CONCLUSION & SCHEMETIC DIAGRAM

E. Regulation of BrdU incorporation and mitochondrial biogenesis through PKCζ-

V. CONCLUSION & SCHEMETIC DIAGRAM

In the present study, we explored a molecular mechanism involved in the reversal of senescence phenotypes, and found that the event is regulated by PEA-15 (phosphoprotein enriched in astrocytes) which tethers cytoplasmic pErk1/2. In the study, we used TPA as the control agent which is known to induce the reversal of senescence morphology to young cell-like through inhibition of interaction between PEA-15 and pErk1/2.

- 27 -

Part. Ι. B

Regulations of reversal of senescence by PKC isozymes in response to 12-O-tetradecanoylphorbol-13-acetate via nuclear translocation of

pErk1/2

I. INTRODUCTION

Cellular senescence has been known as a process of permanent growth arrest when cells lose ability to activate cell division cycle. Hayflick and Moorhead described in detail about the limited proliferative capacity of normal cells and postulated that senescence is an in vitro manifestation of human aging (Hayflick and Moorhead., 1961). It has been also reported that failure of senescence induction in epithelial cells significantly increases carcinogenic progression in both human and animals. Therefore, benign prostate hyperplasia, lung adenoma, intraductal neoplasia of pancreas and skin papilloma etc., can be successfully protected against cancer progression by oncogene-induced senescence (Vernier et al., 2011; Collado et al., 2005), thus cellular senescence playing an important role as a barrier of cancer progression. One of the characteristic features of senescent cells has been shown to be cytoplasmic sequestration of senescence-associated pErk1/2 (SA-pErk1/2) as opposed to the G-actin accumulation in nuclei of senescent cells (Lim et al., 2000). Potential mechanisms of the failure of nuclear translocation of pErk1/2 in response to growth factor stimulation has been in part due to inactivation of protein phosphatases 1 and 2A, and MKP3/DUSP6 by accumulated ROS in senescent human diploid fibroblasts (Kim et al., 2003). On the other hand, failure of G-actin export from nuclei of senescent cells occurs due to cofilin activation as opposed to LIMK inactivation, resulting in the altered F-actin polymerization in the senescent cells (Lim et al., 2000; Kwak et al., 2004).

However, when the senescent cells are treated with 12-O-tetradecanoylphorbol-13-acetate (TPA), the morphology of old cells changed to young cell-like along with reversal of senescence markers, such as BrdU incorporation, pRB hyperphosphorylation, reduced expressions of p53

- 28 -

and p21^WAF1, senescence-associated heterochromatin foci, H3K9me2 and SA-b-galactosidase activity, which lead to G1/S progression and cell proliferation (Lee et al., 2015; Kwak et al., 2004; Kim et al., 2009). Treatment of senescent cells with TPA rapidly dissociates SA-pErk1/2 from phosphoprotein enriched in astrocyte-15 (PEA-15) and induces nuclear translocation of pErk1/2 (Lee et al.,2015). Not only TPA treatment but also knockdown of PKCa expression by RNA interference significantly induces proliferation of human diploid fibroblast (HDF) old cells (Kim et al., 2009). All of the findings strongly implicate a direct role of PKCa in the reversal of senescence phenotypes. Indeed, it has been reported that PKCa is a mediator of G2/M arrest and cellular senescence via inducing p21^WAF1in the asynchronously growing NSCLC (Oliva et al., 2008). Considering that TPA downregulates PKC isozymes after initial activation (Bilezikjian et al., 1987; Lu et al., 1998), the above mentioned findings strongly suggest that downregulation of PKCa might regulate the reversal of senescence in the primary culture of HDF cells. To the best of our knowledge, however, there is no report that TPA reverses senescence phenotypes by knockdown of PKC isozymes in both cells and animal models. In addition, we investigated possible similarities in the gene expression profiles regulated by TPA-induced PKCa downregulation and a carcinogenic process.

