• 검색 결과가 없습니다.

Comparative Differential Expressions of Porcine Satellite Cell during Adipogenesis, Myogenesis, and Osteoblastogenesis

N/A
N/A
Protected

Academic year: 2022

Share "Comparative Differential Expressions of Porcine Satellite Cell during Adipogenesis, Myogenesis, and Osteoblastogenesis"

Copied!
8
0
0

로드 중.... (전체 텍스트 보기)

전체 글

(1)



* This study was supported by Project (PJ006707) and 2013 Postdoctoral Fellowship Program of National Institute of Animal Science, Rural Development Administration, Republic of Korea.

Corresponding author : Phone: +82-31-290-1594, E-mail: [email protected]

Comparative Differential Expressions of Porcine Satellite Cell during Adipogenesis, Myogenesis, and Osteoblastogenesis

Jin Young Jeong1, Jang Mi Kim1, Ramanna Valmiki Rajesh1, Sekar Suresh1, Gul Won Jang3, Kyung-Tai Lee1, Tae Hun Kim1, Mina Park1, Hak Jae Jeong2, Kyung Woon Kim2, Yong Min Cho1 and Hyun-Jeong Lee1,†

1Division of Animal Genomics and Bioinformatics, National Institute of Animal Science, Rural Development Administration, Suwon 441-706, Korea

2Division of Animal Biotechnology, National Institute of Animal Science, Rural Development Administration, Suwon 441-706, Korea

3Division of Planning and Coordination, National Institute of Animal Science, Rural Development Administration, Suwon 441-706, Korea

ABSTRACT

Satellite cells were derived from muscular tissue in postnatal pig. Satellite cell is an important to growth and development in animal tissues or organs. However, the progress underlying induced differentiation is not clear. The aim of this study was to evaluate the morphologic and the transcriptome changes in porcine satellite cell (PSC) treated with insulin, rosiglitazone, or dexamethasone respectively. PSC was obtained from postnatal muscle tissue.

In study 1, for study the effect of insulin and FBS on the differentiated satellite cells, cells were cultured at absence or presence of insulin treated with FBS. Total RNA was extracted for determining the expression levels of myo- genic PAX3, PAX7, Myf5, MyoD, and myogenin genes by real-time PCR. Myogenic genes decreased expression levels of mRNA in treated with insulin. In study 2, in order to clarify the relationship between rosiglitazone and lipid in differentiated satellite cells, we further examined the effect of FBS on lipid accumulation in the presence or absence of the rosiglitazone and lipid. Significant differences were observed between rosiglitazone and lipid by FBS. The mRNA of FABP4 and PPARγ increased in rosiglitazone treatment. In study 3, we examined the effect of dexame- thasone on osteogenic differentiation in PSC. The mRNA was increased osteoblasotgenic ALP and ON genes treated with dexamethasone in 2% FBS. Dexamethasone induces osteoblastogenesis in differentiated PSC. Taken together, in differentiated PSCs, FABP4 and PPARγ increased to rosiglitazone. Whereas, no differences to FBS and lipid. These results were not comparable with previous reports. Our results suggest that adipogenic, myogenic, and osteoblasto- genic could be isolated from porcine skeletal muscle, and identify culture conditions which optimize proliferation and differentiation formation of PSC.

(Key words : Insulin, Rosiglitazone, Dexamethasone, Porcine satellite cell, Differentiation)

INTRODUCTION

Muscle satellite cells (SC), which are function as a myo- genic stem cell, are regulated through cell activation, proreiferation, and differentiation in postnatal tissues.

