Sequence analysis and expression of groE gene encoding heat shock proteins of Brucella abortus isolates

전체 글

(1)³¤¥Èó. * .* a. (2005) 45 1 Korean J Vet Res(2005) 45(1) : 45~53. #SVDFMMBBCPSUVT]ÚªÒ~)FBU4IPDL1SPUFJO z^HSP&F*¶~"8*ª+**. BÏ ÁBæ'ÁËã> ÁB«ÆÁ;c ÁRsN Á*Z;

(2). . . ÏÎL >~ (")79\² *8ÊL ~ ÏÎL ;î*~Bæ\b8 BÞL >~ (²Òß: 2005j 1ú 9¢) 1. 2. 3. 4. Sequence analysis and expression of groE gene encoding heat shock proteins of Brucella abortus isolates Tae-Yong Kim1, Ji-Young Kim, Kyung-Soo Chang2, Myung-Cheol Kim, Chang-Sik Park3, Hong-Ryul Han4, Moo-Hyung Jun* College of Veterinary Medicine, Chungnam National University, Daejeon 305-764, Korea 1 ChoongAng Vaccine Laboratory, Daejeon 305-348, Korea 2 College of Medicine, University of Kentucky, Lexington KY40536-0298, USA 3 Research Center for Transgenic Cloned Pigs, Chungnam National University, Daejeon 305-764, Korea 4 College of Veterinary Medicine, Seoul National University, Seoul 151-742, Korea (Accepted= January 9, 2005) Abstract : GroE that is a heat shock protein composed of GroEL and GroES is known as an immunodominant target of both the humoral and cellular immune responses in bovine brucellosis. This study was carried out to characterize groE gene encoding heat shock proteins of B. abortus isolated in Korea and to evaluate the immunogenicity of the GroE protein expressed in E. coli system. In PCR the specific signals with the size of 2,077 bp were detected in five strains isolated from the mammary lymphnodes of the dairy cattle that were serologically positive and the reference strains. In comparison of the sequences of nucleotides and amino acids among the strains, GroES showed 100% identity in both sequences. GroEL was evaluated 99.0~99.9% in nucleotides and 98.0~100% homology in amino acids. The groE gene including groES and groEL was inserted into pET29a vector and constructed pET29a-GroE recombinant plasmids. The inserted groE was confirmed by digestion with Nco1 and EcoR1 endonucleases and nucleotide sequencing. E. coli BL (DE3) was transformed with pET29a-GroE, named as E. coli BL (DE3)/pET29a-GroE. In SDS-PAGE, it was evident that the recombinant plasmid effectively expressed the polypeptides for GroES (10 kDa) and GroEL (60 kDa) in 0.5, 1 and 2 hours after IPTG induction. The immuno-reactivity of the expressed proteins were proved in mouse inoculation and Western blot analysis. Key words : B. abortus, groE gene, nucleotides sequences, expression of groE. \º ]Ò Ö>\>8(R11-2002-100-0000-0)~ æöj )j >¯>îr. *Corresponding author: Moo-Hyung Jun College of Veterinary Medicine, Chungnam National University, Daejeon 305-764, Korea [Tel: +82-42-821-6753, Fax: +82-42-822-4216, E-mail: [email protected]]. 45.

(3) BÏÁBæ'ÁËã>ÁB«ÆÁ;?ÁRsNÁ*Z;. 46. * . ~ "º öbî 5 rJ^ ® º ¢« ÊÞ.Ê W¢ê ®Ò Nê ¶F öêR ~ ÊÞ.Ê& &î r ^

(4) ÚöB W>º ©b Wî W ";öB complex oligomeric protein~ 5 Ï*æ ;Wö ·Ï~, chaperone $º chaperonins¢ê ®Ö [10]. Wf Escherichia coli ¢ *~ &æ ö^

(5) f ê ^

(6) öB Ã«>îb [4, 5, 11, 23], ' "VB ö ~ z^>, Û öÖ;Vö & >w j ¢b* ¶& î~ FBºb ·Ï~Vê ~ , ^

