Aim of the study

In previous study, we reported that BTG2 can enhance H2O2-induced cardiomyoblast necrotic cell death [33]. Although it has been reported that BTG2 expressed cancer cells are more sensitive to chemotherapy and radiotherapy, its molecular mechanism has not yet been fully elucidated. Therefore, in this study, we tried to investigate enhanced cell death mechanism by BTG2 and analyze its clinical significance in tumor sample and clinical data of lung cancer patients treated with chemotherapy.

６

2. MATERIALS AND METHODS

2.1. Cells and reagents.

HeLa, MCF7, A549, and 293T cells were grown in DMEM and MDA-MB-231 in RPMI-1640 supplemented with 10% fetal bovine serum and 100 U/mL gentamycin at 37^oC and 5% CO2.

Actinomycin D and cisplatin were obtained from Sigma Chemical Co. (St Louis, MO).

2.2. Preparation and transduction of adenoviruses

Adenoviruses expressing BTG2 gene (Ad-BTG2-HA) and bacterial β-galactosidase (Ad-LacZ) were prepared in our laboratory [24], and indicated moi of Ad-BTG2 or Ad-LacZ were transduced to A549, MCF7, MDA-MB 213, and HeLa for 48 h.

2.3. Reverse transcriptional and real-time PCR analysis

Total cellular RNAs were extracted from cells with RNAiso Plus (Takara Inc., Kyoto, Japan) and dissolved in the diethylpyrocarbonate-treated water to quantify by UV scanning. First-strand cDNA was synthesized by reverse transcription reaction using oligo-dT primers from 1 μg of total cellular RNA using a PCR kit (Takara Inc). Glyceraldehyde 3-phosphate dehydrogenase was used as a control.

Real-time PCR was carried out with Power SYBR Green PCR Master Mix (Bio-Rad, Hercules, CA, USA) using the following conditions: initial activation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The primers used for real-time PCR were given in Supplementary Table.

2.4. Western blot and immunoprecipitation (IP) analyses

Western blot analyses were performed by standard method. Cell lysates (40 ug) prepared in RIPA buffer with phosphatase inhibitors were separated on SDS-PAGE before transfer to PVDF membrane (Millipore Corp). Blots were hybridized with primary antibodies and visualized by ECL system (Amersham Biosciences, Buckinghamshire, UK). The antibodies were purchased, anti-V5, Bcl-XL, Bcl2, and anti MCL from Cell signaling, PARP from Abcam, HA, anti-hnRNPC and anti--actin from Santa Cruz Biotechnology. For immunoprecipitation analysis, cells were broken by sonication in E1A buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 0.1% NP-40, 5 mM EDTA, protease inhibitors), and the whole cell lysates (1 mg) were incubated with primary antibody overnight at 4 °C and the immunocomplexes were collected with protein G agarose slurry for 2 h at 4 °C before subjected to Western blot analysis.

2.5. Knockdown of BTG2 using siRNA

７

To knockdown RNA expressions, cells (2 × 10⁵ per 60-mm dish) were incubated for 24h, and then transfected with siRNAs (50 nM) using RNAiMAX reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. After 24-48 hours, the messenger RNA levels of each gene were analyzed by immunoblotting or reverse transcriptional and real-time PCR analyses. siRNA mixture of BTG2 comprised siBTG2 #1 (5′-gaaccgacaugcucccggauu-3), siBTG2 #2 (5′-gcauucgcaucaaccacaauu-3′), siBTG2 #3 (5′-ggucauagagcuaccguauuu-(5′-gcauucgcaucaaccacaauu-3′), siBTG2 #4 (5′-agacaaagguuacuaauuguu-(5′-gcauucgcaucaaccacaauu-3′), and siBTG2 #5 (5′-gagcuauuuauauauauuauu-3′).

2.6. Construction of BTG2 and CNOT7 overexpressing plasmids and site-directed mutagenesis cDNAs encoding full length human BTG2, CNOT7 were generated by RT-PCR from RNAs extracted from 293T cells. Plasmids expressing wild type and mutant BTG2, CNOT7 were made by cloning the cDNAs into a pcDNA3-based HA-epitope or V5-epitope tagging vector, respectively.

Mutations were introduced by sitedirected mutagenesis using the QuickChange Kit (Stratagene).

2.7. Immunoprecipitation of RNP complexes and RT-PCR.

Immunoprecipitation of endogenous RNA protein complexes was previously described [52].