The activation of muscle satellite cells affects prolifera- tive adipogenic, myogenic, and osteoblastogenic precur- sor cells (Chargé and Rudnicki, 2004; Sirabella et al., 2013). Muscle growth is dependent on proliferation and differentiation during the postnatal of pig. Until recent-

ly, the fate of muscle satellite cell was typically consi- dered to be myogenic, contributing to muscle regenera- tion alone. However, several studies have demonstrated the plasticity of muscle stem cells induced differentia- tion into adipogenic, osteogenic, and myogenic. Most of the methods described for the isolation of primary cul- tures from skeletal muscle are time-dependent and com- plex. The transcription factors regulated the differen- tiation of satellite cell is analogous to the molecular me- chanisms regulating embryonic myogenesis (Parker et al., 2003). In addition to myogenic differentiation, muscle

225

(2)

stem cells have the ability to generate into adipogenic (Singh et al., 2007), osteogenic (Asakura et al., 2001) and neuronal phenotypes (Vourc'h et al., 2004). The adipo- genic differentiation of SCs and multi-potent cell lines are interest to disparate study. Despite the growing bo- dy of research in adipose biology, SC differentiation is not restricted to scientists. Most scientists have an in- terest in the study of SC. Therefore, we found signi- ficant variability among differentiated cell types. We isolated the three kinds of multi-potent cells and stu- died the role of PSC. Paired box 7 (Pax7) is specifically expressed in activated satellite cells. A Pax3, paralogue of Pax7, is an important for migration of muscle cells (Goulding et al., 1994). Furthermore, myogenesis regu- lated transcription of the myogenic regulatory factors including MyoD, Myf5, and myogenin (Sabourin and Rudnicki, 2000). The PPARγ as transcription factor is a regulator of adipocyte and osteoblast differentiation (Akune et al., 2004). Alteration of the expression or ac- tivity of peroxisome proliferator-activated receptor (PPAR) and CAAT/enhancer binding protein (C/EBP), regulator of adipocyte-specific genes (Hamm et al., 2001), was con- tributing to the increased adipogenic potential (Taylor- Jones et al., 2002). Muscle cell is converted to adipocy- tes by overexpression of PPAR and C/EBP (Rosen and Spiegelman, 2000). Similarly, PPAR results in induction of genes associated with lipid uptake and metabolism treated with thiazolidinediones (Grimaldi et al., 1997).

The fatty acid binding protein 4 (FABP4) has been used as a marker for differentiated adipocytes. The expre- ssion of other adipogenic genes including PPAR, FA- BP4, and C/EBP were remarkably reduced in the Di- phtheria toxin-treated cultures. Finally, it stimulates de- velopment and proliferation of early osteoblasts. How- ever, it inhibits the maturation and expression of phe- notype-specific genes including osteocalcin and alkaline phosphatase (Alliston et al., 2001; Zhang et al., 2013). In this study, SM muscles were chosen for differences in their function, metabolic properties and developmental origin, in order to determine whether regional satellite cell populations exhibit the same in vitro differentiation potential such as, adipogenic, myogenic, and osteoblas- tic.

Little is known about the relationship between por- cine satellite cell and their transcriptional factor. There- fore, the purpose of this study was to isolate satellite cell from pig muscle and to identify the differential ex- pressions following differentiated porcine muscle satel- lite cell.

MATERIALS AND METHOS Animals

Swine (Landrace × Yorkshire × Duroc; LYD) were ma- naged in the same feeding barn at National Institute of Animal Science (NIAS) under the high quality pork production program and slaughtered at 90∼100 day old pig. All experimental procedures involving animals were approved by the National Institute of Animal Sci- ence Institutional Animal Use and Care Committee (NI- ASIAUCC), Republic of Korea, and conducted in accor- dance with the Animal Experimental Guidelines pro- vided by NIASIAUCC.