(7) Ú 6"B ÷ö~ j êf"º VËj ~ º ©b rJ^ ® [24]. $ ^~ HSPsº 6" B ?"~ öB^

(8) (antigen presenting cells)~ ¾Ò ";j ö ÚW 5 ^

(9) W >wj Fê~º " º öÖ;¶ ·Ï [3, 14, 16, 22]. B. abortus HSPsº j 42 C~46 CöB 2~3* N ÊÞ.Ê¢ &®j r ¾æ¾ 70, 60, 18 5 10 kDa ~ W >îb [5, 21], 7 60 kDa~ GroEL " 10 kDa~ GroESº GroE HSPs ®ÒÚ . GroEL f ?" >w ÆÒK &Ë ¸ GroESº GroEL VË~ cofactor ·Ï~º ©b rJ^ ® [1, 2, 9]. B. abortus~ GroESf GroELj z^z~º groES f groEL F*¶º "ïÚ çö 7B *~~ ® b Wî Wö &NB operon" promoter 5 terminator sequence¢ &æ ® [15]. " GroELf Legionella pneumophila, E. coli, Mycobacterium leprae, Mycobacterium tuberculosis 5 Yersinia enterocoliticaf ?f ÷öW ^ö & ?" ~ OÚV*öB &æ Æ~ ªj¢ Ã& Ê, ^

(10) BW " ÚW >wj FV Êº 7º VËj B : ®b [4, 11], B. abortusöBê ^

(11) Wª ÚW 5 ^

(12) BW >wj ÃêÊº ö W¢º Ò rJr. [15-17, 19]. V¢B ö & groE F*¶~ "VB ªC" Ò W Ö 5 VËö & & B® >¯> ® [14, 17, 19]. B. abortusöBº S19"~ groE operon~ " " VBj ªC~ E. colif çÿWj jv : ®b [9], B. abortus~ HSPsº CD4 Th1 subsetö ~ 6 î-V¾~ Öj Ã&~ &^

(13) ~ VËj êÊ, CD8 T â*ö ~ 2f¢ö 6"B. Brucella abortus(B. abortus) lipopolysaccharide [8], outer membrane protein(OMP) [6], cell surface proteins(BCSP31) [12, 22] heat shock proteins(HSPs) [8, 19] . HSPs , , ,. o. o. +. +. ^

(14) ¢ Ï~º VËj ÃêÊº öb ÆÒ K ¸V r^ö Ò subunit ö Bö & & >¯B : ® [1, 2]. öBº Ú <² ¦V ªÒB B. abortus 5 "f R&"¢ ~ HSPs 7 öb 7º GroESf GroELj z^~º groE F*¶ö & PCR j >¯~ groE F*¶~ "VB" jÖ B j jv ªC~, jÞ F*¶¢ E. coliöB B* ~ áÚê W~ öWj «~V * ¢N~. þj >¯~& .. Òò 5 O». # 8· ÚöB ¦f¢ Ú ·Wb 6;>Ú Ú¾ª B <²~ FOç â*. 5 ÖF¦V ªÒ>Ú biovar 1b ÿ;B 5"~ B. abortus KB4, KB5, KB6, KB7 5 KB8 "f [13], (National Animal Disease Center, NADC)¦V ª· Af B. abortus(biovar 1)¢ ^ b ~& . f Brucella broth(Difco, USA) f Brucella agar(Difco, USA)¢ Ï~ 10% CO V ·V(37 C)öB 3~5¢ V·~& . (FOPNJD %/" ºÂ j Brucella brothö 7«~ 48* V· ê TE buffer(10 mM Tris-HCl, 1 mM EDTA, pH 8.0) 1² ^¿~ Ò¦FÎ j -20 CöB 18* ;~~ & . j 4,000 göB 3ª* ö ê *bj 300 µl~ Single-detergent lysis buffer [50 mM Tris-Cl(pH 8.0), 150 mM NaCl, 0.02% sodium azide, 1% Triton X100 $º 1% NP-40]ö ¦F r 37 CöB 10ª* >w~&b, 10% SDS Ï 150 µl¢ Î&~ N öB 10ª* ¾Ò~& . Phenol/chloroform/isoamylalcohol(P/C/I)¢ ÿï &~ ç[j ~ 100% ö æ¦" 1/10V~ 3M NaOAC(pH 5.2)¢ & ê -70 C öB 30ª* ;~~& . 12,000 göB 20ª* ö *Î ê 75% öæ¦ v ® ^¿~ ~ TE bufferö Ò ¦F8 . RNase(1 mg/ml) 5 µlf proteinase K(10 mg/ml) 1 µl¢ Î&~ 37 CöB 1* >w. r P/C/I¢ ÿï & ê ÿ¢ O»b DNA¢ ºÂ ~ TE buffer 20 µlö ÒÏ~& [7]. 2. o. o. o. o. o. 1PMZNFSBTF DIBJO SFBDUJPO 1$3. Gorf Mayfield [9] Ò Lin [15]" GenBank¢ ^~ groEö & BGroE primer(product size: 2077 bp); BGroE(F) 5'-TAACACCA AGGGTTATACCATGGCTGA-3',.

