RT-PCR (Reverse transcription-Polymerase Chain Reaction)

BV2 cell was seeded in the 6 well plates same as before and incubated for the expected time course. Then the cells were washed twice with PBS and later total RNA was extracted by using easy blue (1 ml) according to the recommended by the manufacturer. Briefly, Cell lysed by easy blue taken into 1.5ml tube and 500 ul of Chloroform was added and vortex well then centrifuged for 15 minutes. Then the 400 ul clear supernatant was carefully taken in a newly prepared 1.5 ml tube and Ice cold isopropanol (400ul) was added there and mixed well by inverting the tube for few times and keep for 10 mins (or overnight). Then centrifuged for 15 mins and thereafter the supernatant was thrown out carefully and ice cold 70% EtOH was added and mixed well

then again centrifuged for 10 mins. Later the upper layer was discarded and the pellet was let it to dry to get rid of moisture. Dried RNA was dissolved in 20-25ul of DEPC. After measuring the RNA, by Nano drop spectrophotometer (Thermo Scientific, Delaware, USA), cDNA synthesis was performed by using 1ug of total RNA and RT-PCR kit AMV reverse transcriptase (Roche, Germany). Single strand cDNAs were subsequently used for PCR analysis by perfectShot^TMEx Tag Kit (Takara, Japan) with the following primers:

10 Table 1. Primer Sequences for RT-PCR

Name Sense Anti-sense

GAPDH CGGCTTTGATCTCTGCTTAA ACAGGTCTCCTCCGTCTT GA

IL-1β GCAACTGTTCCTGAACTC CTCGGAGCCTGTGT GCA

Integrin β1 AATGTTTCAGTGCAGAGC C TTGGGATGATGTCGGGAC

Integrin β2 AATGAAGCAAGAGGGCAA TGCGAC

ACAGTCGCAGAAGGTGCCATA GAT

11 E. Western blotting

BV2 cells were seeded in the 6 well plates as before and incubated for 4 and 6hrs.

After the incubation time cells were washed with Phosphate Buffer Saline (PBS) twice and harvested by RIPA buffer (150 mM NaCl, 10 mM Na2HPO4 [pH 7.2] , 0.5% sodium deoxycholate and 1% Nonident P-40) containing 5 mM EDTA, 10 µg/ml Leupeptin, 0.5 mM Phenylmethylsulfonyl Fluride (PMSF), 1 µg/ml of pepstatin and 10 µg/ml Aptotinin.

Cell Lysate were further homogenized by brif sonication and later on centrifuged at 14,000 g for 20 minutes at 4° C and the resulting supernatant collected. Protein concentration was determined by using BCA reagent and sample was prepared with adding 1x Laemmli buffer (250 mM Tris-Hcl[pH 6.8], 40% Glycerol, 10% SDS, 20% 2-Mercaptoethanol, 0.032% Bromophenol Bule) . The protein sample was separated in the 10% SDS-PAGE and transfer to the PVDF/ millipore membrane. Then the membrane was blocked with 5% skim milk for 1 hour followed by primary antibody binding for expected protein and was kept in the 4°C for overnight. Secondary antibody was bound with the membrane for 2 hours the membrane was scanned by using chemiluminescence WB kit (ECL, intron, Korea) in the LAS-1000 (Fuji, Japan).

F. Inhibition of ICAM-1 by neutralizing antibody for ICAM1

After subculture BV2 cell were separated by two groups in 2x10⁵cells/well. One of them was for control and the other was treated with monoclonal neutralizing antibody to ICAM-1 (YN1/1.7.4 2.5 ug/ml) and incubated in the 37°C and 5% CO2 chamber for 30

mins and then treated with LPS (1 µg/ml) and incubated for 4 and 6hrs. Then the picture was taken by using Coolpix 995 (Nikon, Japan) and the cell was counted. The effect of YN1/1.74 was also observed on the rearrangement of actin filament the phalloidin staining..

