AMP-activated protein kinase - Regulation if SUR1 gene by BETA2/NeuroD and AMP-activated protei

AMP-activated protein kinase (AMPK) is a sensor for cellular metabolism in response to changes in the energy status of the cells. AMPK has been described to shut down energy-consuming pathways in response to a fall in the ATP/AMP ratio by phosphorylating key enzymes of intermediate metabolism. Depletion of ATP in cells is always accompanied by elevation of AMP, due to displacement of the adenylate kinase reaction [2ADP ↔ ATP + AMP].²³ Elevation of AMP (coupled with depression of ATP) activates the system by no less than four mechanisms: 1) Binding of AMP causes allosteric activation of the downstream kinase, AMPK; 2) binding of AMP to dephosphorylated AMPK causes it to become a much better substrate for the

upstream kinase, AMPKK; 3) binding of AMP to phosphorylated AMPK causes it to become a much worse substrate for protein phosphatases, especially protein phosphatase-2C; 4) the upstream kinase, AMPKK, is also allosterically activated by AMP.²⁴

5-Aminoimidazole-4-carboxamide riboside (AICAR) is taken up into cells and is phosphoryla ted by adenosine kinase to the monophosphorylated form (AICAR or ZMP). Although ZMP is a natural intermediated in purine nucleotide synthesis, in many cells, the formation of ZMP from extracellular AICAR is much more rapid than its subsequent metabolism, so ZMP accumulates. ZMP is an AMP analogue, which mimics all of the effects of AMP on the AMPK.

AMPK is a multisubstrate heterodimeric serine/threonine protein kinase consisting of a catalytic α-subunit and a regulatory β- and γ-subunits. AMPK catalytic α-subunit contains the kinase domain, which transfers a phosphate from ATP to the target proteins. Each subunit has two or three isoforms, designated (α1, α2, β1, β2, γ1, γ2, γ3. Catalytic α subunit are encoded by different genes; α1 corresponds to the isoform purified from liver. The α1- and β1-subunits are widely expressed, whereas α2 is expressed at high levels in liver, skeletal and cardiac muscles, and β2 in skeletal and cardiac muscle.²⁶ In hepatocytes, glucose (in the

presence of insulin) induces expression of genes encoding glucose transporters and glycolytic and lipogenic enzymes but represses genes of the gluconeogenic pathway.

Likewise, glucose also activates several of the same genes in pancreatic β-cells. In addition, glucose increases transcription of the preproinsulin (PPI) gene.²⁵ One of the most extensively studied targets of AMPK is acetyl-CoA carboxylase (ACC), a rate-limiting enzyme of fatty acid synthesis in liver, adipose tissue, and mammary gland and an important regulator of fatty acid oxidation in muscle. AMPK phosphorylates and inactivates ACC, principally through the phosphorylation of serine 79 in the N-terminal domain of ACC.²⁷

During exercise, AMPK activated, resulting in inhibition of ACC and thereby reduction of the enzyme product malonyl-CoA, which relives inhibition of CPT allowing an increase in fatty acid oxidation.²⁸ AMPK is known to be involved in glucose uptake. Perfusion of the isolated rat hindlimb with 200 U/ml AICAR increases glucose uptake by approximately twofold.²⁹ Taken together, these previous results suggest that AMPK exerts an important role in coupling metabolic state to expression of genes involved insulin synthesis and secretion. The roles of the AMPK have been described in the glucose-sensitive pancreatic β-cell lines, HIT- T15 and INS-1. AMPK activation in response to glucose depletion appears dependent on

changes in the concentration of AMP and ATP. In HIT-T15 cells of late-passage, both AMPK activity and the AMP/ATP ratio become insensitive to the extracellular glucose concentration and the glucose-dependent insulin secretion response is lost.

The purpose of the study is to characterize the molecular mechanism by which BETA2/NeuroD regulates the SUR1 gene expression and to investigate if β-cell specific genes, such as BETA2/NeuroD, SUR1, and insulin, can be regulated by AMPK.

II. MATERIALS AND METHODS

A. MATERIALS

COS cells as described by Attardi and Tjian. HIT cells were purchased from Korean Cell Line Bank. Rat pancreatic islets were provided by Dr. Yoon KH (Catholic University, Korea). RNAzol B regents were purchased from Tel-Test, INC (Frendwood, TX); LipofectAMINE PLUS reagents from GIBCOBRL (Gland island.