PKC, a serine/threonine kinase, is divided into four subfamilies according to the cofactor requirements; conventional PKCs (PKCα, PKCβ1, PKCβ2, and PKCγ), novel PKCs (PKCδ, PKCε, PKCθ and PKCη), atypical PKCs (PKCζ, PKCι) and distant PKCs such as PKCμ/PKD, PKCν (Clemens et al., 1992; Dekker and Parker., 1994; Nishizuka et al., 1995). Traditionally, PKC has been known as the high affinity intracellular receptor of phorbol esters, a class of potent tumor promoters (Ashendel et al., 1985). The direct activation of PKC by phorbol esters indicates that PKC is critically involved in growth control, thus it is widely accepted that PKC plays a pivotal role in the regulation of proliferation and differentiation (Clemens et al., 1992;

Nishizuka et al, 1992). Phorbol esters activate PKCs longer than physiological regulators:

prolonged vs. transient activation of PKCs is an important distinction that may form the basis for tumor-promoting activity of phorbol esters (Jaken et al., 1990; Bell and Burns., 1991;

Nishizuka et al., 1992) (Fig. 8).

- 29 -

Fig. 8. Domain structures of protein kinase C (PKC) isoforms. PKCs have a conserved kinase domain and more variable regulatory domains. All PKC regulatory domains contain a pseudosubstrate motif (PS) NH₂ terminal to the C1 domain (shown in pink). Tandem C1 domain functions are sensor of 12-O-tetradecanoylphorbol-13-acetate (TPA)/ diacylglycerol (DAG) in both cPKC and nPKC isoforms, whereas the single of aPKC C1 domain does not response to DAG/PMA. The C2 domains (in yellow) function as calcium-dependent phospholipid binding modules in cPKCs. nPKC C2 domains do not bind calcium; the PKCδ-C2-like domain is a phosphotyrosine interaction module. PKC isoform variable regions are shown in gray

PKCα is activated by a variety of stimuli originating from receptor activation, cell contact and physical stresses. Upon stimulation, PKCα translocates from cytosol to particulate fractions, nucleus being one of the major compartments (Buchner et al., 1995). We have observed that stimulation of HDF cells with TPA activates PKCa, PKCb1 and PKCh (Kim et al., 2009), consequently the isozymes moving from cytosol to particulate fractions in both young and old HDF cells. This suggested that PKC might be one of the important factors in the regulation of senescence phenotypes. However, the exact mechanism of nuclear translocation of PKC isozymes has not yet been reported; PKCα and other PKC isozymes do not contain nuclear localization signal (NLS) sequences, and are independent of the components for NLS-dependent transport such as importin and Ran/GTPase (Schmalz et al., 1998).

The activity of PKCα is higher in senescent cells than in the young cells due to accumulated ROS, which stimulates SA-pErk1/2 and enhances p21^WAF1 transcription after Sp1

- 30 -

phosphorylation on S⁵⁹residue and maintains senescence (Kim et al., 2009). In addition, treatment of HepG2 cells with TPA signals PKCα activation along with Erk1/2 signaling and growth inhibition (Wen-Sheng and Jun-Ming., 2005), implying that all the factors regulating MAPK pathway are involved in the activation of PKCα in response to TPA (Thomas et al., 1992;

Alexandropoulos et al., 1993; Tobin et al., 1996; Ueda et al., 1996; Ho et al., 1998; Wen-Sheng., 2006). To accomplish the effect, the signals have to reach nucleus after activation. Buchner (Buchner et al., 1995) suggested several possibilities of PKC-mediated signal transduction into nucleus; Cytoplasmic PKC signals transmitted to nuclei through the activation of Raf-MEK-MAPK pathway, degradation of IkB-a along with p50/p65 translocation to nucleus, and just JAK-STAT activation signals in response to a ligand stimulation. On the other hand, signal transduction to nucleus might be accomplished by nuclear translocation of PKC itself via nuclear pore complex after activation in the cytoplasm. In addition, it has been pointed out that phorbol esters stimulate Erk1 via protein-tyrosine/threonine kinase activation (Alessandrini et al., 1992).

MAPK pathway regulates various cellular functions including cell proliferation, differentiation, migration, and apoptosis (Chang and Karin., 2001; Pearson et al., 2001), and the terminal elements of this pathway, ERK1 and ERK2, activate transcription factors (e.g. c-fos, Elk-1) in nucleus upon phosphorylation (Cruzalegui et al., 1999) (Fig. 9).