G. Inhibition of ICAM1 downstream Rho/ROCK kinase

BV2 cell was first incubated with Y27632 (10 μM/ml) (Sigma-Aldrich, USA), a well known inhibitor Rho kinase, of for 30 minutes then LPS (1 μg/ml) was added and cell was seeded. The concentration of the cell was 2x10⁵in each group. The cell was incubated for 4 and 6hrs and later the phase contrast picture were taken.

III. RESULTS

A. BV2 cell morphology

BV2 microglial cells were subcultured when the cells was confluent and plated in 24 well plate. After seeding BV2 cells showed round morphology. After 2 hrs they gradually started to get their ramified form which showed slender cell body with smooth membrane and short proximal process (Fig.1A). However, at 4 and 6 hrs more than 30- 40% of total cells became ramified with small body, usually bipolar short thickened proximal process and long distal ramification, and negligible amount of spread cells. The spread cells showed little short proximal process and distal attachment (Fig.1B). When the BV2 cells were treated with LPS (1 µg/ml), they showed the change of morphology but similar as untreated group until 2hrs (Fig.2A and B). After 4 and 6 hrs there was significant increase in the number of spread cells, with distorted uneven membrane, short contracted process and large in size (Fig.2A).

Fig. 1. BV2 cell morphology. Change of BV2 cell morphology was observed without any treatment in different time course. (A) BV2 cells plated on plastic started to change morphology as early as 2 hr and the number of cells changing morphology increased after then respectively. The increase of spread cells was not significant. (B) Bar chart showed the ramified cells increased significantly whereas the change of round cells and spread cells showed no significant difference Blue arrow shows the round cell, green arrow shows the ramified cells and red arrow shows the spread cells.(*p < 0.05, compared with control). Phase contrast photo micrograph of the corresponding fields X100.

Fig. 2. Earlier changes of LPS-treated BV2 cell morphology. Microglial cell line BV2 cells were treated with or without LPS (1 μg/ml) for 2hrs, 4hrs and 6hrs. (A) Showed the increases of ramified cells with long distal processes and spread cells with shortening the long processes and ruffling of the cell body in LPS-treated group. (B) Bar chart showed the changes of three types of cells in time. Blue arrow shows the round cell, green arrow shows the ramified cells and red arrow shows the spread cells. (#p < 0.05, compared with control of different time point). Phase contrast photo micrograph of the corresponding fields X100.

B. Immunofluorescence assay of actin to check BV2 cell spreading

In BV2 cells the immunofluorescence assay for actin was done 4 and 6 hrs after treated with or without LPS (1 µg/ml). Without LPS, that is control condition, the cell showed round shape cell body sign of having process like short proximal process and long distal ramification and cell membrane looks even in both 4 and 6 hrs (Fig.3). In the other hand, actin expression in the LPS-treated group showed changes in the cell shape and sign of having more than two pole, possible retraction of process, their uneven membrane (Fig.3).

Fig. 3. Immunofluorescence assay of BV2 cell morphology. Microglial cell line BV2 cell were treated with or without LPS (1 μg/ml) for 4hrs and 6hrs and labeled with antibody for actin. Treatment of LPS increased the number of cells containing uneven membrane, thick proximal process with short or no distal ramification, which indicated the spread BV2 cells. Blue arrow shows the round cell, green arrow shows the ramified cells and red arrow shows the spread cells. Immunefluorescence photomicrograph of the corresponding fields is X400.

18 C. Role of cytoskeleton in cell shape change

Cytoskeleton is one of the main factors that are responsible for the maintenance of the cell shape. Therefore, I performed immunoassay for the stress fibers, components of cytoskeleton, in BV2 cells. After treatment with LPS (1 μg/ml) for 4hrs and 6hrs, the cells were fixed and labeled with antibody against a focal adhesion molecule vinculin and phalloidin specific for F-actin. It showed that LPS increased the focal adhesion area and changed the arrangement of stress fibers (Fig.4A). In LPS-treated group, the numbers of spread cells increased while the numbers of round cells decreased than the control group, which was same as previous data in phase contrast picture. In cytoskeleton-stained pictures, the cell shape change is suggested as due to rearrangement of the actin filaments.