N.Y. 14072 U.S.A); Butyryl-coenzyme A, ONPG (o-NitroPhenyl β -D-Galactopyranoside) and forskolin from Sigma (St. Louis, MO, U.S.A.);

[3H]chloramphenicol from NEB (Boston, MA, U.S.A.); LA PCR kit from Takara (Shuzo, Japen); Dual- Luciferase assay system from Promega (Madison, WI, USA);

pcDNA3 from Invitrogen (Sandiego, CA, USA); pGemT plasmid and pGL3-promoter plasmid from Promega (Madison, WI, U.S.A.); anti- BETA2 and anti-PDX-1 antibodies from Santa Cruz Biotechnology (Santa Cruz, U.S.A.); anti-c-myc antibody from Calbiochem (La Jolla, CA, U.S.A.); anti-phospho-AcCoA

Carboxylase (S79) antibody from Upstate Biotechnology Inc (Lake Placid, NY, U.S.A.). ECL-Plus kit and Hyperfilm from Amersham (Buckinghamshire, U.K.);

Immobilon-P membrane from Millipore (Bedford, MA, U.S.A.). A recombinant adenovirus expressing AMPK (Ad-AMPKα/T172D) and anti-phospho-AcCoA carboxylase (S79) antibody were provided by Ha JH (Kyung-Hee University, Korea).

B. METHODS 1. Plasmids

pRIPE3(3+) CAT and pINSCAT448- were described previously.^{30, 31} An expression vector for pcHA-BETA2(1-233), the 773 bp NcoI fragment was isolated from pGEM-BETA2 and ligated downstream of the 5’ untranslated region of PSD95 and a cDNA sequence for the HA epitope in pcDNA3. To obtain the full length BETA2, the BstI and XbaI fragment of pcHA-BETA2(1-233) was replaced with the BstI (+641)/XbaI fragment of pGEM-BETA2. These plasmids were designed to

express 26 amino acids encoded by the 5’-untranslated region of the hamster BETA2 (GeneBank accession number: U24679) to the N-terminal of the first methionin of NeuroD. The amino acids of BETA2 peptides were numbered according to the NeuroD amino acids sequence. pCR3.1/ngn3, the expression vector for ngn3 and

pGL3-BETA2-2.2Luc were given by Dr. Tsai MJ (Baylor College of Medicine, Houston, Texas, U.S.A). pCR3.1/ngn3 and pGL3-BETA2-2.2Luc were described previously.²⁰

2. Preparation of recombinant adenovirus expressing NeuroD

A recombinant adenovirus expressing NeuroD was prepared using the AdEasy system. The BglII-FLAG-BamHI was inserted to the BamHI of pGEM-BETA2. AdTrack-CMV-FALG-BETA2 was made by ligating the FLAG-BETA2 (BglII/XhoI) to the BglII/XhoI site of a suttle vector pAdTrack-CMV. The resultant is linearized by digesting with restriction endonuclease PmeI, and subsequently cotransformed into E. coli BJ5183 cells with an adenoviral backbone plasmid, e.g., pAdEasy-1. Recombinants are selected for kanamycin resistance, and recombination was confirmed by multiple restriction endonuclease analyses. Finally, the linearized recombinant plasmid is transfected into adenovirus packaging cell line, 293 cells.

Recombinant adenoviruses typically are generated within 7-10 days. MIN cells were infected with Ad-Track-CMV-FLAG-BETA2, using a 2 h exposure to 5 ml of adenovirus (1 x 10⁹ PFU/ml). After infection of adenovirus, MIN cells were cultured for 32 h in 10 ml of DMEM medium. The efficiency of infection could be conveniently followed with GFP.

- 28 -

3. Constructions of reporter genes

A BamHI/BamHI fragment (-660/+340) from MG10-1 was subcloned into

fNeuroD -fNeuroD Cotransfectioninto bacteria Selection with kanamycin

Linearizewith PmeI pAd-NeuroD

L-LTRGFPfNeuroDR-LTR PacIPacI Transfect 293 cells Follow transfection Harvest virus in 7day