Sample Preparation and Satellite Cell Culture

All experimental procedures were approved by the NIASIAUCC. Tissue samples were taken immediately post- exsanguination. Satellite cells were isolated from semi- membranosus (SM) muscles as described by (Doumit and Merkel, 1992). Briefly, LYD crossbred pigs were ex- cised, removed of visible connective tissue, and minced using sharp scissors. The SM muscle tissues (1 g) were digested with phosphate buffered saline (PBS) contain- ing 0.8 mg/ml of protease (Sigma, St. Louis, MO) for 1 hr at 37℃. After digestion, cells were centrifuged at 1,200 ×g for 5 min and 300 ×g for 10 min at room tem- perature respectively. The cell was filtered using nylon mesh. Cells were harvested by centrifugation at 1,200

×g for 15 min. SC isolates were seeded on matrigel (BD Biosciences, Bedford, MA) coated 6 well plates in pro- liferation medium consisting of Minimum Essential Me- dium (MEM; Sigma, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) with antibiotics [penicil- lin (100 U/ml) and streptomycin (100 μg/ml)]. The cells lines were seeded in 10 cm petridish at a density of pproximately 1×104 cells/cm2. The cells were incubated at 37℃ in air containing 5% CO2. The medium was changed every second day allowing the cells to pro- liferate until confluence (∼80 %). Myogenic differentia- tion of the cells was induced by transfer to fresh DM- EM medium supplements with 2% horse serum, 100 U/ml pencillin, 2 mM/L glutamine at 70% or 80% con- fluency and maintained at 37℃ in air containing 5%

CO2 for 10 days post-confluence. Cells from each site and within each animal were kept and analyzed se- parately.

Alizarin Red Staining

Alizarin red staining assay was used to determine the presence of calcification (calcium deposition) during differentiation. Briefly, the cells were immersed with alizarin solution (pH 4.2) for 5 min at room tempe- rature. The dye removed with acetone and acetone-xy- lene solution. The stained cell observed under micro- scope. Calcium deposition was demonstrated by aliza- rin red staining or quantitated using the Sigma Diag-

(3)

nostics Kit 587 as previously described (Luppen et al., 2003).

Oil Red O Staining

The progression of adipocyte differentiation was per- formed using Oil red O staining. Briefly, the cells were seeded in 35-mm plates and at the specified stage of differentiation. Cells were rinsed with phosphate-buf- fered saline (PBS) and fixed with 10% formalin in PBS for 1 h at least. After two washes with PBS, the cells were stained for 1 h in freshly diluted oil red O sol- ution (six parts Oil Red O stock solution and four parts H2O; stock solution is 0.5% Oil Red O in iso- propyl alcohol). The stain was washed twice with wa- ter. The stained lipid droplets in the cells were visua- lized by light microscopy and photographed.

Masson’s Trichrome Staining

Table 1. Primer sequences used in real-time PCR

Gene name, Symbol GenBank ID 5’ → 3’ Sequence Amplicon size

(bp)

Paired box gene 3 (Pax3) XM_005674269 Forward cgaaacaccgtaccctcagt 116

Reverse ttcttctcgctctcctcagc

Paired box gen 7 (Pax7) XM_005659088 Forward gactccggatgtggagaaaa 70

Reverse gatctcccagctgaacatgc

Myogenic factor 5 (Myf5) NM_001278775 Forward agacgcctcaagaaggtcaa 74

Reverse agcctctggttggggttagt

Myogenic differentiation 1 (MyoD) SSU12574 Forward gtgcaaacgcaagaccacta 128

Reverse gctgattcgggttgctagac

Myogenic factor 4 (Myogenin) NM_001012406 Forward tcatctgctcacagctgacc 86

Reverse ccacatcctccactgtgatg

Fatty acid binding protein 4 (FABP4) NM_001002817 Forward gcagaagtgggatggaaaga 99

Reverse attctggtagccgtgacacc

Peroxisome proliferator-activated receptor gamma (PPARγ) NM_214379 Forward cacgaagagccttccaactc 105 Reverse acccttgcatccttcacaag

Alkaline phosphatase (ALP) AY145130S1 Forward ccttggtgccagagaaagag 106

Reverse ttagccacgttggtgttgag

Osteocalcin (OC) AY150038 Forward ccccctacccagatcctct 80

Reverse gatgtgatcagccagctcgt

Osteonectin (ON) NM_001031794 Forward gaacgtcctggtcaccttgt 72

Reverse actcgcagcttctgcttctc

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)1 NM_001206359 Forward acccagaagactgtggatgg 79 Reverse aagcagggatgatgttctgg

