Wild-type (wt) subtype adw R9 designated as a pPB and polymerase-deficient mutant of HBV designated as a P polymerase-deficient were constructed under the cytomegalovirus immediate early (IE) promoter (Kim et al., 2004). DHBV clone was kindly provided from Dr. W. Mason, Fox Chase Cancer Center, USA (NCBI accession number; K01834).
To generate the HBV polymerase gene under the CMV promoter that has full
8
length of HBV polymerase gene, PCR was performed. In brief, HBV polymerase gene was amplified by PCR with the sense mutagenic primer HBV 23 that contained HindIII site and Kozak sequence and the antisense primer HBV 21. The resulting 660
bp of PCR product was digested with HindIII and BstEII, and cloned into the corresponding restriction sites of pPB, yielding pHBV pol. To generate the DHBV polymerase gene under the CMV promoter, PCR and fragment ligation were performed. Part of DHBV polymerase gene was amplified by PCR with the sense mutagenic primer DHBV 1 that target nt 20-50 of DHBV genome (5′-GGAATTCGCCACCATGCAAAAATTAACGACGAATCACTGGATAG-3′) and the antisense primer DHBV 2 that target nt 474-450 of DHBV genome (5′-GTACAGCCCTTCATTTGATATAGTC-3′). The resulting 450 bp of PCR product
was digested with EcoRI and BglII. The pcDNA3 vector was digested with same restriction enzyme and then two fragments from PCR and vector were ligated and redigested with BglII to obtain the ligated fragment. Full-length DHBV sequences were digested with BglII and EcoRI to get most of DHBV DNA polymerase, resulting 2.6 Kbp fragment. This 2.6 Kbp fragment was cloned into pcDNA3 vector that had been digested with same enzymes, resulting pDA. The BglII digested 1.3 Kbp fragment was cloned into the corresponding restriction sites of pDA, resulting pDHBV pol.
Primer sets used to construct chimeric DNA polymerases were shown in Table 1. The alignment of amino acid sequence of HBV DNA polymerase and DHBV DNA polymerase is shown in Fig. 1.
9
To generate pDTN construct under the CMV promoter that has N terminal region of DHBV TP, PCR was performed. The N-terminal region of DHBV TP domain was amplified by PCR with the antisense mutagenic primer HBV 44 and the sense primer PC 3, which binds to the CMV promoter region of pcDNA3. The HBV sequence to be fused with N-terminal region of DHBV TP was amplified by sense mutagenic primer HBV 45 and antisense primer HBV 21. The resulting 950 bp and 300 bp of PCR products were combined by fusion PCR. The fusion PCR product was digested with SnaBI and BstEII, and cloned into the corresponding restriction sites of wt HBV DNA polymerase, yielding pDTN. For pDTC that has C terminal region of DHBV TP, HBV was amplified with the antisense mutagenic primer HBV 47 and sense primer PC 3. The DHBV sequence to be fused with N-terminal region of HBV TP was amplified with sense mutagenic primer HBV 46 and antisense primer HBV 48 with BstEII site. The resulting 700 bp and 200 bp of PCR products were combined by fusion PCR. The 900 bp of fusion PCR product was digested with BspEI and BstEII, and cloned into the corresponding restriction sites of wt HBV
DNA polymerase, yielding pDTC. For pDS that has spacer domain of DHBV, DHBV DNA polymerase was amplified with HBV 50, the antisense mutagenic primer and HBV 49, the sense mutagenic primer with BstEII. HBV 51, the sense mutagenic primer, and HBV 8, the antisense primer, was used to amplify the HBV sequence to be fused with spacer of DHBV. The resulting 500 bp and 600 bp of PCR products were combined by fusion PCR. The 1.1 Kbp of fusion PCR product was digested with XcmI and BstEII, and cloned into the corresponding restriction sites of wt HBV
10
DNA polymerase, yielding pDS. For pDRN that has the N terminal region of DHBV RT, DHBV DNA polymerase was amplified with HBV 56, the antisense mutagenic primer, and HBV 3, the sense primer. The HBV sequence to be fused with N-terminal region of DHBV RT was amplified by sense mutagenic primer HBV 57 and antisense mutagenic primer HBV 58. The other HBV sequence to be fused with N-terminal region of DHBV RT was amplified by sense mutagenic primer HBV 59 and antisense primer HBV 19. The resulting 170 bp, 400 bp and 1 Kbp of PCR products were combined for fusion PCR. The resulting 550 bp of the second fusion PCR product was combined with 1 Kbp first PCR product by third PCR. The resulting 1.6 Kbp PCR fragment was digested with EcoRI and EcoRV, and cloned into the corresponding restriction sites of wt HBV DNA polymerase, yielding pDRN. For pDRC that has the C-terminal region of DHBV RT, DHBV DNA polymerase was amplified with the antisense mutagenic primer HBV 60 and sense primer HBV 4.