(15) Brucella abortus. ]Ú ªÒ~ Heat Shock Protein z^ groE F*¶~ "8* ª+ B*. BGroE(R) 5'-TTTAGTCCATGGGCG A G CTTTATGGAC -3' , BGroE(R) NcoI T C . genomic DNA 2 µl 10 Ex Taq reaction buffer 5 µl, 25 mM MgCl2 10 µl, 2.5 mM dNTPs 4 µl, BGroE(F) BGroE(R) primer 1 µl(100 pmol/µl) 26 µl Ex Taq polymerase(TaKaRa, Japan) 1 µl(1.25 unit/ µl) 50 µl . 5 Automated thermal cycler 94oC , 94oC 1 , 64oC 1 , 72oC 4 30 , 7 [7, 13]. PCR DNA 72oC 1% ethidium bromide agarose gel Image analyzer(Pharmacia, Sweden) [20].. ¢ B~&b öº ¦*¢ ò. 8 * ¢ &~~& ÖÃ f ö Ü f '' f Ã~> ¢ Î &~ ¢ &~ + & >ê ê ¾ b~&. ö* ª* >w Î ê ö* ª ö* ª ö* ª ÿn >w~º ¢N~ ";j ² >~&b îæïb Ã ö* ª* >w8. º j Ï~ *8' ÿ~& $ë~ &. . Sambrook f Russell [20]~ O»j wÏ~ >¯~ &b, Subcloning vectorº pGEM-T vector(Promega, USA)¢ ÒÏ~& . Insert DNAº BGroE(F)f BGroE(R) primers¢ Ï~ Ã ê ;B KB4 "~ PCR Ã DNA¢ ÒÏ~& . Cloning vector º pET-29a plasmid vector(Novagen, USA)¢ ~&b, groE F*¶¢ ~8 * NcoI (TaKaRa, Japan)b ¾Ò~ linear vector ò ¶&[j ÛBÊ8 *~ 56 Cö* 1* calf intestine alkaline phosphatase (TaKaRa, Japan) ¾Ò~ & [12, 20]. pGEM-T vectorö PCR Ã DNA¢ [Ê8 * ~ Promega protocolj Ï~&b, áÚê Ò plasmid¢ pET29a-GroE¢ ~& . E. coli JM109 cell (Promega, USA)" E. coli BL21(DE3) cell(Novagen, USA)j [B pGEM-T vectorf pET29a-GroE ;î *~~8 * '' ~& [12, 20]. pET29a-GroE ;î*~B j E. coli BL21(DE3)/pET29a-GroE, o. ;î*~B ©j E. coli BL21(DE3)/pET-29a R8~& . Ö"8 5 jÖ * ª+ pGEM-T vector¢ Ï~ groE F*¶¢ plasmid DNA¢ ÒÏ~&b Complement sequence¢ * primersº M13(F), M13(R)f Clone Manager 6, version 6.00(Scientific & Educational Software, USA) ¢ Ï~ 9 GroEseqF1, GroEseqR1, GroEseqF2, GroEseqR2, GroEseqF3, GroEseqR3¢ ÒÏ~& (Table 1). "8* ª+f Macrogen Ltd. (Korea)ö *ç~ >¯~& . Clone Manager 6, version 6.00(Scientific & Educational Software, USA)¢ Ï~ "8 * ¦8 jÖ *j Ö;~&b, GenBankö* á Úê ¶òf multialignö ~ B. abortus ªÒ"~ groES f groEL F*¶ "8*j B. abortus S19(Accession# M82975), B. abortus lambda-2001(Accession# M83930) 5 E. coli(Accession# X07850)f jv ª+~& . & DPMJ.