Amp

fNeuroD -fNeuroD Cotransfectioninto bacteria Selection with kanamycin

Linearizewith PmeI pAd-NeuroD

L-LTRGFPfNeuroDR-LTR PacIPacI Transfect 293 cells Follow transfection Harvest virus in 7day

exonuclease Ⅲ. The resulting fragments of -138/-20 and -660/-20 base pairs were linked to a CAT reporter plasmid, pCAT3M, to obtain pSUR-138CAT and pSUR-660 CAT, respectively. A KpnI/KpnI fragment (-2432/-627) from MG10-1 was inserted to the KpnI site of pSUR-660CAT to generate pSUR-2432CAT. pSUR-4542CAT was made by replacing the -2432/-1131 fragment of pSUR-2432CAT with an XbaI/NsiI fragment (-4542/-1131) from MG10-1. Reporter genes containing multiple copy of the E-box from the SUR1 promoter were constructed by inserting a double stranded E3 and mutation form of 3Em oligonucleotides into the BglII site of the pGL3-promoter luciferase vector. pSUR-2432/-660 was made by ligating the KpnI/BamHI fragment (-2432/-660) to the pGL3-promoter vector. To introduce a linker scanning mutation at E3, PCR was carried out using MG10-1 as a template and the oligonucleotide 8411 (5’-GGATCCAAGTTCCTCTTCTGGCCTCTA TTGGTA-3’) and 8939R (5’-CCCCCGGGCTCTTGTGGGGCGAGGGTGGG-3’) or the oligonucleotides 8930 (5’-CCCGGGGAAGGGCGGGGGCCAGCGGCA-3’) and

9052R (5’-CTGCTCTGGCTCCGCGCGCCT-3’). Two PCR products were subcloned into pGEM-T easy vector and subsequently isolated from the vector by digestion with BamH1 and Xma1. The two BamHI/XmaI fragments were inserted to the BglII site of pGL2-basic vector to obtain pSUR-660E3m.

4. Cell culture

HIT, MIN, 293T and HeLa cells were maintained in Dulbecco's modified Eagle's medium (DMEM) with 4500 ㎎/L glucose, supplemented with 4 mM L-glutamine, 10% fetal bovine serum (FBS), 100 unit/ml penicillin, 100 ㎍/ml streptomycin. To measure AMPK’s effects in low glucose, MIN cells were maintained in MEMα, containing 10 % FBS, 100 unit/ml penicillin, 100 ㎍/ml streptomycin in a standard humidified atmosphere at 37 ^oC.

5. Isolation of islets and culture of islet cells

Pancreatic islets were isolated from SD rats (200-250 g) by distending the pancreatic duct with a collagenase P (1.5 mg/ml) in PBS, After digestion, the islet were separated on a Histopaque density gradient (Histopaque-1077) and further purified by handpicking under a microscope. Islet were cultured in RPMI/1640 containing 11.1 mmol/l glucose, 10 % FBS, 100 unit/ml penicillin, 100 ㎍/ml

streptomycin in uncoated petridish.

6. Transfection

The cells were plated 24 h before transfection. HIT and MIN cells were transfected using LipofectAMINE PLUS. Reporter plasmids (0.5 ㎍), 0.5 ㎍ each expression vector for BETA2/NeuroD, pCMV-BETA2, or ngn3, pCR3.1-ngn3, and 0.07 ㎍ of an expression vector for E12, pSVE-5, or pCR3.1-E47 were used. The total amount of DNA used transfection was kept constant by adding pcDNA3.

Transient transfection assay in 293T cells for electrophoretic mobility shift assay were carried out with the reporter plasmid, 12 ㎍ pcDNA3/flag-NeuroD by the standard calcium phosphate precipitation method as previously described.³² To evaluate the effect of AICAR, MIN cells and islets were incubated at 400 µM AICAR. To obtain stably transformed cells with ngn3, pCR3.1-ngn3 was transfected into HIT-T15 and HeLa cells and selected in the presence of G418 (600 ㎍/ml) for 2 weeks.

7. Chloramphenicol acetyltransferase (CAT) and luciferase Assay

For CAT assays, cell extracts were prepared 48 h after transfection by

repeated cycling of freezing and thawing and heat inactivated at 65^oC for 10 min.

Protein concentration was determined by Bradford assay and 10-20 ㎍ of cell extracts was assayed for CAT activity using [³H]-chloramphenicol and butyryl-coenzyme A. Activity was normalized to β-galactosidase activity.

For luciferase assays, cell extracts were prepared according to the manufacturer’s protocol and luciferase activity was determined with 5-20 ㎍ of cell extracts using the Dual- Luciferase assay system. The data are presented as an average + standard error from at least three independent experiments.

