B. Methods
11. Electrophoretic Mobility Shift Assay
Nuclear proteins were extracted from the tissues of Group I, II, , IV,
and V. Nuclear proteins (10 mg) were incubated for 30 min at 25 with 20 pg of 32P-labeled oligonucleotides containing the NF- B binding site (GATCGAGGGGGACTTTCCCAGC) and 1 g of poly dI-dC in 5 ml of a solution consisting of 20 mM HEPES, 4 mM MgCl2, 50 mM CaCl2, 1 mM EDTA, 1 mM DTT, and 4% glycerol. The mixtures were loaded onto a non-denaturing 6% polyacrylamide gel with 0.25 × TBE electrophoresis buffer.
After electrophoresis, gels were dried and exposed to the radiography film for 18 h at 70 with intensifying screens. Supershift assays were also performed using rabbit antibodies against four kinds of Rel protein; p50, p65, p52, c-Rel to determine the Rel protein composition of oxygen-derived free radicals-activated NF- B dimers in nuclear extracts of esophageal mucosa of GERD. Each anti-p50, -p65, -p52, -c-Rel antibody (Santa Cruz, CA) was mixed with the
NF-B probe at the start of the 30 min-incubation.
12. Statistical Assay
Results are expressed as the mean±S.E.M.. The data were analysed by one-way analysis of variance (ANOVA), and the stastical significance between groups was determined by Duncan's multiple range test. Statistical significance was accepted with a p<0.05.
. RESULTS
1. The Influence of Stress on H. pylori-associated Gastropathy; Macroscopic and Microscopic Observation
1) The macroscopic changes
H. pylori infection alone only provoked the gastric inflammations in rats.
There were neither ulcerative lesions nor tumorous lesions in the stomach upto 24 weeks after H. pylori infection. WIRS, on the other hand, formed multiple erosions with hemorrhagic changes. By the way, stress significantly increased gastric lesions of H. pylori infection than without H. pylori infection. WIRS of 30 min duration alone did not develop any GML, but when stress was imposed in H. pylori-infected rat, multiple scattered hemorrhagic erosions were noted even after 30 min of WIRS, severe than rats without H. pylori infection. The gastric lesions including erosions and linear ulcerations were appeared after 120 min of WIRS and multifocal hemorrhagic lesion at 480 min. Hemorrhagic, erosive lesions shown at 30 min after WIRS increased number and size of hemorrhagic lesion at 120 and 480 min in H. pylori-infected group and linear ulcerations were noted thereafter. Bleeding index of WIRS alone increased the score by 0.33, 0.75, 0.88 and 0.99 at 30, 120, 480 and 720 min (Fig. 1) and bleeding index of WIRS with H. pylori infection increased the score by 0.38, 0.93, 1.35 and 1.97 at 30, 120, 480 and 720 min, of which index was increased in a time-dependent manner. Compared to WIRS alone, bleeding index of WIRS with H. pylori infection increased at 480 and 720 min respectively with singnificant
difference (p<0.05). Bleeding rates of WIRS alone increased the percentage by 0, 59.6, 69.7 and 80.4 % at 30, 120, 480 and 720 min in time-dependent manner (Fig. 2). Compared to WIRS alone, bleeding rates of WIRS with H. pylori infection significantly increased the percentage by 41.6, 79.9, 90.8 and 100 at 30, 120, 480 and 720 min respectively (p<0.05).
2) The microscopic changes
The WIRS caused serious pathological changes in the stomach, of which severity was significantly increased in accordance with the times of restraint stress. Pathologically, overt gastric ulcer with necrotic bases and exudative changes and inflammatory cell infiltrations, mostly neutrophils were observed.
Only 30 min duration of WIRS caused some erosive changes with inflammatory cells. However, in group affected with both stress and H. pylori infection, the gastric lesions were more brisk and aggravated. In a same time point, the overall pathological changes including hemorrhages and erosions were apparently severe in rats affected with both stress and H. pylori infection than groups of rat only done with WIRS. Microscopic examination of the mucosa after 480 min WIRS-induced GMD revealed widespread damage of the surface epithelium with many cells sloughed off into the gastric lumen and focal area of deep hemorrhagic necrosis. Severe hemorrhagic GMD are observed WIRS-induced GMD with H. pylori infection animals (Fig. 3). Inflammatory cell infiltration and hemorrhage were noted in the lamina proporia as well as submucosa. The degree of mucosal inflammation became more prominent and a mild to moderate decreased thickness layers was also seen during this period.