(16) ö* HSP& B* pET29a-GroE ;î*~B E. coli BL21(DE3)¢ ¾î(50 µg/ml) Î&B LB agarö êö7«~ 2~3 mm~ ÷£j 1B .~ ¾î(50 µg/ml) Î&B LB broth 1 mlö 7« ê 37 Cö* ~!J V ·~& . ¾î Î&B LB broth 10 mlö V·B 50 µl¢ 7«~ 37 Cö* v>(200~250 rpm) V·~* UV-ª77êê(W7ê 600 nm)ö* OD 0.6 > V· 1 ml¢ 1.5 ml þ&ö j~ 4 Cö &~&, Îf V·ö IPTG¢ 1.0 mM >ê Î&~ 37 Cö* v> V·~* 0.5*, 1 * 5 2* *Ïb 1 ml~ V·j '' j~ 4 Cö &~& . pET-29a. o. o. o. o. o. . jB V·j Nö* 12,000 g 1ª* ö . Table 1. Primers for DNA sequencing of groE gene Primers GroEseqF1 GroEseqF2 GroEseqF3 GroEseqR1 GroEseqR2 GroEseqR3 M13(F) M13(R). Nucleotide sequences (5' to 3') TATCCTCGCTGACGCTGTTA GTCGCCTTACTTCGTCACCA GATCAAGCAGCAGATCGAAG TAACAGCGTCAGCGAGGATA CGAAGTAAGGCGACAGGTAG GAGCTTGGCAAGACGTTCCT CAGGAAACAGCTATGAC GTTTTCCCAGTCACGAC. 47. Size (mer). Sequence position. 20 20 20 20 20 20 17 17. 450 ~1000 987 ~1503 1431 ~2028 469 ~1 1000 ~450 1503 ~987 1 ~2028 2028 ~1.

(17) BÏÁBæ'ÁËã>ÁB«ÆÁ;?ÁRsNÁ*Z;. 48. *~ ç[j B ê Ü. 1 SDS gel-loading buffer [50 mM Tris-Cl(pH 6.8), 100 mM dithiothreitol, 2%(w/v) SDS, 0.1% bromophenol blue, 10%(v/v) glycerol] 100 µl 3 12,000 g 10 100oC . Tris-glycine electrophoresis buffer 80 V 30 150 V 2 . pre-stained protein ladder (10 kDa - 190 kDa, Invitrogen, USA) [Coomassie brilliant blue R-250 0.25 g, methanol 50 ml, H2O 40 ml, acetic acid 10 ml] 1 [methanol 30%, H2O 60%, acetic acid 10%] [20].. ª ¢ Î&~ ö* ª* y ê * öªÒ~ áf ç[j þ~&. ¢ ÒÏ~ ö* ª* *¾ Ò ê ò¢ I ö* * ;ê *8'ÿ ~& ª¶ïj G;~8 * ¢ ÒÏ~& *8 'ÿ jòB ºj rÚÚ "ï ö * "ï ê î"ï b îï* &V~&. îÖÊ 7« 5 (SP& ß]Ú B Roop [19]~ O»j wÏ~ >¯~& . E. coli BL21(DE3)/pET29a-GroE¢ ¾î(50 µg/ml) Î &B LB broth(5 ml)öB êû V· ê IPTG¢ 1 mM >ê Î&~ 37 CöB 2* êû V·~& . ¢ "> 3² ^¿ ê .r2ªêV(Sonics, USA)öB 60% ÿKb 10ª* ¾Ò¢ ~ ^