8. Electrophoretic mobility shift assays (EMSA).

293T cells were transfected with expression vectors for BETA2/NeuroD and E47 using calcium phosphate. After 36 h, nuclear extracts of 293T and MIN cells were prepared from transfected cells as described by Attardi and Tjian.³³ Briefly, cells were lysed in 25 mM Tris-Cl (pH 8.0), 2 mM MgCl2, 0.5 mM dithiothreitol (DTT), and 0.01 % phenylmethylsulfonyl fluoride (PMSF) for 5 min at room temperature. Nonidet P-40 was then added to a final concentration of 0.05 % and incubated for 2 min. After centrifugation at 1700 ×g for 5 min, the resulting pellet was suspended in 10 mM Tris-Cl (pH 8.0), 400 mM LiCl, 0.5 mM DTT, and 0.01%

PMSF and kept at room temperature for 5 min. After centrifugation at 12,000 ×g for 2 min, the supernatant was collected and used for EMSA. EMSA was performed using double stranded oligonucleotides as probes containing the E-box of rat insulin (RIPE3) or the E3 of SUR1 promoter. RIPE3, 5'-GATCTGGAACTGCAGCTT CAGCCCCTCTGGCCATCTGCTGATCCA-3' (sense) and 5’-GATCCGGA TCAGCAGATGGCCAGAGGGGCTGAAGCTGCAGTTTCCA-3’ (antisense);

RIPA, GATCCCTCTTAAGACTCTAATTACCCTAG-3’ (sense) and 5’-GATCCTAGGGTAATTAGAGTCTTAAGAGG-3’ (antisense) were annealed and end- labeled with [α-³²P] dATP (NEN) and Klenow fragment. The sequences of

putative E-boxes of SUR1 were illustrated in the Fig. 5. The ³²P-labeled probe (3 x 10⁴cpm/lane) and 1 µg of nuclear extracts were incubated in 7 % glycerol, 60 mM LiCl, 0.5 mM PMSF, 5 mM MgCl2, 2 mM DTT, pH 7.4, with 2 ㎍ of polyd eoxyinosinicdeoxycytidylic acid (poly dI/dC) for 30 min at room temperature.

To confirm specific binding, the unlabeled probe of 30-100 fold excess or 0.6 ㎍ of

an anti-NeuroD antibody were added to the reaction mixture. Samples were loaded onto 4% polyacrylamide gels and subject to electrophoresis at 8 V/cm. Gels were dried and exposed to X-ray film for 1-2 day at –70 ^oC.

9. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)

Total RNA was isolated using a RNAzol^{T M} B and cDNA was synthesized using First-strand cDNA synthesis kit and 1 ㎍ of total RNA following the manufacture’s instructions. The PCR was conducted with 3 µl of the first-strand cDNA; 98 ôC for 1 min, followed by 25 cycles for BETA2 and β-actin, and 30 cycles for SUR1 at 94 ôC for 1 min, 55 ôC for 30 sec, and 72 ôC for 1 min, and finally 72 ôC for 7 min. Primers were designed to recognize the separate exons to eliminate possible DNA contamination. The PCR primers for SUR1 were 5’-GCTCTTCATCACCTTCCCCATCCTC-3’ (forward) and 5’-CACAACCTGCG CTGGATCCTTACC-3’ (reverse); for BETA2 5’-CTCCGGGGTTATGAGAT CGTCAC-3’ (forward) and 5’-GATCTCTGACAGAGCCCA-3’ (reverse); for Pdx-1 5’-GGACACACAGCTCTACAAGGA-3’ (forward) and 5’-CATCACTGCCAG CTCCACCC-3’ (reverse); for β-actin 5’-CATGTTTGAGACCTTCAACACCCC-3’

(forward) and 5’-GCCATCTCCTGCTCGAAGTCTAG-3’ (reverse). The PCR products were analyzed on a 2 % agarose gel.

10. Nuclear extracts and immunoblotting

Nuclear extracts were prepared from transfected COS and 293T cells as

previously described by Attardi and Tjian.³³ Briefly, cells were harvested 36 h after transfection and lysed in 25 mM Tris-Cl (pH 8.0), 2 mM MgCl2, 0.5 mM dithiothreitol (DTT), and 0.01% phenylmethylsulfonyl fluoride (PMSF) for 5 min at room temperatur e. Nonide P-40 was then added to a final concentration at 1700 ×g for 15 min, the resulting pellet was suspended in 10 mM Tris-Cl (pH 8.0), 400 mM LiCl, 0.5 mM DTT, and 0.01 % PMSF and kept on room temperature for 5 min.