WIRS alone
WIRS alone
(A) (B)
(C) (D)
Fig. 3. Microscopic observation of WIRS-induced gastric mucosa in rats with or without H. pylori infection after stress loaded 480 min. (A) and (B) were observed inflammation in epithelium on WIRS alone, (C) and (D) were checked severe gastritis and hemorrhage in epithelium on WIRS with H. pylori infection. (A, C ×40, B, D ×100)
2. The Influence of Stress on H. pylori-associated Gastropathy; Changes of Several Mediators Involved in H. pylori-induced Gastric Mucosal Damages
1) Oxidative mediators
The contents of thiobarbituric acid reactive substances (TBA-RS, a marker of lipid peroxidation) were significantly increased in WIRS with H. pylori infection compared to WIRS group without H. pylori infection at 30, 120, 480 and 720 min (*p<0.05, **p<0.01) (Fig. 4). After 720 min of WIRS, TBARS was seen maximum level (4.4 pg/mg of protein).
2) Cytokines
Production of INF- was significantly increased in WIRS with H. pylori infection than without H. pylori infection on time-dependent manner (Fig. 5A).
After 480 min of WIRS, IFN- was seen maximum level (79.0 pg/mg protein), but IFN- was decreased after 720 min. The group of without H. pylori infection didn't change level of IFN- .
The content of TNF- and IL-10 were increased in WIRS with H. pylori infection and no H. pylori infection on time-dependent manner (Fig. 5B). TNF-was not significantly differently among groups.
3) Proteome markers
Changes of proteomic profiles were differentially expressed on WIRS-induced GMD in H. pylori-infected rats (Fig. 6). Identifications of changes spot by SELDI-TOF analysis were seen with the check of genebank identification number. After 30 min in WIRS, Fig. 6A identified three spots into (1) PART1 (putative novel phosphatidylinositol 3 kinase, AAB32956, gi:806955), (2) BMI-1 (murine leukemia viral oncogene homolog, XP_031361, gi:14747007) and (3) hypothetical protein (XP_035122, gi:14783675). After 120 min in WIRS, Fig. 6B identified five spots into (4) nestin (P48681, gi:1346682), (5) mitotic spindle associated protein (AAK91712, gi:15193198), (6) hypothetical protein (XP_044197, gi:14744107), (7) caspase-9 (N92123, gi:1264432) and (8) solute carrier family 26, number 1, isoform b (AAH15517, gi:15930164). And, after 480 min in WIRS, Fig. 6C identified one spot (9) ZA (AAB36122, gi:1478361).
WIRS alone
(A)
Fig. 5. (A) Changes of IFN- on WIRS-induced GMD in rats with H. pylori infection. IFN- was determined at 30, 120, 480 and 720 min for using ELISA kit. *: Significance different from no H. pylori infection vs.
p<0.05. **: Significance different from no H. pylori infection vs. p<0.01.
(B) Changes of TNF- on WIRS-induced GMD in rats H. pylori infection. TNF- was determined at 30, 120, 480 and 720 min for using ELISA kit. IFN- and TNF- were checked severe gastritis and hemorrhage in epithelium on WIRS with H. pylori infection. *:
Significance different from no H. pylori infection vs. p<0.05. **:
Significance different from no H. pylori infection vs. p<0.01.
(A) (B) (C)
Fig. 6. Change of proteomic profiles at 30 (A), 120 (B) and 480 (C) min on WIRS-induced GMD in H. pylori-infected rats. Identification for differentially expressed spot by 2-dimensional gel electrophoresis analysis from genebank identification numbers as described in the mateials and methods. At 30, 120 and 480 min, we observed detection of three, five and one spot on WIRS-indued GMD in H. pylori-infected rats.
3. The Influence of Stress on H. pylori-associated Gastropathy; Changes of Heat Shock Proteins (HSPs)
1) Western blot analysis
H. pylori infection alone decreased expression of HSP70 and HSP27, but heat-induced stress increased expression of HSP90, HSP70 and HSP27 in AGS cells (Fig. 7). In H. pylori infected AGS cell, heat shock increased HSP70, but decreased HSP27. The changes of other HSPs including HSP90 and HSC70 were not significant.
2) 2-D gel electrophoresis with blotting
Fig. 8 showed the overall change of proteome spots according to the times after heat shock in AGS cell. There was no significant change of HSP90 in spite time passages. However, when we transferred the whole proteome spots separated by 2D-gel electrophoresis in to NC paper and applied with each specific antibodies of various HSPs, the change of HSP expression were significantly different according to time points. As times passed, significant phosphorylation of HSP90 and HSP27 wre noted and also heat shock or H.
pylori infection triggered the significant phosphorylation of these proteins (Fig.