Briefly, two million HeLa cells were crosslinked with 1% formaldehyde for 10 minutes at room temperature, whereupon glycine was added to stop the crosslinking reaction. The cells were then washed with PBS, resuspended in 1 ml RIPA buffer, and sonicated. The supernatant obtained after centrifugation was used for IP using either IgG1 or hnRNP C antibody for 1 h at room temperature.

The beads were washed three times with 1 ml high-stringency RIPA buffer, resuspended in 100 μl elution buffer and kept at 70°C for 45 min to reverse the crosslinks. SDS-PAGE sample buffer was added to the supernatant obtained after reversal of crosslinks and proteins were subjected to SDS-PAGE and Western blotting using an anti-hnRNP C antibody.

2.8. Synthesis of Biotinylated Transcripts and Biotin pull-down assays

Biotin pull-down assays were performed as described [53] Briefly, for in vitro synthesis of biotinylated transcripts, reverse-transcribed total RNA was used as the template for PCR amplification using 5' oligonucleotides that contained the T7 RNA polymerase promoter sequence (T7, CCAAGCTTCTAATACGACTCACTATAGGGAGA). Oligonucleotide pairs (sense and antisense) used to synthesize DNA templates for the production of biotinylated transcripts were as follows for

the 3’UTR of Bcl-XL, A: (T7)CCAGACACTGACCATCCACTCTAC and

TCAATTCTGAGGCCACAAACAT , B: (T7)GTTTGTGGCCTCAGAATTGA and

ATAGCTCCCTTTCACCTCAG , C: (T7)AGGTGAAAGGGAGC-TATCAGGA and

CTAGTCTCAAATATGTACAGCAGAG , D: (T7)GCTGTACATATTTGAGACTAG and

８

CACTGAGTAAACACAGTTTATT; for the 3’UTR of GAPDH, (T7)CCTCAA

CGACCACTTTGTCA and GGTTGAGCACAGGGTA CTTTATT. PCR-amplified products were used as templates for the synthesis of the corresponding biotinylated RNAs using T7 RNA polymerase and biotin-CTP. Biotin pulldown assays were carried out by incubating whole-cell lysates with purified biotinylated transcripts (25 μg lysate, 1 μg RNA) for 1 h at 25 °C. Complexes were isolated with paramagnetic streptavidin-conjugated Dynabeads (Dynal, Oslo, Norway), and bound proteins in the pulldown material were analyzed by Western blotting using monoclonal antibodies for hnRNP C.

2.9. Measurement of cell viability.

Cell viability after various treatments for indicated times was assessed by trypan blue dye exclusion (Sigma-Aldrich). For the assay, 4 x 10⁴ cells were plated in 12-well plates and treated with chemicals the next day. Cells were trypsinized and mixed with 0.4% trypan blue (1:1). Percentage of viable cells represents the number of unstained cells/number of total cells x 100.

2.10. Immunohistochemical staining for BTG2

Paraffin-embedded cancer tissues obtained at the time of initial diagnosis were used for all patients. Sections were deparaffinized in xylene and rehydrated in graded alcohols and water. For antigen retrieval, specimens were exposed to 10 mM citrate buffer (pH 6.0) and heated for 15 min in a water bath (120 °C). Endogenous peroxidase activity was blocked by treatment with 3% hydrogen peroxide for 10 min. Sections were treated with protein-blocking solution and then with primary antibodies overnight at 4 °C. Primary antibodies were rabbit anti-human polyclonal antibodies against BTG2 (dilution, 1:50, GeneTex, Irvine, CA, USA). After several rinses in phosphate-buffered saline, the sections were incubated in the biotinylated secondary antibody. Bound antibodies were detected by the streptavidin–biotin method with a Cap-Plus detection kit (Zymed Laboratories Inc., San Francisco, CA, USA). Slides were rinsed in phosphate-buffered saline, exposed to diaminobenzidine, and counterstained with Mayer’s hematoxylin.

Negative controls for these proteins were made by the omission of the primary antibody during the process of immunohistochemical staining. For a positive control for BTG2, human brain tissue was used. The slides were examined independently by two observers (J.H. Kim, J.H. Han) blinded to both clinical and pathologic data. In case of disagreement, final grading was determined by consensus.

Expression of the proteins was quantified using a visual grading system based on the extent of staining (percentage of positive tumor cells; graded on a scale of 0 to 3: 0, none; 1, 1-29%; 2, 30-60%;

3, >60%) and the intensity of staining (graded on a scale of 0 to 3: 0, no staining; 1, weak staining; 2, moderate staining; 3, strong staining). A semi-quantitative H-score was obtained by multiplying the

９

grades of extent and intensity of staining. The median value of all the H-scores was chosen a priori as the cut off value for dividing the expression of the proteins into high and low.