- 31 -

Fig. 9. MAPK signaling pathway. Mitogen-activated protein kinase (MAPK) proteins are serine/ threonine specific kinases which are activated by a wide range of stimuli including growth factors, mitogens, osmotic stress, etc. These proteins function in a signaling cascade are activated upon ligand binding to a cell surface receptor activating several kinases, which in turn phosphorylate their respective substrates. Upon the extracellular growth factor binding to the ligand, Ras a GTPase exchanges GDP for GTP. This in turn initializes a cascade activating MAP3K (Raf) which in turn activates MAP2K (MEK1/2) which activates MAPK (Erk1/2).

MAPK regulates a number of transcription factors including c-Jun, ELK-1, c-fos etc. These events thereby regulate various cellular activities, such as gene expression, mitosis, differentiation, proliferation, and cell survival/apoptosis.

Erk1/2 has, therefore, been to be translocated from cytoplasm to nucleus to activate downstream transcription factors in response to various stimuli, and a significant fraction (> 50%) of Erk1/2 can be found in the nucleus within 10 minutes after stimulation with growth factor and phorbol ester (Chen et al., 1992). The redistribution of Erk1/2 is regulated by its

- 32 -

interaction with proteins such as β-arrestin, calponin, mitogen activated protein kinase kinase (MEK), and PEA-15 (Menice et al., 1997; Camps et al., 1998). PEA-15 can directly bind to Erk1/2 or pErk1/2 in vitro or in vivo (Araujo et al., 1993). In this regard, therefore, PEA-15 indirectly contributes to maintenance of cellular senescence, and its phosphorylation at S¹⁰⁴ by protein kinase C blocks its interaction with ERK both in vivo and in vitro (Krueger et al., 2005;

Renganathan et al., 2005; Vaidyanathan et al., 2007). The above findings prompted us to explore how PKC isozymes and Erk1/2 interact in tumor promotion and reversal of senescence process by TPA stimulation, and how the kinetics of PKC degradation change in the early and late stages of reverse senescence in response to TPA, focusing on the differential activities of PKCa and PKCb1 in the translocation; PKCb1 was active to dissociate SA-pErk1/2 tethered to PEA-15, and PKCα was a carrier of pErk1/2 in senescent cells. MAPK docking motif and the kinase activity of PKCα were both necessary to transfer SA-pErk1/2 to nuclei of senescent cells. PKCa degradation in nuclei by ubiquitination occurred much earlier than inactivation of pErk1/2, and developed cell proliferation not only in the senescent cells but also in the DMBA-TPA mediated skin carcinogenesis in CD-1 mice, implying that promotion of carcinogenesis undergoes molecular changes similar to those in the reversal of senescence upon TPA stimulation.

- 33 -

Purpose of this study

We have already reported the characteristic phenotypes of cellular senescence; e.g. the cytoplasmic sequestration of pErk1/2 (SA-pErk1/2) in contrast to the nuclear accumulation of G-actin cytoskeleton for the first time by using primary culture of human diploid fibroblasts.

Since that, we were studying the biochemical mechanisms of contrast phenotypes related with cancer and ageing development. As a result, we could identify the roles of ROS and protein kinase C along with pErk1/2 and Sp1, in addition to inactivation of protein phosphatases which can regulate cellular senescence. Moreover, we have demonstrated that senescent cells can be reversed to young cells both in the cell shape, molecular markers, and cell cycle progression (G1 to S phase) along with actin rearrangement upon TPA treatment to old cells. Therefore, we have investigated the mechanism of reverse senescence focused on the nuclear translocation of SA-pErk1/2 by PKC isozymes in response to TPA treatment to old HDF cells and physiological effects of in vivo DMBA/TPA skin carcinogenesis model.

- 34 -

II. MATERIALS AND METHODS A. MATERIALS

TPA and 7, 12-dimethylbenz[a]anthracene were purchased from Sigma (St. Louis, MO, USA).

Antibodies to pErk1/2, Erk1/2, PEA-15pS¹⁰⁴and PEA-15 were from Cell Signaling (Danvers, MA, USA); against PKCβ1, lamin B1, HA, ubiquitin (Ub) and α-tubulin were from Santa Cruz Biotechnology (Santa Cruz, CA, USA); against PKCα from Novus Biologicals (Littleton, CO, USA). Active forms of PKCα and PKCβ1, and PKC activators were purchased from Millipore (Billerica, MA, USA).