Fig. 4. Immunofluorescence assay cytoskeleton of BV2 cell. Microglial cell line BV2 cell were treated with or without LPS (1 μg/ml) for 4hrs and 6hrs and labeled with antibody for vinculin (red) stress fiber (green). LPS increased the focal adhesion area of the cells and changed the rearrangement of F-actin (A). Blue arrow shows the round cell, green arrow shows the ramified cells and red arrow shows the spread cells. According to the cell shape the cell numbers also counted into three different groups as previously mentioned (B). Immunefluorescence photomicrograph of the corresponding fields is X200.

D. LPS-induced cell adhesion molecule mRNA expression in BV2 cells

Cell adhesion molecules expressed by LPS (1 ug/ml) in BV2 cells were evaluated by RT-PCR. The BV2 cells were treated with or without LPS and incubated for 1, 10 and 30 mins, 1hr, 2hr and 4 hrs. The mRNA for ICAM-1, LFA-1 and subunits of different integrin (β1 & β2) were done. Results showed that there was no change of ICAM-1 mRNA expression in the control group in any time course, whereas LPS induced ICAM-1 mRNA expression as early as 1 hr and maintained in 2 and 4 hrs (Fig. 5), which coincided with the time of BV2 cell spread. However, the expression of LFA-1 and integrin subunits (β1 & β2) mRNA was not much changed in time or by LPS treatment.

E. ICAM-1 protein expression in BV2 cells

LPS induced ICAM-1 mRNA expression in BV2 cell as early as 1 hr. The ICAM-1 protein expression was observed at 2, 4 and 6 hrs with western blotting. There was no change in ICAM-1 protein expression in the control group in any time course (Fig.

6), while LPS began to induce ICAM-1 protein expression at 2hrs and increased the expression significantly at 4 and 6 hrs (Fig. 6).

Fig. 5. Cell adhesion molecule express in BV2 cells The cells were treated with or without LPS for 0, 10 and 30 min, 1hr, 2 hrs and 4hrs to check mRNA expression of different CAMs. The expression of ICAM-1 mRNA increased in BV2 cells treated with LPS at 1 hr and continued in 2 hrs and 4 hrs, which also correlated with change of morphology. In case of CAMs from integrin family there were no significant changes in their mRNA expression by LPS.

Fig. 6. ICAM-1 protein expression with or without LPS. Western blotting was done to measure ICAM-1 protein expression in BV2 cells treated with or without LPS for 2, 4 and 6 hrs. It showed that the ICAM-1 protein expression increased at 2hr and more increased at 4 and 6hrs. This result coincided with the ICAM-1 mRNA expression and the increase in number of spread cells.

24 F. Cytokine expression By the BV2 cell

After seeding BV2 cells, the expression of cytokines IL-β and TNF-α was observed at the time of seeding, 30 min, 1hr, 2hr, 4hr and 6hr (Fig. 7). Both of the cytokines gradually increased until 1 hr, and gradually decreased after 2 hrs and later at 6hr become hardly traceable. The treatment of LPS (1ug/ml) increased the expression of both cytokines as early as 30 mins and the expression remained same until even 4hrs.

Therefore, the LPS-treated cells started spread after 2 hrs but the cytokines expressed far earlier than the cell spread (Fig. 8). As cytokines expressed ICAM1 within 1-4 hrs, they may have some roles in cell spread in the earlier spread of BV2 cell.

Fig. 7. Cytokines Expression by BV2 cells without treatment. Cytokines IL-1β and TNF-α mRNA expression was measured in the BV2 cells without LPS treatment. Both of the cytokine expression increased as early as 30 min but gradually decreased after 2 hrs and become hardly traceable in 6 hrs. This suggested that the cytokines had little roles in BV2 cell morphology without LPS treatment.

Fig. 8. Cytokines by LPS-treated BV2 cells. BV2 cells were treated with or without LPS for 30 min, 1 hr, 2hrs and 4hrs to check the effect of LPS on the expression of cytokines IL-1β and TNF-α mRNA. LPS increased the expression of both cytokines at 30 min and remained same until 4 hrs (A). In case of control group the expression of mRNA showed as previously mentioned. Both cytokines increased the ICAM1 expression at 2 hrs but the expression was not much significant in the earlier time (B).