9). When the cells were treated with both H. pylori and heat shock, these phosphorylations of HSP90 were significantly increased, reflecting that H. pylori or stress and both provoked the activation of HSP90 rather than the changes of amounts.
- + - +
70, and 90 antibodies, respectively. Proteins amounts were balanced with-tubulin amounts.
Control + Heat shock + Heat shock
presence of H. pylori
Fig. 8. 2 D-gel electrophoresis. Isoelectric focusing with PAGE separation was done in each group, control, heat shock, and H. pylori infection. Each spots were analyzed with Image Analyser.
HSP90
pylori and heat shock together induced more apparent phosphorylation of HSP90, which might be the principal mechanism of gastric mucosal damages.
4. Prevention of Stress-induced Augmented Gastric Lesions with Antioxidants
1) Macroscopic and Microscopic evidences
As shown in Fig. 10, treatment of DA-9601 (6, 20 mg/kg, po) or -tocopherol (40 mg/kg, po) significantly attenuated the severity of WIRS-induced GMD in H. pylori-infected rats. Rats were sacrificed and fixed with 10% neutral
In the control group, pathological changes were noted with hemorrhagic GMD at 120 and 480 min after WIRS in H. pylori-infected rats (Fig. 11A). At 120 min after WIRS, control was mainly observed hemorrhagic site and inflammation-related factors in epithelium of fundic area, and severe hemorrhagic gastritis at 480 min after WIRS. DA-9601 (20 mg/kg) was not seen GMD at 120 min after WIRS, and observed weakly GMD without hemorrhage at 480 min after WIRS (Fig. 11B).
2) Molecular evidences; Western blot of HSP changes
The changes of various HSPs was determined by Western blotting with antibody against HSP90, HSP70 and HSP27 (Fig. 12). DA-9601 significantly increased HSP70 and HSP27 expressions on WIRS-induced GML of H.
pylori-infected rats.
3) Molecular evidences; RNase protection assay
The changes of mRNA of inflammation-related cytokines and apoptosis-related factors were measured by RPA using the RNA obtained from rat gastric mucosa of each group. The TNF- , TGF- 1, MIF and IFN- mRNA transcript with two housekeeping gene, L32 and GAPDH were detected in the rat gastric mucosa using rck-3 multi probe template set (Fig. 13). Antioxidant treatment significantly decreased these inflammatory cytokines mRNA expression levels at 0.5, 2 or 8 h after WIRS inducetion in H. pylori-infected rats.
Similarily Bcl-xL, caspase-1, caspage-2, caspase-3 mRNA transcript with two housekeeping gene, L32 and GAPDH were detected in the rat gastric mucosa using rAPO multi probe template set, although the level of mRNA expression weak (Fig. 14). Antioxidant increased these apoptosis-related mRNA expression levels at 30, 120 or 480 min after WIRS inducetion in H.
pylori-infected rats, suggesting the preventive induction of apoptosis related gene transcript to prevent the necroinflammation.
4) Molecular evidences; NF- B DNA bindings
Fig. 15 shows the NF- B complex of nuclear proteins extracted from each group. Pretreatment with DA-9601 significantly decreased NF- B DNA binding in a dose dependent manner, suggesting the antioxidant regulated the transcriptional binding for either cytokines or other inflammation related genes.
(A) (B)
(C) (D)
(A) (B)
(C) (D)
Fig. 10. Representative macroscopic findings of the gastric mucosa of rats.
At 480 min of WIRS-induced stress, we observed gastric mucosa in H.
pylori infection rats. These groups are (A) control, (B) DA-9601 6 mg/kg, (C) DA-9601 20 mg/kg, and (D) -tocopherol 40 mg/kg.
(A ) (B )
(C ) (D )
Fig. 11. Microscopic observation of WIRS-induced GMD in H. pylori- infected rats. (A) and (B) denoted the representive gastric pathology in rats affected with both H. pylori infection and WIRS 120 and 480 minutes, respectively. (A) and (B) denoted the gastric pathology in group treated with DA-9601 at 120 and 480 min, respectively. Significant protection was noted in rats pretreated with antioxidant.
3 0 1 2 0 4 8 0 3 0 1 2 0 4 8 0
WIRS alone
WIRS pretreated With DA -9601
HSP27 HSP70 HSP90
3 0 1 2 0 4 8 0 3 0 1 2 0 4 8 0
WIRS alone
WIRS pretreated With DA -9601
HSP27 HSP70 HSP90
Fig. 12. Effect of antioxidant on HSPs expressions according to group.