B. METHODS

1. Cells culture

HDF cells were isolated in our laboratory from the foreskin of a 4 year-old boy (Lim et al., 2000; Kwak et al., 2004) and the primary culture was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen/GIBCO, Grand Island, NY, USA) supplemented with 10%

fetal bovine serum (FBS; Invitrogen). Number of population doublings and their doubling times were calculated by the published equations (Kim et al., 2009). HDF young cells used in this study represent doubling time of around 26 h, the mid-old and the old cells indicate doubling times of around 4–10 days and over 14 days, respectively. Huh7 cells were cultured in DMEM supplemented with 10% FBS. All cells used in this study were maintained in 5% CO2 incubator at 37 °C.

2. Immunoblot (IB) analysis

Cells were solubilized in RIPA buffer [50 mM Tris/HCl (pH 7.5), 150 mM NaCl, 1.0%

Nonidet P40, 0.1% SDS, 0.5% deoxycholic acid, 1.0 μg/ml leupeptin, 100 μg/ml PMSF, 1.0 mM Na3VO4, 1.0 mM NaF], cleared by centrifugation at 12,000 g for 10 min at 4°C, and then 40 μg of the lysates (per lane) were resolved on 10-15% SDS-PAGE in 25 mM Tris/glycine buffer. The gel-resolved protein bands were transferred to Polyvinylidene fluoride membrane and then treated with 5% non-fat skim milk in PBS containing 0.05% Tween 20 (PBST) for 1 h before incubation with the targeted antibodies overnight at 4 °C. The polyvinylidene fluoride membranes were washed three times with PBST and then incubated with horseradish

- 35 -

peroxidase-conjugated secondary antibodies for 1 h. ECL (Amersham Biosciences, Little Chalfont, UK) kit was employed to visualize protein expression levels.

3. Immunoprecipitation (IP)

Immunoprecipitation was performed with cell lysates (~1.0 mg protein) isolated from the young, old and mid-old HDF cells in the modified RIPA buffer (without 0.1% SDS from RIPA) by the standard method. Whole cell lysates were pre-cleared with protein G-agarose beads (Invitrogen) for 1 h at 4 °C before precipitation for 4 h with targeted primary antibodies at 4 °C.

The immunoprecipitates were washed 5 times with IP buffer, and then subjected to immunoblot analysis with appropriate antibodies.

4. Cells fractionation

Cells were harvested, washed with ice cold 1x PBS, and then lysed in 250 μl of TD buffer [25 mM Tris base (pH 8.0), 2.0 mM MgCl2, 0.25% v/v Nonident P40, 0.5 mM DTT, 1.0 μg/ml leupeptin, 100 μg/ml PMSF, 1.0 mM Na3VO4, 1.0 mM NaF] for 5 min at room temperature (RT). The lysates were centrifuged at 12,000 g for 5 min and the supernatant was collected as cytoplasmic fraction. The pellets were suspended in 125 μl of BL buffer [10 mM Tris (pH 8.0), 0.4 M LiCl, 0.5 mM DTT, 1.0 μg/ml leupeptin, 100 μg/ml PMSF, 1.0 mM Na3VO4, 1.0 mM NaF] for 5 min along with vigorous vortex for few seconds, followed by centrifugation at 12,000 g for 20 min to remove cell debris, and used as nuclear fraction. Protein concentration of each sample was assessed by BioRad protein assay kit (Hercules, CA, USA) and analyzed by IB assay.