G. Spread inhibition by monoclonal neutralizing ICAM1antibody in BV2 cells

As BV2 cells showed spreading at 4 and 6 hrs, the cellular shape changes were observed at those time course after treatment with or without LPS and a monoclonal

neutralizing ICAM1antibody YN1/1.7.4 (2.5 ). In Fig. 9A phase contrast pictures showed that the treatment of neutralizing antibody to ICAM1 attenuated the number of spread of BV2 cells and although the numbers of ramified cells was reduced, there was no significant change (Fig. 9). However, the portion of spread cells showed a significant reduction in LPS and YN1/1.7.4 treated group compared with the only LPS-treated group (Fig. 9A and 9B). This result indicates that ICAM-1 plays roles in LPS –induced morphologic changes of BV2 cells.

Fig. 9. Inhibition of ICAM1 by monoclonal neutralizing antibody. BV2 cell were treated with or without LPS (1ug/ml) and ICAM1 monoclonal antibody YN1/1.7.4 (2.5uM/ml) for 2, 4 and 6hrs. In (A). Phase contrast picture shows that monoclonal neutralizing antibody to ICAM1 reduce the number of spread of BV2 cell. Pai chart shows that Neutralizing antibody for ICAM-1 reduce the number of spread cells in LPS treated groups in both 4 and 6 hrs (B). But there is no significant difference in other type of cells. Blue arrow shows the round cell, green arrow shows the ramified cells and red arrow shows the spread cells. Phase contrast photo micrograph of the corresponding fields X100.

H. Immunoflruorecense Assay to check the effect of monoclonal antibody to ICAM1.

To confirm the effect of the YN 1/1.7.4 the monoclonal antibody to ICAM1 on the morphologic changes by LPS in BV2 cells, I examined the effect of ICAM1 mAb on actin remodeling, LPS-induced spread, which was evident in the phase contrast. The actin remodeling was observed 4 and 6hrs after LPS treatment. After fixation with 4%

paraformaldehyde the BV2 cells were stained with Phalloidin. LPS treatment increased the actin rearrangements and those were attenuated significantly by treatment of mAb to ICAM1 (Fig.10). It gives that idea that monoclonal antibody to ICAM1 blocks the effect of LPS-induced ICAM1 which causes the actin rearrangement.

Fig. 10. Expression of actin in LPS and monoclonal antibody treated BV2 cell LPS (1μg/ml) and ICAM1 monoclonal antibody YN1/1.7.4 (2.5 μg/ml) were treated in BV2 cell for 4 and 6hrs. The cells were fixed with 4% PFA and later was stained with phalloidin. It showed that mAb for ICAM1 attenuated the spread of BV2 cells by reducing the rearrangement of actin fiber. Blue arrow shows the round cell, green arrow shows the ramified cell and red arrow shows the spread cell. Immunefluorescence photomicrograph of the corresponding fields is X200.

I. Inhibition of ICAM1 downstream molecule Rho/ROCK.

Rho/ROCK, serine-threonine kinases are the downstream molecule of ICAM1 signaling pathway. The effect of Rho/ROCK kinase inhibitor Y27632 (10 μM/ml) on BV2 cells with or without LPS was observed. It showed that Y27632 developed long process in most cells which resembled the ramified cells (Fig.10). When the cells were treated with LPS for 4 and 6 hrs, there was little changing in the cell shape or process.

However, treatment of LPS without Y27632 showed the similar result as previously shown.

Fig. 11. Inhibition of ICAM1 downstream pathway by Rho/ROK inhibitor. BV2 cells were first incubated with or without Rho/ROK inhibitor Y27632 (10 μM/ml) and later with or without LPS (1μg/ml). The time course was chosen as 4 and 6hrs. Then the pictures was taken in the contrast phase. Blue arrow shows the round cell, green arrow shows the ramified cells and red arrow shows the spread cells. Phase contrast photomicrograph of the corresponding fields is X100.