After centrifugation at 12000 ×g for 2 min, the supernatant was harvested as nuclear extracts. Usually 30-60 ㎍ of cytosol and nuclear extracts were subjected to 12 % sodium dodecyl sulphate (SDS)-polyacrylamide gel electrophoresis. The proteins on the gel transferred electrophoretically onto the Immobilon-P Teflon menbrane and western analysis was performed with an specific antibodies. Finally, the membrane was incubated with horseradish peroxidase-conjugated anti- mouse IgG antibody and the proteins were visualized using an enhanced chemiluminescence (ECL) kit following the manufacture’s recommendation.

III. RESULTS

1. Transactivation of the SUR1 gene by BETA2/NeuroD

Previously, we defined that SUR1 is a target gene of BETA2/NeuroD. To investigate whether the endogenous BETA2/NeuroD confers high activity of pSUR-660CAT in HIT-T15 cells, we determined the effect of a dominant negative form of BETA/NeuroD, BETA2(1-233) (Fig. 4A). BETA2(1-233) functions as a dominant negative mutant because it contains the bHLH domain for heterodimerization with E47 but lacks transactivation domain. Coexpression of BETA2(1-233) reduced the promoter activity of the -660/-20 fragment in a dose dependent manner (Fig. 4B). Thus, transfection of 0.3 µg pCHA-BETA2(1-233) decreased the promoter activity of the -660/-20 fragment and the insulin promoter to about 20% and 35% of the reporter alone, respectively. Similarly an insulin reporter gene, pINSCAT448-, which contained the RIPE3 sequence was suppressed by BETA2(1-233). Under the same condition, BETA2(1-233) did not affect the

pSV2CAT. This result indicates that repression by BETA2(1-233) is specific to β-cell

specific genes and high promoter activity of –660/-20 of SUR promoter is due to BETA2/NeuroD-like factors in HIT-T15 cells.

BETA2

Fig. 4. Repression of the SUR1 promoter by a dominant negative mutant of BETA2/NeuroD.

A schematic diagram of full- length BETA2 and a truncated form BETA2(1-233) peptides were epitope tagged with hemagglutinin (HA) at the N-terminus.

bHLH, basic helix- loop-helix domain; AD, activation domain. B. Reporter genes were cotransfected with pcHA-233), an expression vector for BETA2(1-233). Although pSV2CAT lacking the E-box was not affected by BETA2(1-233), pINSCAT448- containing the E-box of the rat insulin II promoter was repressed by BETA2(1-233). Data are relative values with respect to the CAT activity of pSV2CAT and presented as averages ± standard errors of three independent experiments. *p<0.05, **p<0.01, both p values were estimated from t-test compared to the value of the reporter gene alone.

2. Determination of binding sites for BETA2/NeuroD

Four E-box-like sequences (E1- E4), which are potential sites for BETA2/NeuroD action, were found within the -660/-20 fragment. Since the -138/-20 fragment containing E4 was not synergistically activated by BETA2/NeuroD and E47, E4 alone is insufficient for tissue specific regulation. To determine which of the remaining E-box like sequences was necessary fo r BETA2/NeuroD binding, we carried out electrophoretic mobility shift assays (EMSA) using RIPE3 as a probe and the E-box sequences (E1-E3) of the SUR1 promoter as competitors (Fig. 5). As a source of BETA2/NeuroD, nuclear extracts were prepared from 293T cells transfected with expression vectors for BETA2(1-233) and E47. BETA2(1-233) has been shown to bind RIPE3 stronger than the full length BETA2 when expressed in 293T cells. Several complexes were detected and specific binding of the labeled RIPE3 probe was verified using an excess amount of unlabeled RIPE3 oligonucleotide (data not shown). Interestingly, only E3 was able to compete with RIPE3 for binding to BETA2/NeuroD (lane 6, 7). The binding was specific since the

same complexes disappeared by addition of an anti-NeuroD antibody (lane 8). This result indicates that the E3 box is necessary for binding of BETA2/NeuroD. To confirm the specificity of binding to E3, we carried out EMSA using E3 as a probe

Fig. 5. Determination of DNA binding ability of three putative E-boxes.

Nuclear extracts were prepared from 293T cells expressing a dominant negative form of BETA2/NeuroD, BETA2(1-233). EMSA was carried out with RIPE3, the E box of

consensus CANNTG

E1 GATCCACATCCAGCTGAGCCTAGA E2 GATCCCAGCGCACGTGCGCATTGA E3 GATCCAAGAGCAGCTGGAAGGGCA RIPE3a GATCTAGCCCCTCTGGCCATCTGCTGATCCG

the rat insulin II. Double stranded oligonucleotides containing E1, E2 or E3 of the SUR1 were used as competitors. Only E3 was able to compete with RIPE3 (solid triangle in lanes 6 and 7). The same complex disappeared in the presence of an anti-BETA2 antibody (lane 8).