Ribosomal protein, large, P0 (RPLP0)1 DQ316319 Forward tgttgaacatctcccccttc 73

Reverse gggttgtagatgctgccatt

1 Housekeeping gene: GAPDH for myogenesis or osteoblastogenesis; RPLP0 for adipogenesis.

For observes of collagen deposition, satellite cells we- re stained using Masson's trichromic method according to the manufacturer's instructions. Briefly, the cell was fixed with 4% paraformaldehyde in PBS for 30 min, dehydration in 70% ethanol, and clearing in xylene. Six random areas were examined at a magnification of ×4,

×20, and ×40 respectively.

Real-Time PCR Analysis

Satellite cells were harvested at specified stage. Total RNA was extracted from control and treated cells us- ing TRIzol reagent (Molecular Research Center) accord- ing to the manufacturer's instructions. Total RNA was quantified by absorbance at 260 nm, and the integrity of total RNA was checked by 1 % agarose gel elec- trophoresis. Total RNA (2 μg) was reverse transcribed into cDNA using an iScript cDNA Synthesis kit (Bio- Rad, Hercules, CA), according to the manufacturer’s in-

(4)

structions. Real-time PCR was performed using Quanti- Tect SYBR Green RT-PCR Master Mix (Qiagen, Valen- cia, CA) and a 7500 fast Sequence Detection System (Applied Biosystems). Briefly, PCR was conducted in a 25 μl total reaction volume containing 300 ng of c- DNA, 12.5 μl of SYBR Green RT-PCR Master Mix, and 1.25 μl of 10 μM primers. The thermal cycling param- eters were as follows: 95℃ for 10 min and 50℃ for 2 min by 1 cycle and 95℃ for 15 min followed by 40 cy- cles at 94℃ for 15 s, 62℃ for 30 s, and 72℃ for 30 s.

All primers were designed using integrated DNA te- chnology, based on National Center for Biotechnology Information published sequences (Table 1). The 2−ΔΔct me- thod was used to determine the relative fold changes (Livak and Schmittgen, 2001), and all data were nor- malized relative to the housekeeping glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) gene or ribosomal protein P0 (RPLP0) gene.

Statistical Analyses

All data are expressed as the mean±SEM. Differences among stages of differentiation were determined using the general linear model procedure of SAS software (SAS Institute, Cary, NC). Differences were considered signi- ficant at p<0.05.

RESULTS AND DISCUSSION

Dose-Dependent Effect of Insulin and FBS in Porcine Satellite Cells during Myogenic Differentiation

To study the effect of insulin and FBS, the differ- entiated satellite cells were cultured at absence or pres- ence of insulin. And then fetal bovine insulin was treated with 2, 5, or 10% respectively. Total RNA was extracted for determining the expression levels of myo- genic PAX3, PAX7, Myf5, MyoD, and myogenin genes by real-time PCR. In this study, the results showed the means of three independent experiments using cells isolated from the same pigs. For fibroblastic morpho- logy, the representative cells showed using Masson’s trichrome staining (Fig. 1A). Myogenic genes decreased expression levels of mRNA on insulin or FBS treatment (Fig. 1B). Transcriptional regulation of PAX3, PAX7, Myf- 5, MyoD, and myogenin genes affects during myogenic differentiation in porcine satellite cells. To study the dy- namics of myogenic genes during muscle differentia- tion, we cultured porcine satellite cells as an in vitro myo- genic differentiation model system. As shown in Fig.

1B, expression levels of PAX3, PAX7, Myf5, MyoD, and myogenin genes were lower at added insulin stage.