The DHBV sequence to be fused with C-terminal region of DHBV RT was amplified by sense mutagenic primer HBV 61 and antisense mutagenic primer HBV 63. The other HBV sequence to be fused with C-terminal region of DHBV RT was amplified by sense mutagenic primer HBV 63 and antisense primer HBV 19. The resulting 380 bp, 450 bp and 640 bp of PCR products were combined by fusion PCR. The resulting 800 bp of second fusion PCR product was combined with 640 bp of first PCR products. The resulting 1.5 Kbp of third PCR fragment was digested with XcmI and SacII, and cloned into the corresponding restriction sites of wt HBV DNA polymerase, yielding pDRC. For pDHN that has the N-terminal region of DHBV
11
RNase H, DHBV DNA polymerase was amplified with the antisense mutagenic primer HBV 64 and sense primer HBV 4. The DHBV sequence to be fused with N-terminal region of DHBV RNase H, DHBV sequence was amplified with sense mutagenic primer HBV 65 and antisense mutagenic primer HBV 66. The other HBV sequence to be fused with N-terminal region of DHBV RNase H, HBV sequence was amplified by sense mutagenic primer HBV 67 and antisense primer PC 5 that binds to the upstream of SP6 promoter region of pcDNA3. The resulting 800 bp, 300 bp and 500 bp of PCR products were combined by fusion PCR. The resulting 800 bp of second fusion PCR product was combined with 800 bp of first PCR product. The resulting 1.6 Kbp of third PCR fragment was digested with EcoRV and NotI, and cloned into the corresponding restriction sites of wt HBV DNA polymerase, yielding pDHN. For pDH1Cdε that has C-terminal 35 amino acids of DHBV RNase H,
DHBV DNA polymerase was amplified with sense mutagenic primer HBV 52 and antisense primer PC 5 that binds to upstream of SP6 promoter of pcDNA3. The HBV sequence to be fused with C-terminal 35 amino acids of DHBV RNase H was amplified with sense primer HBV 18 and antisense mutagenic primer HBV 53. The resulting 110 bp and 670 bp of PCR products were combined by fusion PCR. 750 bp of fusion PCR product was digested with SacII and NotI, and cloned into the corresponding restriction sites of wt HBV DNA polymerase, yielding pDH1Cdε. For pDH2Cdε that has C-terminal 35 amino acids of DHBV RNase H, DHBV DNA polymerase was amplified with the sense mutagenic primer HBV 54 and sense primer PC 5. The HBV sequence to be fused with C-terminal 35 amino acids of
12
DHBV RNase H was amplified by sense primer HBV 18 and antisense mutagenic primer HBV 55. The resulting 160 bp and 670 bp of PCR products were combined by fusion PCR. The 800 bp of fusion PCR product was digested with SacII and NotI, and cloned into the corresponding restriction sites of wt HBV DNA polymerase, yielding pDH2Cdε. To replace the epsilon region of DHBV in DH1Cdε and pDH2Cdε to HBV, epsilon part of HBV from pPB was amplified with sense mutagenic primer HBV 72 and antisense primer PC 5. pDH1Cdε and pDH2Cdε were
amplified with sense primer HBV 18 and antisense mutagenic primer HBV 73, respectively. The combined resulting 600 bp and 650 bp products were digested with SacII and NotI, and cloned into the corresponding restriction sites of pDH1Cdε and pDH2Cdε constructs, yielding pDH1C and pDH2C construct, respectively. The pDH1Cdε and pDH1C constructs or the pDH2Cdε and pDH2C constructs have
C-terminal 35 amino acid of DHBV RNase H region, but the joining site with HBV RNase H are different each other (Fig. 1). All constructs were sequenced to confirm the presence of specific mutations and to ensure that no extraneous mutations were introduced during PCR.
13
Table 1. Primers used for chimeric DNA polymerase construction. For chimeric DNA polymerases construction, nucleotide positions of primers are given starting on the first dA residue of the EcoRI site of adw R9 wt genome and on the first dC residue of the EcoRI site of DHBV genome (NCBI accession number; K01834).
< Name >
14
(continued)
< Name >
Primer
Sequence
Site (nt)
< DRN >
HBV 3 HBV 56
HBV 57
HBV 58
HBV 59
HBV 19
CCACCTCT AAGAGACAGTC
TTTTTATCACT GCGGAGATTGACGAGATGTG
GTCAATCTCCGC AGTGATAAAAACTCCCCCCTTG
CAGTGGGGGAA GCGACGAGAGATTTCGGATC
CTCTCGTCGC TTCCCCCACTGTTTGGCTTTC
GTGCGCAGACCAATTTATGC
H (3183-3201) H (11 0 -1 31 ) D (1252-1263) H (120 -132 ) D (1253-1274) H (714 -724 ) D (1659-1678) H (714 -735 ) D (1669-1678) H (1789-1808)
15
(continued)
< Name >
Primer
Sequence
Site (nt)
< DRC >
HBV 4 HBV 60
HBV 61
HBV 62
HBV 63
HBV 19
CCAATCACTCACCAACCTCC
CAAACGTTAA AGCCCTACGAACCACTGAAC
TCGTAGGGCT TTTAACGTTTGGACTTTCAC
CACAGACCAGG TGGCTTTATTCTTAATTTAC
GAATAAAGCCA CCTGGTCTGTGCCAAGTGTTTG
GTGCGCAGACCAATTTATGC
H (328-3470) H (694 -713 ) D (1680-1689) H (704 -714 ) D (1679-1698) H (1167-1177) D (2112-2131) H (1167-1188) D (2121-2131)
H (1789-1808)
16
(continued)
< Name >
Primer
Sequence
Site (nt)
< DHN >
HBV 5 HBV 64
HBV 65
HBV 66
HBV 67
PC 5
GCTTTCAGCTATATGGATG
CAGAGGACTT CCGTTGCCGAGCAACGGGGT
CTCGGCAACGG AAGTCCTCTGTACCTTTGC
CAAGCGGCC CCTGGATGGGCCGTCAGCAGGA
GCCCATCCAGG GGCCGCTTGGGACTCTCTCG
GCATTTAGGTGACACTGTAG
H (729 -747 ) H (1147-1166) D (2132-2141) H (1156-1166) D (2132-2150) H (1470-1478) D (2425-2446) H (1470-1489) D (2436-2446) 9 9 9 - 1 0 1 8
17
18