E3 GATCCAAGAGCAGCTGGAAGGGCA E3m GATCCAAGAGTGGCTGGAAGGGCA

Fig. 6. Binding of BETA2/NeuroD to E3.

Nuclear extracts were prepared from 293T cells expressing a dominant negative form of BETA2/NeuroD, BETA2(1-233). A double stranded oligonucleotide containing E3 of the SUR1 promoter was used as a probe. Specific binding was confirmed by competition

with an excess amount of the unlabeled E3 (lanes 2 and 3) or E3m containing mutant in E3 (lanes 4 and 5) and RIPE3 (lanes 6 and 7). The specific complexes (solid triangle) disappeared by addition of an anti-BETA2 antibody (lane8).

(Fig. 6). Similar to RIPE3, BETA2/NeuroD bound to E3 specifically. E3 oligonucleotide (lane 2, 3) and RIPE3 (lane 6, 7) were able to compete with E3 of the SUR1 gene (closed triangle). In contrast, the E3m, a mutant oligonucleotide, did not compete with E3 (lane 4, 5). The specific complexes disappeared in the presence of an anti-NeuroD antibody (lane 8). This result indicates that BETA2/NeuroD can bind the E3 element at -141 bp of the SUR1 gene.

3. E3-mediated transactivation by BETA2/NeuroD

To determine whether the E3 box could confer transactivation of the SUR1 gene by BETA2/NeuroD, reporter genes, pSURE3(1+) and pSURE3m(1+), were constructed by ligating one copy of E3 or E3m to a heterologous promoter driving expression of luciferase in the pGL3-promoter vector, respectively (Fig. 7).

Coexpression of BETA2/NeuroD and E47 enhanced the luciferase expression by 3.8 fold for pSURE3(1+) while the pGL3-promoter was not affected at all. Mutation of E3 eliminated the stimulatory effect of BETA2/NeuroD (Fig. 8, left panel). To

confirm that E3 is the only functional E-box element in the -660/-20 fragment, we constructed pSUR-660E3m which contained a linker scanning mutation in E3 of the -660/-20 fragment. Mutation of E3 in the whole promoter context eliminated the

Fig. 7. Construction for E3 box and mutated E3 box of SUR1.

Reporter genes, pSURE3(1+), pSURE3m(1+), pSUR(-2432/-660), were constructed by ligating one copy of E3, E3m, or –2432/-660 to pGL3-promoter.

pSUR-660 and pSUR-660E3m were constructed using pGL2-basic (see the Materials

-660 -141 -20

and Methods for details).

Fig. 8. Mutation of E3 abolishes transactivation by BETA2/NeuroD.

Each of reporter genes (0.3 µg) was cotransfected with expression vectors for BETA2 and E47 into HIT-T15 cells. Note that mutation in E3 caused a loss of transactivation by BETA2/NeuroD and E47. Data are shown as averages ± standard

errors of three independent experiments with respect to the luciferase activity of pGL3 promoter or pGL2 basic. p values were estimated from t-test compared to the

BETA2/E47 - + - + - + - +

value of reporter genes alone (*p<0.05, **p<0.01).

stimulatory effect of BETA2/NeuroD (Fig. 8, right panel). Sequence analysis revealed nine more E-box- like sequences upstream of –660. To determine whether they might confer higher activity of pSUR-2432CAT than pSUR-660CAT in HIT-15 cells as shown in master’s thesis, we generated a reporter construct, pSUR-2432/-660 by ligating the -2432/-660 fragment to the pGL3-promoter. Coexpression of BETA2/NeuroD with or without E47 did not significantly enhance the -2432/-660 fragment (Fig. 8, left panel). Thus, E3 is essential for transactivation by BETA2/NeuroD.

4. Specificity of the E box-mediated transactivation by BETA2/NeuroD

In addition to BETA2/NeuroD, ngn3 is also a bHLH transcription factor expressed in pancreatic islet cells during their development. Thus, it is possible that ngn3 can also activate the SUR1 gene through the E3 element. We tested this possibility by coexpressing ngn3 and E47 in HIT-T15 cells. In HIT-T15 cells, the

문서에서 Regulation if SUR1 gene by BETA2/NeuroD and AMP-activated protein kinase (페이지 22-0)