol Cell Biol 2009; 10:148-55; PMID:19122676; http://dx.doi.org/10.1038/nrm2617
[39] Merregaert J, Van Langen J, Hansen U, Ponsaerts P, El Ghalbzouri A, Steenackers E, Van Ostade X, Sercu S. Phospholipid scramblase 1 is secreted by a lipid raft-dependent pathway and interacts with the extracellular matrix protein 1 in the dermal epidermal junction zone of human skin. J Biol Chem 2010; 285:37823-37; PMID:20870722; http://dx.doi.org/10.1074/jbc.M110.136408
[40] Ebrahimi-Fakhari D, Cantuti-Castelvetri I, Fan Z, Rockenstein E, Masliah E, Hyman BT, McLean PJ, Unni VK. Distinct roles in vivo for the ubiquitin-proteasome system and the autophagy-lysosomal pathway in the degradation of alpha-synuclein. J Neu-rosci 2011; 31:14508-20; PMID:21994367; http://dx.doi.org/ 10.1523/JNEUROSCI.1560-11.2011
[41] Morck C, Olsen L, Kurth C, Persson A, Storm NJ, Svensson E, Jansson JO, Hellqvist M, Enejder A, Faergeman NJ, et al. Statins inhibit protein lipidation and induce the unfolded protein response in the non-sterol producing nematode Caenorhabditis elegans. Proc Natl Acad Sci U S A 2009; 106:18285-90; PMID:19826081; http://dx. doi.org/10.1073/pnas.0907117106
[42] Deretic V. Autophagy: an emerging immunological paradigm. J Immunol 2012; 189:15-20; http://dx.doi.org/10.4049/jimmunol. 1102108
[43] Shi CS, Shenderov K, Huang NN, Kabat J, Abu-Asab M, Fitzgerald KA, Sher A, Kehrl JH. Activation of autophagy by inflammatory sig-nals limits IL-1beta production by targeting ubiquitinated in flamma-somes for destruction. Nat Immunol 2012; 13:255-63; PMID:22286270; http://dx.doi.org/10.1038/ni.2215
[44] Jahn R, Lang T, Sudhof TC. Membrane fusion. Cell 2003; 112:519-33; PMID:12600315; http://dx.doi.org/10.1016/S0092-8674(03)00112-0 [45] Li D, Ropert N, Koulakoff A, Giaume C, Oheim M. Lysosomes are the
major vesicular compartment undergoing Ca2C-regulated exocytosis from cortical astrocytes. J Neurosci 2008; 28:7648-58; PMID:18650341; http://dx.doi.org/10.1523/JNEUROSCI.0744-08.2008
[46] Rao SK, Huynh C, Proux-Gillardeaux V, Galli T, Andrews NW. Iden-tification of SNAREs involved in synaptotagmin VII-regulated lyso-somal exocytosis. J Biol Chem 2004; 279:20471-9; PMID:14993220; http://dx.doi.org/10.1074/jbc.M400798200
[47] Verderio C, Cagnoli C, Bergami M, Francolini M, Schenk U, Colombo A, Riganti L, Frassoni C, Zuccaro E, Danglot L, et al. TI-VAMP/VAMP7 is the SNARE of secretory lysosomes contributing to ATP secretion from astrocytes. Biol Cell 2012; 104:213-28; PMID:22188132; http://dx.doi.org/10.1111/boc.201100070
[48] Jung ES, An K, Hong HS, Kim JH, Mook-Jung I. Astrocyte-origi-nated ATP protects Abeta(1-42)-induced impairment of synaptic plasticity. J Neurosci 2012; 32:3081-7; PMID:22378880; http://dx.doi. org/10.1523/JNEUROSCI.6357-11.2012
[49] Martins I, Wang Y, Michaud M, Ma Y, Sukkurwala AQ, Shen S, Kepp O, Metivier D, Galluzzi L, Perfettini JL, et al. Molecular mecha-nisms of ATP secretion during immunogenic cell death. Cell Death Differ 2014; 21:79-91; PMID:23852373; http://dx.doi.org/10.1038/ cdd.2013.75
[50] Eroglu C, Barres BA. Regulation of synaptic connectivity by glia. Nature 2010; 468:223-31; PMID:21068831; http://dx.doi.org/10.1038/ nature09612
[51] Verghese PB, Castellano JM, Garai K, Wang Y, Jiang H, Shah A, Bu G, Frieden C, Holtzman DM. ApoE influences amyloid-beta (Abeta) clear-ance despite minimal apoE/Abeta association in physiological conditions. Proc Natl Acad Sci U S A 2013; 110:E1807-16; PMID:23620513; http:// dx.doi.org/10.1073/pnas.1220484110