5. Immunocytochemistry (ICC)

Cells were cultured on cover slips (18 mm x 18 mm) using 6-well plates, washed twice with 1xPBS before fixation with 4% paraformaldehyde for 15 min, permeabilized with 0.05% Triton X-100 (diluted in 1x PBS) for 15 min, and then subjected to blocking with 3% bovine serum albumin (BSA) in 0.05% Triton X-100 at 4 °C for 2 h. The cells were incubated overnight with primary antibody at 4 °C, with secondary antibody at 4 °C for 2 h, and then stained with 4% 6-diamidino-2-phenylindole (DAPI, 1.0 μg/ml) for 5 min at RT before mounting with Mowiol medium (Hoeschst Celanese, Charlotte, NC, USA) containing antifade 1,4-diazabicyclo[2,2,2]octane (Aldrich, Milwaukee, WI, USA). Expressions of pErk1/2, PKC , PKC mutants, PKCb1 and ubiquitin (Ub) were detected using monoclonal or polyclonal

- 36 -

primary antibodies along with Alexa 488 or Alexa 594 conjugated goat-anti mouse or rabbit IgG as a secondary antibody. Data were visualized with fluorescence microscope and photographed by AxioVision image acquisition with analysis software package (Carl Zeiss MicroImaging GmbH, Jena, Germany) or Images were analyzed using an Eclipse Ti (Nikon, Japan) or an A1 confocal microscope (Nikon, Japan).

6. Two stage skin carcinogenesis

CD-1 male mice (7 week old) were purchased from ORIENT BIO Inc (Seoul, Korea) and acclimatized in the animal house of Ajou University animal facilities for 3 weeks before shaving the hair on the back skin with electric shaver at 1 day before experiment. TPA (5 mg/200 ml acetone) was topically applied on the back skin of the mice for 2 weeks (twice/week) with or without DMBA (100 mg/200 ml acetone) initiation at 1 week before TPA treatment. Mice were sacrificed on 3 days of the TPA final treatment, and then the back skin was surgically removed, spread on dry ice and embedded in the O.C.T. compound (Sakura Finetek, Torrance, CA, USA) for frozen section or fixed in 10% formalin solution for paraffin embedding. Paraffin embedded sections were cut (4 mm thickness) and mounted on microslides and processed for hematoxylin–

eosin (H&E) staining according to the described metheod (Devanand et al., 2014).

7. Immunofluorescence (IF) study

Frozen sections (10 μm thickness) fixed at RT for 15 min were incubated in 0.3% H2O2 in PBS for 10 minto block endogenous peroxidase activity, and then incubated in 0.05% Triton X-100 containing 10% BSA for 40 min at RT before washing 3 times with 1xPBS. The other procedures were followed according to the described method in the immunocytochemistry method. PKC was detected using monoclonal antibody along with Alexa 488 conjugated goat-anti mouse IgG as a secondary goat-antibody.

8. GST-pull down and in vitro kinase-immunoblot analyses

Recombinant GST-PEA15 proteins were expressed in E.coli strain BL21 (DE3) and purified to homogeneity using glutathione agarose 4B beads (Incospharm, Daejeon, Korea). The GST- or GST-PEA15-conjugated glutathione agarose 4B beads were washed twice with kinase buffer [50 mM HEPES, (pH 7.5), 10 mM MgCl2, 1 mM DTT, 2.5 mM EGTA, protease inhibitors and phosphatase inhibitors], and then in vitro kinase assay was initiated with 100 ~200 ng of GST-PEA-15, 400 µM ATP and 0.1 µg each of either active PKCα or PKCβ1 (Millipore, MA, USA) enzyme in 10 µl of the buffer. The mixtures were incubated at 30 °C for 30 min until

- 37 -

termination by adding SDS sample buffer with subsequent boiling for 5 min. Enzyme activity was analyzed by SDS-PAGE and immunoblotting with anti-pPEA15S¹⁰⁴(AssaybioTech, CA, USA) or anti-GST (Santa Cruz) antibodies. GST was employed as a control substrate of the assay.

9. siRNA transfection

siRNAs against PKC (siPKC ) were purchased from Santa Cruz Biotechnology, siPKCβ1 (F- 5’ CAUUACAUUUCAAACUUUAUU 3’, R- 5’ UAAAGUUUGAAAUGUAAUGUU 3’) from Genolution pharmaceuticals (Asan Institute for Life Sciences, Seoul, Republic of Korea), and control siRNAs (siControl) were from DHARMACON (Lafayette, CO, USA). HDF old cells cultured on a cover slip (18 mm x18mm) in 6-well plates were transfected with siRNAs and oligofectamine (Invitrogen) for 4-6 h. After 48 h, the cells were treated with either vehicle (DMSO 0.01%) or TPA (50 ng/ml) for 30 min before subjected to ICC or IB analyses.