2.11. Patients and clinical review

All patients with advanced non-small cell lung cancer (NSCLC) who initiated first-line platinum-based doublet palliative chemotherapy between January 2002 and December 2016 at our institution were retrospectively identified. The criteria for eligibility were histologically or cytologically documented squamous cell carcinoma of lung, either stage IV according to the 7th edition of the American Joint Committee on Cancer (AJCC) [54] or stage IIIB/recurrent disease unsuitable for definitive local therapy. Patients with locally advanced or recurrent NSCLC who underwent palliative chemotherapy due to progression after initial definitive chemoradiotherapy or radiotherapy were excluded.

A retrospective review of the clinical information of eligible patients was performed. Data on the patients including patient characteristics (age, gender, smoking history, performance status (PS) based on the Eastern Cooperative Oncology Group (ECOG) performance scale, histology, clinical stage at diagnosis), chemotherapy regimen, objective response according to the Response Evaluation Criteria in Solid Tumors criteria [55], and survival information were collected. This research protocol was approved by the Institutional Review Board of Ajou University Hospital (AJIRB-MED-KSP-17-385).

2.12. Public database analysis

Oncomine (http://www.oncomine.org), an online microarray database, was used to analyze the mRNA expression differences of BTG2 between tumor of resistant or sensitive to cisplatin, 5-FU, and etoposide. TCGA data of BTG2 and Bcl-XL expression were downloaded from the TCGA database

2.13. Statistical analysis

Numerical data were presented as mean±SD of the independent determinations. Independent t-test or ANOVA was applied, and multiple comparisons were evaluated by Tukey HSD. P values less than 0.05 were considered as significant. A comparison of the characteristics of patients was evaluated using Fisher’s exact test. Progression-free survival (PFS) and Overall survival (OS) was calculated using the Kaplan–Meier method. PFS was defined as the time from the date of starting chemotherapy to tumor progression or death from any cause. OS was defined as the time from the date of starting chemotherapy to death; data on the survivors were censored at the last follow-up. The differences among the survival curves were tested using the log-rank test. The Cox proportional hazards regression model was used to determine the joint effects of several variables on survival. All factors in the univariate analysis were included in the Cox proportional hazards regression model. All statistical

１０

analyses were performed two-sided using SPSS for Windows 21.0.

2.14. BTG2 interaction proteins screening with protein chip array

The HuProt Human Proteome Microarray was purchased from CDI laboratories (http://www.cdi-lab.com). The Chip includes 16,368 unique full-length humanrecombinant proteins in duplicate along with several control proteins such as IgG, GST, BSA-biotin, and histones as previously described [56].

Human cDNA of BTG2 was subclonned into various GST-V5-HIS fusion vectors and purified, Purified hBTG2 proteins were applied to human protein microarray and hBTG2 interacting proteins were detected by using Alexa-Fluor 488 conjugated V5 antibody(Invitrogen, Carlsbad, CA). V5 antibody alone was used as control. Briefly, the protein chip was first incubated with blocking buffer (5% BSA in PBS with 0.05% (v/v) Tween 20) for 30 minutes at room temperature and V5-His-hBTG2 or V5 antibody were further incubated under the lifterslip (Thermo scientific, USA) for 1 hour at room temperature. After washing three times with 1x PBS containing 0.05% Tween 20 by gentle shaking for 10 min each, the microarray was incubated with Alexa-Fluor conjugated antibody.

Subsequently, the microarray was washed three times and then the values of probe signal were obtained using a GenePix Pro 6.0 software (Molecular Devices, Sunnyvale, CA).