[52] Xiao Q, Yan P, Ma X, Liu H, Perez R, Zhu A, Gonzales E, Burchett JM, Schuler DR, Cirrito JR, et al. Enhancing astrocytic lysosome bio-genesis facilitates Abeta clearance and attenuates amyloid plaque pathogenesis. J Neurosci 2014; 34:9607-20; PMID:25031402; http:// dx.doi.org/10.1523/JNEUROSCI.3788-13.2014
[53] Vekrellis K, Ye Z, Qiu WQ, Walsh D, Hartley D, Chesneau V, Rosner MR, Selkoe DJ. Neurons regulate extracellular levels of amyloid beta-protein via proteolysis by insulin-degrading enzyme. J Neurosci 2000; 20:1657-65; PMID:10684867
[54] Gao W, Eisenhauer PB, Conn K, Lynch JA, Wells JM, Ullman MD, McKee A, Thatte HS, Fine RE. Insulin degrading enzyme is expressed in the human cerebrovascular endothelium and in cultured human cerebrovascular endothelial cells. Neurosci Lett 2004; 371:6-11; PMID:15500957; http://dx.doi.org/10.1016/j.neulet.2004.07.034 [55] Kilger E, Buehler A, Woelfing H, Kumar S, Kaeser SA,
Nagara-thinam A, Walter J, Jucker M, Coomaraswamy J. BRI2 protein regulates beta-amyloid degradation by increasing levels of secreted insulin-degrading enzyme (IDE). J Biol Chem 2011; 286:37446-57; PMID:21873424; http://dx.doi.org/10.1074/jbc. M111.288373
[56] Blennow K, Hampel H, Weiner M, Zetterberg H. Cerebrospinal fluid and plasma biomarkers in Alzheimer disease. Nat Rev Neurol 2010; 6:131-44; PMID:20157306; http://dx.doi.org/10.1038/nrneurol. 2010.4
[57] Turner AJ, Fisk L, Nalivaeva NN. Targeting amyloid-degrading enzymes as therapeutic strategies in neurodegeneration. Ann N Y Acad Sci 2004; 1035:1-20; PMID:15681797; http://dx.doi.org/ 10.1196/annals.1332.001
[58] Mawuenyega KG, Sigurdson W, Ovod V, Munsell L, Kasten T, Morris JC, Yarasheski KE, Bateman RJ. Decreased clearance of CNS beta-amyloid in Alzheimer’s disease. Science 2010; 330:1774; PMID:21148344; http://dx.doi.org/10.1126/science.1197623 [59] Liu L, Duff K. A technique for serial collection of cerebrospinalfluid
from the cisterna magna in mouse. J Vis Exp 2008; 10(21):pii: 960; PMID:19066529; http://dx.doi.org/10.3791/960
[60] Moon M, Choi JG, Nam DW, Hong HS, Choi YJ, Oh MS, Mook-Jung I. Ghrelin ameliorates cognitive dysfunction and neu-rodegeneration in intrahippocampal amyloid-beta1-42 oligomer-injected mice. Journal of Alzheimer’s disease : JAD 2011; 23:147-59; PMID:20930280
[61] Son SM, Song H, Byun J, Park KS, Jang HC, Park YJ, Mook-Jung I. Altered APP processing in insulin-resistant conditions is medi-ated by autophagosome accumulation via the inhibition of mam-malian target of rapamycin pathway. Diabetes 2012; 61:3126-38; PMID:22829447; http://dx.doi.org/10.2337/db11-1735
[62] Avrahami L, Farfara D, Shaham-Kol M, Vassar R, Frenkel D, Eldar-Finkelman H. Inhibition of glycogen synthase kinase-3 ameliorates beta-amyloid pathology and restores lysosomal acidification and mammalian target of rapamycin activity in the Alzheimer disease mouse model: in vivo and in vitro studies. J Biol Chem 2013; 288:1295-306; PMID:23155049; http://dx.doi.org/10.1074/jbc.M112. 409250
[63] Trajkovic K, Hsu C, Chiantia S, Rajendran L, Wenzel D, Wieland F, Schwille P, Br€ugger B, Simons M. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 2008; 319:1244-7; PMID:18309083; http://dx.doi.org/10.1126/science. 1153124
[64] Byun J, Son SM, Cha MY, Shong M, Hwang YJ, Kim Y, Ryu H, Moon M, Kim KS, Mook-Jung I. CR6-interacting factor 1 is a key regulator in Abeta-induced mitochondrial disruption and pathogenesis of Alz-heimer’s disease. Cell Death Differ 2015; 22(6):959-73. http://dx.doi. org/10.1038/cdd.2014.184