IV. DISCUSSION

In this study it is characterized that BV2 microglial cells change in morphology, which is time dependent, and the expression of ICAM-1 is parallel for the time course change of microglial shape especially for spreading. When the BV2 cells was pre-incubated with ICAM-1 neutralizing antibody YN1/1.7.4 prior to LPS, the number of spreading cells was significantly reduced.

Microglial cells, the resident macrophages of the CNS, are exquisitely sensitive to brain injury and disease, altering their morphology and phenotype to adopt a so-called activated state in response to pathophysiological brain insults. Morphologically activated microglial cells like other tissue macrophages, exist as many different phenotypes, depending on the nature of tissue injury (Perry et al, 2010). Lipopolysaccharides (LPS), also known as lipoglycans, are large molecules consisting of a lipid and a polysaccharide joined by a covalent bond; they are found in the outer membrane of Gram-negative bacteria, act as endotoxins and elicit strong immune responses in animals. LPS treatment has been used extensively in inflammatory studies (Carter et al, 2003; Maekawa et al, 2002). It has also been shown that LPS activates microglia and exerts neurocytotoxic effects in both in vitro and in vivo systems (Hughes et al, 2004; Nakamura et al, 1999). Microglia shows diverse morphological changes which also indicate activation after treated with LPS. Morphologically, this activation was characterized by the swelling of the microglial cell body, a thickening of the proximal processes, and a reduction in distal ramification (Christian et al, 2000). In this study the types of BV cells were classified into three groups round, ramified and spread.

The classification was done according to their cell size, condition of the membrane,

proximal process and distal ramification. Round cells with smooth cell surface membrane resembles as either myelomonocytic cells or activated BV2 cell (amoeboid activated cells), ramified are bipolar with small cell body and have distal ramification and proximal process, lastly the spread cells tri- or multipolar with short or no distal ramification, thickened proximal process and uneven cell surface membrane. In primary microglial cells, treatment of LPS has a more extended morphology than untreated cells on glass (Summers et al, 2009). In this study BV2 microglial cells treated with LPS (1 µg/ml) showed different time duration but the result supported the previous study. In present study BV2 cells started to take ramified morphology after 2 hours in both LPS treated and untreated group. However, LPS increased the number of spread cells at 4 and 6 hrs in Fig. 1 and 2, which also could be manifested as pro-amoeboid cells (Fig. 2). I also confirmed the changes of the cell shape with immunofluorescence assay, by using antibody binds to actin, in the control and LPS-treated group at 4 and 6 hours. It showed that BV2 cells increased in size and got spread shape in LPS-treated group in both 4 and 6 hrs. Thus, it is certain that LPS induce the spreading of BV2 cells and it is time dependent.

Cell adhesion molecules (CAMs) are located on the cell surface, which are involved with the binding with other cells or with the extracellular matrix (ECM) in the process called cell adhesion. Microglial cells express a number of CAMs like ICAM-1 (CD54), lymphocyte function associated antigen-1 (LFA-1) (CD11a) and α5β1 integrin in neurodegenerative diseases (Milner et al, 2003). Previous study reveals that cell adhesion molecules like ICAM-1, LFA-1 has a strong role in change of size in human dermal microvessel endothelial cells (HDMEC), human monocyte cell line THP-1, T-cell and other cells (Ronald et al, 2001; Mueller et al, 2004). In present study, cell adhesion

molecule expression with or without LPS (1 µg/ml) in BV2 cells was measured. The most of the CAMs or their subunits expressed by microglia such as LFA-1, β2 and β1 subunits of MAC-1 and α5β1 were present after seeding in the plastic (Milner et al, 2003; Färber et al, 2008). After seeding, mRNA of these integrins expressed at earlier time and there are no significant changes of their expression in the course of time and also irrespective of the control and the LPS-treated group (Fig. 5). In contrast, the expression of ICAM-1, a cell adhesion molecule related to Immunoglobulin super family, increased significantly after 1 hr and it continued even until 4 hrs (Fig. 5). In morphology, BV2 cells showed spreading after 2 hrs and at 4 hrs and it was suggested that the increase of ICAM-1

문서에서 Role of ICAM-1, a cell adhesion molecule, in morphological changes of BV2 microglial cell (페이지 20-0)