１１

3. RESULTS

3.1. BTG2 regulates mRNA and protein level of anti-apoptotic protein, Bcl-XL

To investigate the possibility that BTG2, as a binding partner of mRNA deadenylase, CAF1, can influence cell viability by regulating mRNA stability of anti-apoptotic proteins, the basal level of mRNA of Bcl-2, Bcl-XL and MCL1 was observed after overexpression of BTG2 in several cancer cell lines. In A549, lung carcinoma cell line, decreased basal levels of Bcl-2, Bcl-XL and MCL1 was observed after BTG2 overexpression. However, in BTG2-overexpressed other cell lines, depression of Bcl-2 and MCL1 mRNA was not consistently observed. After all, only the decrease of Bcl-XL mRNA was consistently observed in all investigated cell lines after BTG2 expression (Figure 1A). To exclude the possibility of decreased transcription of Bcl-XL as a mechanism of decreased Bcl-XL mRNA level in overexpressed cells, the level of pre-mRNA was compared between control and BTG2-overexpressed cells. As expected, the significant difference was not observed in the level of BCL-XL pre-mRNA (Figure 1B). After transcription, alternative splicing of pre-mRNA of Bcl-XL produces short or long form mRNA, so called Bcl-XS and Bcl-XL, respectively and it was already reported that the alternative splicing toward producing more Bcl-XS along with decreased Bcl-XL can induce the loss of cell viability [57]. However, by observing the decrease of both long and short form of Bcl-X (Figure 1C), we can verify that BTG2 has no significant influence on alternative splicing process in this experiment setting. Although, along with decrease of Bcl-2 or MCL1 mRNA levels, in some cell lines, the decreased protein level of Bcl-2 or MCL1 was observed, decreased protein level of Bcl-XL was consistently confirmed by western blot analysis in all those cell lines after 48 hours of BTG2 overexpression (Figure 1D). In addition, the increased level of BCL-XL mRNA was observed in liver tissue from BTG2/TIS21-knock out mouse, along with increased other anti-apoptotic genes, Bcl2, MCL1 and BCL2L10 Figure S1. Taken together, these results indicated that BTG2 can regulate mRNA level of Bcl-XL not by transcriptional but by post transcriptional level.

１２

１３

１４

Figure 1.BTG2 decreases mRNA and protein level of anti-apoptotic protein, Bcl-XL. (A) mRNA level of Bcl2, Bcl-XL, MCL1 in BTG2 overexpressed cancer cells. RNA from cells infected with Ad-BTG2 or Ad-LacZ for 48 hours was subjected to quantitative real-time PCR with their specific primers of Bcl2, Bcl-XL, MCL1 and GAPDH. mRNA expressions were normalized to that of GAPDH. Note statistically significant decrease of Bcl-Xl mRNA in BTG2 overexpressed cancer cells. (B) Comparison of Bcl-X enogenous pre-mRNA in LacZ and BTG2 overexpressed cancer cells. Note no significant difference of Bcl-X pre-mRNA level in three different cancer cell lines after BTG2 overexpression in contrast to the level of mature Bcl-XL mRNA. (C) mRNA level of Bcl-XL and Bcl-XS in BTG2 overexpressed cancer cells. Similar degree of decrease of Bcl-XL and Bcl-XS was observed in BTG2 overexpressed A549 cells. (D) Immunoblot analysis of Bcl2, Bcl-XL, MCL1 protein level in BTG2 overexpressed cancer cells. Note significant decrease of Bcl-XL protein in agreement with the decrease in Bcl-XL mRNA in BTG2 overexpressed cancer cells.

１５

Figure S1. Gene expression data of microarray from liver tissue of TIS21 wild type and knock out mouse.

Figure S2. Comparison of mRNA stability between LacZ and BTG2 overexpressed HeLa cells.

１６ 3.2. BTG2 regulates mRNA stability of Bcl-XL

To prove the mechanism that BTG2 can reduce mRNA of Bcl-XL, not by regulation of transcription or splicing process, but by regulation of mRNA stability, remaining mRNA of Bcl-XL was compared between control and BTG2-overexpressed cell lines after blocking further transcription by actinomycin D treatment. In three different BTG2-overexpressed cancer cell lines, statistically significant decrease of mRNA was observed after actinomycin D treatment only in Bcl-XL, not in Bcl2 or MCL1 (Figure 2A). It was reported that prolonged treatment of actinomycin D as a chemotherapeutic agent can decrease cell viability [58]. As expected, increased loss of cell viability was observed in BTG2 overexpressed cancer cells after 12hr treatment of acinomycin D (Figure 2B).

Increased apoptotic cell death is anticipated when Bcl-XL, as anti-apoptotic protein, is decreased.

Morphological feature of dead cells and increased cleaved PARP along with decreased Bcl-XL expression suggested increased apoptotic cell death in BTG2 overexpressed cell treated with acinomycin D. Although it was reported that basal BTG2 expression is relatively low in cancer tissues and cell lines compared normal tissues or cell lines, cancer cell lines still express variable level of BTG2. Therefore, endogenous BTG2 was knocked down with BTG2 siRNA in Hele cells, expressing relatively high level of BTG2 among investigated cancer cell lines (Figure 2C). When BTG2 was knocked down, basal level of Bcl-XL mRNA (Figure 2C) and mRNA stability of Bcl-XL measured by real-time PCR after acinomycin D treatment were increased (Figure 2D). Together, these data suggest that BTG2 can reduce the expression of Bcl-XL and promote cell death, when proper stimulation was applied, by down-regulating mRNA stability of Bcl-XL.