Also, expression levels of PAX3, PAX7, Myf5, MyoD,

and myogenin genes decreased in 5% and 10% FBS com- pared to 2% FBS. Taken together, the expression level of myogenic associated with gene is up-regulated in the porcine satellite cells from proliferation to differen- tiation and suggesting a complete change in capacity for myogenic metabolism.

Rosiglitazone Regulates Adipogenic Genes in Differen- tiated Porcine Satellite Cells

In order to clarify the relationship between rosiglita- zone (BRL49653) and lipid in differentiated satellite ce- lls, we further examined the effect of FBS on lipid ac- cumulation in the presence or absence of the rosiglita- zone and lipid. Differences were observed between ro- siglitazone and lipid by FBS. The lipid droplets in dif- ferentiating PSC treated with rosiglitazone increased com- pared to control by oil red O staining (Fig. 2A). The mRNA of FABP4 and PPARγ genes increased during rosiglitazone treatment. Whereas, the effect of lipid was not significantly difference. Taken together, FABP4 and PPARγ mRNA levels increased in differentiated por- cine satellite cells treated with rosiglitazone. Whereas, adipogenic related genes were not differences to FBS and lipid. These results were not comparable with pre- vious reports.

Dexamethasone Enhances Differentiatiation in Porcine Satellite Cell

Mineral deposition of the osteoblastic cells was also stimulated by dexamethasone treatment or FBS. Alizar- in red staining used to determine of osteoblastogenic (Fig. 3A). The morphology of the cells was markedly changed by dexamethasone treated with 2% FBS. How- ever, after osteoblastogenic, the Alizarin red staining was more intense in the dexamethasone treated cul- tures compare to FBS. The expression levels of alkaline phosphatase (ALP) and osteonectin (ON) genes increased in 2% FBS treated with dexamethasone compared to control. Whereas, the expression levels of porcine osteo- calcine (OC) mRNA decreased in presence of dexame- thasone (Fig. 3B). Taken together, these effects could be regulated the expression of early marker of osteoblasts and required the proper differentiation.

Determination of a Unique Model during Porcine Sa- tellite Cell

Satellite cell is a powerful tool for cell fate decision in postnatal of animal. Recently, several studies have been demonstrated differentiation towards adipogenic, os- teogenic, and myogenic. Several methods have been de- scribed for isolation, culture, and proliferation of ske- letal muscle satellite cells to study of skeletal muscle biology. However, the detailed changes associated with

(5)

(A)

(B)

Fig. 1. Insulin and FBS induces expression of myogenic PAX3, 7, MyoD, Myf5, and myogenin genes during myogenic differentiation. Con- fluent satellite cells were induced to differentiate and maintained in the differentiation medium for 8 days. (A) representative cells of dif- ferentiating satellite cell stained using Masson's trichrome method. Differentiation cell (I; ×50, II; ×400 respectively). (B) mRNA levels of myogenic genes including paired box gene 3 (PAX3), paired box gene 7 (PAX7), myogenic factor 5 (Myf5), myogenic regulatory factor (MyoD), and myogenic factor 4 (myogenin) genes in differentiation of satellite cell. Cells were cultured in 2%, 5%, and 10% FBS until confluent re- spectively. Satellite cells were allowed to differentiate in presence or absence of insulin (5 ug/ml). mRNA levels were determined by real- time PCR. Data are expressed as mean±SEM. a∼c Means with different superscripts differ significantly (p<0.05).

differentiation in porcine satellite cell remain unknown.

The present study was performed to examine transcrip- tome changes by differentiation of PSC. In SC study, It is well established that satellite cell affects adipocyte,

myocyte, and osteoblast in animal or human (Asakura et al., 2001; Saini and Stewart, 2006; Wu et al., 2012).

PSC was isolated from SM tissue of Landrace × Yo- rkshire × Duroc (LYD) crossbred pig at approximately

(6)

(A)

(B)

Fig. 2. Rosiglitazone (BRL49653) and lipid induces adipogenic FA- BP4 and PPARγ genes during adipogenic differentiation. Confluent satellite cells were induced to differentiate and maintained in the differentiation medium. (A) oil red O staining of cells derived fr- om SC (top row) treated 2% FBS, 5% FBS (middle row), and 10%

FBS (bottom row) following adipogenic differentiation of 6 days.