DA-9601 treatment induced significant levels of HSP70 and HSP27, which might be involved in the protective action against WIRS in rats.
1 2 3 4 5 6 7 8 9 1 0 were hybridized with radiolabelled multi-probes hybridizing with inflammation associated cytokines, which included IFN- , TNF- , GM-CSF, TGF- 1, TGF- 3, TGF- 2, LT-b, TNF- , MIF and IFN- with
F a s A g ( 4 3 5 )
N F -κB
1 2 3 4 5 6 7 8
N F -κB
1 2 3 4 5 6 7 8
Fig. 15. Effect of NF-κ B by DA-9601 on WIRS-induced GMD in rats with H. pylori infection. NF-κB DNA binding activities were measured by electrophoretic mobility shift assay using 32P-labeled oligonucleotide coding NF-κB binding sites Significant increased in NF-κB binding activities were noted after H. pylori infection or H. pylori infection and heat shock and these radiactivities were markedly decreased with antioxidant treatment Lane 1: no probe 2: control cells (30 min) 3: H.
pylori infection 4: H. pylori infection + heat shock 5: H. pylori + heat shock pretreated with DA-9601 6: H. pylori infection 7: H. pylori infection + heat shock 8: H. pylori + heat shock pretreated with DA-9601.
. DISCUSSION
The present study showed for the first time that the gastric lesion by H.
pylori could be augmented by both stress and oxidative stress and the dysregulation of heat shock protein might be responsible for augmented gastric lesion. These findings can explain why the incidence of gastric cancer is so high in Korea, because we can infer that the high prevalence of H. pylori infection and complex social structure might lead to notoriously high incidence of gastric cancer in Korea.
As major etiologic factors leading to peptic ulcer disease, and hypersecretion, smoking, alcohol, NSAIDs, bile acid, and stress are considered.
The German blitz in London, the Kobe Hanshin great earthquake, economic crisis in Sophia, and sovereignty negotiations in Hong Kong have all been followed by an abrupt increase in peptic ulcers of both the stomach and the duodenum.31-33 By the way the evidence that psychological stress is one of those factors is not invalidated by the discovery of H. pylori. Among potential mediators, several known behavioral risk factors for ulcers - smoking, alcohol abuse, and lack of sleep - have clear associations with real-life stress and are known to impair wound healing through their effects on immune function.34 On the physiological side, stress is known to modify gastric blood flow, which plays an important role in the gastric mucosal barrier, and to affect possible mediators such as thyrotropin-releasing hormone, cytokines, and corticotropin-releasing hormone. Besides, stress seems to have variable effects on gastric motility:
delayed gastric emptying could increase the risk of gastric ulcer, while augment the stress-induced erosions.16 And, Yamamoto reported that H. pylori infected C57BL/6 mice increased the severity of mucosal injury at 30 min of significantly higher than without H. pylori infection. In histological observation and inflammation-mediated factors, stress augmented inflammation of gastric mucosa, and increased TBA-RS, IFN- , and TNF- in gastric mucosa layer with H. pylori infection.
The changes in oxygen-free radicals and pro-inflammatory cytokines are induced by both stress and H. pylori, but their roles in the development of gastric ulcers are not fully understood.15,16,43 Recent reports suggest that the effect of altered cytokines may be different in stress-induced and H. pylori-associated ulcers. For example, Matsushima et al. reported that both Helicobater felis infection and water-immersion stress induced a similar IL-1 response.40 And, we found that the Th1 lymphocytic responses were augmented in group affected with both stress and H. pylori infection, suggesting the intense involvement of gastric inflammation after H. pylori infection was increased. The production of IFN- and TNF- was significantly higher in the infected than in the uninfected inflammatory cell reaction suggest that additional mechanisms may be involved in the formation of gastric mucosal injuries in the early phase of stress treatment.