１７

１８

１９

Figure 2. BTG2 downregulates mRNA stability of Bcl-XL.

(A) mRNA stability of Bcl2, Bcl-XL, MCL1 in BTG2 overexpressed cancer cells. After actinomycin D (5ug/m) treatment, RNA from cells infected with Ad-BTG2 or Ad-LacZ was subjected to quantitative real-time PCR with their specific primers of Bcl2, Bcl-XL, MCL1 and GAPDH. mRNA expressions were normalized to that of GAPDH. Note decreased mRNA stability was observed only in Bcl-XL. (B) Cell death after actinomycin D treatment. Significant apoptotic cell death was observed along with a decrease in Bcl-XL protein in BTG2 overexpressed cells. (C) Increased Bcl-XL mRNA after BTG2 knock down. Note significant upregulation of Bcl-XL mRNA by knockdown of BTG2 in HeLa cells by transfection with siRNA-BTG2. (D) Comparison of Bcl-XL mRNA stability between siRNA-control and siRNA-BTG2 transfected HeLa cells after actinomycin D treatment. Note statistically significant increase of Bcl-XL mRNA stability in siRNA-BTG2 transfected HeLa cells.

２０ 3.3. BTG2 interacts with CNOT7 and hnRNP C

BTG2 has no known enzymatic activity itself. Thus, it was hypothesized that BTG2 might reduce mRNA stability of Bcl-XL by interacting with other proteins. PRMT1 as representative binding partner with BTG2, mediates methylation of arginine residue on several proteins including RNA binding proteins such as AUF1 (hnRNP D) and nucleolin, It is also reported that enzyme activity of PRMT1 can be regulated by BTG2 [59]. In fact, AUF1 is well known RNA binding protein as negative regulation of mRNA stability [60]. In vitro, increased methylation of GST-AUF by PRMT1 was observed when 1ug of recombinant BTG2 was co-incubated (Figure S3A.). However, when PRMT1 was efficiently knocked down by different kinds of siPRMT1s, no significant difference of Bcl-XL mRNA stability was observed (Figure S3B.) and decreased Bcl-XL mRNA after BTG2 overexpression was not recovered by siPRMT1 (Figure S3C.) In addition, the phenomenon of BTG2-mediating enhanced cell death was not reversed when PRMT1 was knocked down (data not shown).

Together, these data suggested that regulation of Bcl-XL mRNA stability was not mediated by PRMT1.

２１

Figure S3. Regulation of Bcl-xL mRNA stability by BTG2 is not dependent on PRMT1.

２２

CNOT7 (CAF1a),mRNAdeadenylase, is another well-known interacting partner of BTG/TOB family, and it was suggested that TOB can mediate recruitment of CNOT7 (CAF1a) to target mRNA directly interacting with PABP by PAM2 motifs located on C-terminal [61]. However, since BTG2 has no PAM2 motifs, it was hypothesized that unknown BTG2 interacting protein which has mRNA binding ability might mediate the interaction between BTG2 and target mRNA. According to a recent study, BTG2 can interacts with cytoplasmic poly(A) binding protein (PABPC)1 and stimulates CAF1 deadenylase activity [51]. To find out unknown BTG2 interacting proteins, in vitro binding assay using protein chip with recombinant BTG2 protein was performed and 210 BTG2 binding protein was discovered. As predicted, binding intensity score of CNOT7, known interacting protein was relatively high among other candidate proteins as expected (Figure 3A).

HnRNP C is a nuclear RNA-binding protein with roles in pre-mRNA splicing [62], mRNA stability [63], and translational modulation [64] with nascent mRNA transcripts. On literature searching, hnRNP C was identified as one of the proteins interacting to 3'UTR of Bcl-XL mRNA along with nucleolin, YB-1, and NF-AT, and only the role of nucleolin as stabilizing Bcl-XL mRNA in response to UAV irradiation was studied [65]. Thus, hnRNP C was selected for further investigation.

To confirm the in vitro interaction between BTG2 and hnRNP C or CNOT7 observed in protein array result, immunoprecipitation assay was performed in 293T cell. Since the level of endogenous hnRNP

To confirm the in vitro interaction between BTG2 and hnRNP C or CNOT7 observed in protein array result, immunoprecipitation assay was performed in 293T cell. Since the level of endogenous hnRNP