(B) mRNA levels of both adipogenic fatty acid binding protein 4 (FABP4) and peroxisome proliferator-activated receptor gamma (PPAR γ) genes in differentiation of satellite cell. mRNA levels were de- termined by real-time PCR. Data are expressed as mean±SEM.

a-dMeans with different superscripts differ significantly (p<0.05).

80∼90 days. To study skeletal muscle differentiation, we used the porcine satellite cell model in postnatal. In order to isolate satellite cell from pig muscle and to identify the differential expression following differen- tiated porcine muscle satellite cell, cultured cell were harvested at 8 days after differentiation. We confirmed that mRNA showed strongly expressed levels in PSC.

(A)

(B)

Fig. 3. Effects of dexamethasone (DEX) during osteoblastogenic differentiation of porcine satellite cell. Confluent satellite cells we- re induced to differentiate and maintained in the differentiation medium for 8 days. Satellite cells were seeded (day 0) in 12-well plates and treated with DEX. (A) Calcium deposition determined using ALP staining treated 2% FBS (left panel), 5% FBS (middle panel), and 10% FBS (right panel) following osteoblastogenic di- fferentiation. Images shown are representative of three indepen- dent experiments. (B) mRNA levels of osteogenic alkaline phospha- tase (ALP), osteocalcin (OC), osteonectin (ON) genes in differentia- tion. mRNA levels were determined by real-time PCR. Data are expressed as mean±SEM. a-cMeans with different superscripts dif- fer significantly (p<0.05).

(7)

Myogenesis was further assessed Pax3 and 7, a satellite cell marker, myogenic differentiation 1 (MyoD), an early marker of muscle differentiation, myogenin, an interme- diate marker of muscle differentiation, and myf5, a ter- minal marker of muscle differentiation, by measuring the mRNA expression level. The myogenic factors are involved in the specification of the myogenic during early embryogenesis and in the control of the muscle differentiated phenotype (Du et al., 2013). Myogenin and MRF4 progressed in cultures of skeletal muscle via the activation of MYOD and Myf5 genes (Yablonka–Reu- veni et al., 1999). Embryonic myogenesis depends on the expression of Pax3 and Pax7, which is regulator of the myogenic process. The fetus skeletal muscle depe- nds on Pax3 and Pax7 genes (Messina and Cossu, 2009).

The absence of myogenic cells in Pax7−/− skeletal muscle demonstrates a requirement for Pax7 in the function of the satellite cell lineage (Seale et al., 2000). Pax3 is also implicated in the determination of myogenic cell fate through MyoD. Skeletal muscle does not form and no myogenic cells are present in the absence of the myo- genic regulatory factors including MyoD and Myf5 (Bajard et al., 2006). Finally, we show that differentia- tion could successfully process to myogenesis in pig muscle model.

Muscular satellite cell induced to adipogenic differ- entiation in several different studies. PPAR has been reported in adipocytes (Grimaldi et al., 1997). PPARγ and FABP4 genes were used as common molecular markers of adipogenesis. PPARγ and FABP4, late mar- ker of adipogenesis, showed in adipogenic progression of MSC (Yanik et al., 2011; Shin et al., 2009). We show- ed that dexamethasone induced osteoblastogenesis in differentiated porcine satellite cells. Dexamethasone in- hibits mineralization when administration commences at a commitment stage. We evaluated the effects on the osteoblastogenesis by calcium deposition (a marker for final mineralization) and alkaline phosphatase (ALP, a marker for early differentiation), osteoclacin (OC, a mar- ker for late differentiation), and osteonectin (ON, a mar- ker of bone formation) expression levels of various os- teoblastogenic genes.