In H. pylori-infected gastric mucosa, significant generations of oxidative radicals was involved. NH3 derived from H. pylori reacts with HOCl to yield monochloramine (NH2Cl) and these liphophilic compounds freely penetrates biological membranes to oxidize intracellular components.47 Therefore, a new therapeutic approach using agents that inhibit reactive oxygen species (ROS) production from activated neutrophils or scavenging ROS has been proposed for
H. pylori associated gastric mucosal inflammation. We and other groups have demonstrated that some kinds of gastroprotective drugs, such as rebamipide, polaprezine, and ecabet sodium, have these properties documented in vitro and in vivo.48,49 In the stress and H. pylori infected condition, ROS from neutrophils could play an important role in the pathogenesis of gastric mucosal injury.50-52 Under WIRS, gastric mucosal oxidative stress as well as lesion formation were attenuated by treatment with the xanthine oxidase inhibitor, allopurinol, suggesting the importance of xanthine/xanthine oxidase system for the development of ischemic-reperfusion injury in the stomach.53 The most important physiological function of antioxidant enzymes like peroxidase, catalase, and glutathione peroxidase is to detoxify cellular H2O2 to prevent oxidative damage
through a metal-catalysed Haber-Weiss reaction.56 Neutrophil accumulation in stomach clogged the microvasculature, thus causing tissue ischemia.57 Accumulation of H2O2, which not only causes oxidative damage of the gastric mucosa, but also leads to apoptotic cell death during ulceration.58,59 Our results confirmed that H. pylori increased contents of TBA-RS in WIRS-induced GMD.
In the current experiment, antioxidant treatment including -tocopherol or DA-9601 reported to possessing the antioxidative actions in the stomach, ameliorated the gastric lesions provoked by both stress and H. pylori infection.
-Tocopherol is known to antioxidant, and DA-9601 is ethanol extract of Artemisia asiatica possesses antioxidative and antiinflammatory activities.
DA-9601 mainly contribute to its protective effects against experimentally induced gastric damage (gastritis, gastric ulcer and duodenal ulcer) in animal models.60-62 The mechanisms of DA-9601 are known as antioxidantive effect, anti-inflammatory effect, reepithelization of gastric mucosa and cytoprotective effects, potentially.63-65 Recently, DA-9601 evaluated chemopreventive effect on phorbol ester-induced ornithine decarboxylas activity, papilloma foemation, COX2 expression, iNOS expression, NF- B activation in mous skin.66
Similarily the antioxidant administration markedly decreased the mRNA of several inflammatory cytokines and even transcription factor like NF- B, known to be inflammation-associated transcription factor. H. pylori activated NF- B in gastric mucosa in vivo and cultured epithelial cells in vitro.67 Maeda et al.
identified upstream mediators that regulate H. pylori-induced NF- B-dependent IL-8 production.68 H. pylori-induced apoptosis in gastric epithelial cells is suppressed by inhibition of NF- B activation using catalase, pyrrolidine dithiocarbamate, an antisense oligonucleotide for NF- B subunit p50, or peroxisome proliferator-activated receptor ligands. Kanai et al. who noted that TGF- plays an anti-apoptotic role in gastric mucosal cells by enhancing the expression of Bcl-2 family proteins via an NF- B-dependent pathway.69 Antioxidant, -tocopherol and DA-9601, weakened inflammation via inhibition of ROS production and DA-9601 especially decreased inflammation and apoptosis-mediators in RPA and reduced NF- B activation in EMSA.
Another important changes in stress and H. pylori-associated gastric lesions
were the changes of molecular chaperones in our study. One of these key organisms to show transient protection from the adverse effects of subsequent heat or chemical stresses.79 Evidence for the protective effects of individual heat shock proteins has been reported for human HSP27, yeast HSP104, human HSP70, mammalian HSP90, and Drosophila HSP27.80-84 The level of HSP90 is
generally similar, ubiquitously existed and expressed, in most tissues, with the played an important role in the intracellular mechanism of gastric protection against ethanol.87 HSP70 induction after a conditioned emotional stress would be cytoprotective for gastric mucosal oxidative injury.88 Koh et al. study showed a significant increase in MPO activity in the conditions without HSP70 induction and a significant reduction in MPO activity with HSP induction.89
In the current our experiment, very important finding was grawn from the 2D-gel electrophoresis experiment showing the active phosphorylation of HSP90 was noted after either H. pylori infection or heat shock. These phosphorylation was further active after the challenge of both stress and H. pylori infection.
Similar finding was also observed in HSP27 (Fig. 9). Recently, HSP90 is regarded as significant oncoprotein, based on which, multiple targets for HSP90 were tried in clinical field as promising anticancer agents. HSP90 is constitutively expressed at 2 10 fold higher levels in tumor cells compared with their normal counterparts, suggesting that it could be crucially important for the growth and/or survival of tumors. These can be explained by the fact that as
Similar finding was also observed in HSP27 (Fig. 9). Recently, HSP90 is regarded as significant oncoprotein, based on which, multiple targets for HSP90 were tried in clinical field as promising anticancer agents. HSP90 is constitutively expressed at 2 10 fold higher levels in tumor cells compared with their normal counterparts, suggesting that it could be crucially important for the growth and/or survival of tumors. These can be explained by the fact that as