10. Plasmid transfection

Huh7 cells cultured in 6-well plates (5 x 10⁴ cells/well) or 100 mm dishes (2x10⁵ cells/well) were transiently transfected with 2 or 10 μg of pHACE (vector), wt-PKCα or mt-PKCα (R^159,161G) using Fugene (Promega, Madison, WI, USA), and then subjected to immunocytochemistry or cell fractionations into nuclei and cytoplasm in 48 h of transfection.

11. Site-directed mutagenesis

To confirm the interaction of PKCα with pErk1/2, three different PKCα mutants [MAPK docking motif (R^{159, 161}G) double mutant, kinase dead PKCα (KD-PKCα) and catalytically active PKCα (CA-PKCα)] were prepared along with wild type PKCα. MAPK docking motif in the regulatory and catalytic domains of PKCα was predicted and searched by using website http://elm.eu.org and based on the published reports (Debata et al.; Yang et al., 1998; Bardwell et al., 2001). Arginine residues at 159 and 161 in the regulatory domain of PKCα were mutated to glycine (R^{159, 161}G) by using Stratagene QuikChange II site-directed mutagenesis kits (Stratagene, La Jolla, CA, USA) according to the manufacturer's recommendations. Wild type PKCα-HA plasmid in pHACE vector was used as a template and the specific mutation was confirmed by DNA sequencing.

12. RNA-seq analysis

The integrity of RNAs isolated from HDF senescent cells treated with TPA for 8 h and 24 h, or DMSO as a vehicle control, was confirmed by bioanalyzer with an Agilent RNA 6000 Pico Kit

- 38 -

(Agilent, Santa Clara, CA), and then mRNA sequencing library was prepared by TruSeq stranded mRNA sample preparation kit (illumina, San Diego, CA) according to manufacturer’s instruction. The functional category analyses of the differentially expressed genes (DEGs) were performed by DAVID (http://david.abcc.ncifcrf.gov), Enrichr (http://amp.pharm.mssm.edu/Enrichr/) or PANTHER (http://pantherdb.org/) tools. The DEGs were selected with the significance level of p<0.001 or false discovery rate<0.05 after multiple testing corrections for the compared conditions, TPA 8 h vs. 0 h (DMSO control) and TPA 24 h vs. 0 h (DMSO control).

12.1 Preprocessing and genome mapping

Potentially existing sequencing adapters and raw quality bases in the raw reads were trimmed by cutadapt software. The option -a AGATCGGAAGAGC and -A AGATCGGAAGAGC were used for the common adapter sequence of the Illumina TruSeq adapters and the option –q 20, 20 was used for trimming low quality 5’ and 3’ ends of the raw reads. The cleaned high quality reads after trimming the low quality bases and sequencing adapters were mapped to the human reference genome hg19 of UCSC genome (https://genome.ucsc.edu) by TopHat2 software (Kim et al., 2013) using bowtie2 tool (Langmead and Salzberg., 2012) internally. Since the sequencing libraries were prepared strand-specifically by using Illumina’s strand-specific library preparation kit, the strand-specific library option, --library-type=fr-firststrand was applied in the mapping process.

12.2 Quantifying gene expression and differential expressed gene analysis

To quantify the mapped reads on the human reference genome into the gene expression values, Cufflinks software (Trapnell et al., 2010) with the strand-specific library option, --library-type=fr-firststrand and other default options were used. Gene annotation of the human reference genome hg19 from UCSC genome (https://genome.ucsc.edu) in GTF format was used as gene models, and the expression values were calculated in fragments per kilobase of transcript per million fragments mapped (FPKM) unit. To compare the expression profiles among the 7 samples, the normalized Z-scores of the logarithmic expression values of the most variable 1,000 genes were subjected to the unsupervised clustering by MeV software of the microarray software suite, TM4 (Saeed et al., 2003). The differentially expressed genes between the two selected biological conditions were analyzed by Cuffdiff software in Cufflinks package

문서에서 Role of protein kinase C isozymes in cellular senescence and reversal of senescence in response to 12-O-tetradecanoylphorbol-13 acetate (TPA) treatment in (페이지 38-122)