In conclusion, the differentiating of PSC were indu- ced the up- and downregulation of adipogenic, myoge- nic, and osteoblastogenic genes, thereby contributing to multipotent cell. Our data suggest that differentiation shifts the adipocyte, myocyte, and osteocytes in PSC.

This information could be applicable to a unique mo- del for meat quality.

REFERENCES

1. Akune T, Ohba S, Kamekura S, Yamaguchi M, Ch-

ung UI, Kubota N, Terauchi Y, Harada Y, Azuma Y, Nakamura K, Kadowaki T, Kawaguchi H (2004):

PPARgamma insufficiency enhances osteogenesis th- rough osteoblast formation from bone marrow pro- genitors. Clin Invest 113:846-855.

2. Alliston T, Choy L, Ducy P, Karsenty G, Derynck R (2001): TGF-beta-induced repression of CBFA1 by Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO J 20:2254- 2272.

3. Asakura A, Komaki M, Rudnicki M (2001): Muscle satellite cells are multipotential stem cells that ex- hibit myogenic, osteogenic, and adipogenic differen- tiation. Differentiation 68:245-253.

4. Bajard L, Relaix F, Lagha M, Rocancourt D, Daubas P, Buckingham ME (2006): A novel genetic hierar- chy functions during hypaxial myogenesis: Pax3 directly activates Myf5 in muscle progenitor cells in the limb. Genes Dev 20:2450-2464.

5. Chargé SB, Rudnicki MA (2004): Cellular and mo- lecular regulation of muscle regeneration. Physiol Rev 84:209-238.

6. Doumit ME, Merkel RA (1992): Conditions for iso- lation and culture of porcine myogenic satellite cells.

Tissue Cell 24:253-262.

7. Du M, Huang Y, Das AK, Yang Q, Duarte MS, Dodson MV, Zhu MJ (2013): Meat Science and Mus- cle Biology Symposium: manipulating mesenchymal progenitor cell differentiation to optimize perfor- mance and carcass value of beef cattle. J Anim Sci 91:1419-1427.

8. Goulding M, Lumsden A, Paquette AJ (1994): Re- gulation of Pax-3 expression in the dermomyotome and its role in muscle development. Development 120:957-971.

9. Grimaldi PA, Teboul L, Inadera H, Gaillard D, Amri EZ (1997): Trans-differentiation of myoblasts to adipoblasts: triggering effects of fatty acids and thiazolidinediones. Prostaglandins Leukot Essent Fa- tty Acids 57:71-75.

10. Hamm JK, Park BH, Farmer SR (2001): A role for C/EBP beta in regulating peroxisome proliferator-ac- tivated receptor gamma activity during adipoge- nesis in 3T3-L1 preadipocytes. J Biol Chem 276:

18464-18471.

11. Livak KJ, Schmittgen TD (2001): Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402-408.

12. Luppen CA, Smith E, Spevak L, Boskey AL, Fren- kel B (2003): Bone morphogenetic protein-2 restores mineralization in glucocorticoid-inhibited MC3T3-E1 osteoblast cultures. J Bone Miner Res 18:1186-1197.

13. Messina G, Cossu G (2009): The origin of embryo-

(8)

nic and fetal myoblasts: a role of Pax3 and Pax7.

Genes Dev 23:902-905.

14. Parker MH, Seale P, Rudnicki MA (2003): Looking back to the embryo: defining transcriptional networks in adult myogenesis. Nat Rev Genet 4:497-507.

15. Rosen ED, Spiegelman BM (2002): Molecular regu- lation of adipogenesis. Annu Rev Cell Dev Biol 16:

145-171.

16. Sabourin LA, Rudnicki MA (2000): The molecular regulation of myogenesis. Clin Genet 57:16-25.

17. Saini A, Stewart CE (2006): Adult stem cells: the therapeutic potential of skeletal muscle. Curr Stem Cell Res Ther 1:157-171.

18. Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA (2000): Pax7 is required for the specification of myogenic satellite cells. Cell 102:777-786.

19. Shin DW, Kim SN, Lee SM, Lee W, Song MJ, Park SM, Lee TR, Baik JH, Kim HK, Hong JH, Noh M (2009): (—)-Catechin promotes adipocyte differentia- tion in human bone marrow mesenchymal stem cells through PPAR gamma transactivation. Biochem Pharmacol 77:125-133.

20. Singh NK, Chae HS, Hwang IH, Yoo YM, Ahn CN, Lee SH, Lee HJ, Park HJ, Chung HY (2007): Trans- differentiation of porcine satellite cells to adipobl- asts with ciglitizone. J Anim Sci 85:1126-1135.

21. Sirabella D, De Angelis L, Berghella L (2013): So- urces for skeletal muscle repair: from satellite cells

to reprogramming. J Cachexia Sarcopenia Muscle 4:

125-136.

22. Taylor-Jones JM, McGehee RE, Rando TA, Lecka- Czernik B, Lipschitz DA, Peterson CA (2002): Acti- vation of an adipogenic program in adult myo- blasts with age. Mech Ageing Dev 123:649-661.

23. Vourc'h P, Romero-Ramos M, Chivatakarn O, Yo- ung HE, Lucas PA, El-Kalay M, Chesselet MF (2004):

Isolation and characterization of cells with neuro- genic potential from adult skeletal muscle. Biochem Biophys Res Commun 317:893-901.

24. Wu H, Ren Y, Li S, Wang W, Yuan J, Guo X, Liu D, Cang M (2012): In vitro culture and induced di- fferentiation of sheep skeletal muscle satellite cells.

Cell Biol Int 36:579-587.

25. Yablonka-Reuveni Z, Rudnicki MA, Rivera AJ, Pri- mig M, Anderson JE, Natanson P (1999): The tran- sition from proliferation to differentiation is dela- yed in satellite cells from mice lacking MyoD. Dev Biol 210:440-455.

26. Yanik SC, Baker AH, Mann KK, Schlezinger JJ (2011):

Organotins are potent activators of PPARγ and adi- pocyte differentiation in bone marrow multipotent mesenchymal stromal cells. Toxicol Sci 122:476-488.

27. Zhang JY, Yu SJ, Fu Y (2013): Effect of sonicated ex- tracts of Porphyromonas gingivalis on osteogenic di- fferentiation of mouse osteoblasts. Zhonghua Kou Qiang Yi Xue Za Zhi 48:398-402.

(Received: 3 December 2013/ Accepted: 17 December 2013)

참조

관련 문서

Reverse CGTAGGCAAACTAAACTCCACAG CD163, cluster of differentiation 163; b-Actin, beta actin; FMDV, foot and mouth disease virus; PRRSV ORF7, porcine reproductive

The estimates of marker allele additive and dominance effects indicated that marker alleles B and D at locus S0120 were linked to the QTL allele favoring less backfat

The results in Figure 4 clearly indicates that serum lipids can induce a lot better oil droplet accumulation and expression of PPAR gamma (p&lt;0.01) after their treatment to

Conclusions: Since NLR was significantly elevated in group LT-PTC and group PTC, NLR value may give an opinion as a potential marker in differentiation of benign and malign

After the palm strike I’ll pick up a cross check on his elbow with my left hand and begin a forehand thrusting line into his abdomen, groin, and inner thigh..?. Here he

The proposal of the cell theory as the birth of contemporary cell biology Microscopic studies of plant tissues by Schleiden and of animal tissues by Microscopic studies of

To identify the role of VRK1 in liver cancer, VRK1 levels were examined in an immortalized hepatocyte cell line, THLE-2, and in six HCC cell lines, including SH-J1,

Therefore, the objectives of the current study were (1) to prepare BMP2-OpgY with an alkyne group and to examine the osteogenic differentiation of hPLSCs induced by BMP2-OpgY,