(18) ÏÂ >j ·B~& . ^

(19) ÏÂ>" incomplete Freund's adjuvant(Sigma, USA)¢ 1:1~ jN b ©j 0.2 ml O îÖÊ(BALB/c) b~ö 7«~&, ê 8¢ *Ï b 2² º& 7«~&b, îæï 7« ê 10¢ ö j., .Ó ªÒ~ -20 Cö &~& . E. coli &N Ú 5 jß Ú¢ B~V * E. coli BL21(DE3)/pET-29a¢ *f ?f O»b V·~ ^

(20) ÏÂ>j B~& . îÖÊ .Ó(1 vol.)" &jB ^

(21) ÏÂ>(10 vol.)j b~ 37 CöB 3* >w Î ê 15,000 göB 30ª* ïË öªÒ~ ç[j ~º ";j 2² > r 0.2 µm syringe filter "~& . áÚê ß.Óf Western blot þö ~&b, $ .Óö & B. abortus þ& w÷>w ê(ã>~"¦ö)j Ï Ú¦ Òf Western blot þb B*B GroE W~ öWj G;~& . o. o. o. PBST[1.37 mM NaCl, 2.7 mM KCl, 10 mM Na HPO , 2 mM KH PO , 0.05%(v/v) Tween 20] 5ª* 3² ^ ¿~& . r &jB ßÚ 37 CöB 1* >wÎ ê *f ?f O»b ^¿~, goat antimouse IgG HRP conjugate(Sigma, USA)¢ 1* >w 8 . Ò ^¿ ê DAB substrate (5 ml)f 1 ª* >w ê Ã~>¢ Ï~ ^¿~& . 2. 2. 4. 4. o. 1$3ö. Ö . ~R ªÒ~ F*¶ { BGroE primer¢ Ï~ B. abortus(biotype 1) 5 5 "~ ÚªÒ B. abortus Ò B. abortus RB51" ~ DNA ºÂ>ö & PCRj ~&~ :, ^ " 5 ªÒ" Îv 2,077 bp~ ß Z& &V>î. (Fig. 1).. F*¶~ V ¢ NcoI" EcoRI BÎ² ¾ Ò~ ö *V'ÿ~ 2.0 kbf 1.7 kb V~ Ã B Z& &V>Ú groE F*¶~ ç¢ {~&b, T7 promoter primer (5'TAATACGACTCACTATAGG-3')¢ Ï~ "VB ª C Ö" NcoI ¦*ö ;{® ã«B © ¦Ã> î . 52 F*¶~ "8 5 jÖ * jL GroE¢ W~º groES(297 bp)f groEL(1,641 bp)~ "VBj ÚªÒ 5"f B. abortus S19 5 B. abortus lambda-2001¢ jv~&~ :, groES~ "VB f 7" Îv j* ¢~(100%)~& E. colifº 59.9% ~ çÿWj ¾æÚî . groELf ÚªÒ 5"f B. 052 pET29a-GroE plasmid 1% agarose gel DNA. 8FTUFSO CMPU. " ¢ Ï~&. & jòB º" îÞf®ï ": + 6j J~~ * :+ ê îÞ f®ïj âÚÚ ö & öB * >w~. XCell II Blot Module(Invitrogen, USA) DAB substrate kit(Vector, USA) . SDS-PAGE (Osmonics, USA) 25 V 3 , blocking solution [10 mM TrisCl(pH 8.0), 150 mM NaCl, 0.05%(v/v) Tween 20, 5% 1 Skim milk(Difco, USA)] 37oC. Fig. 1. Amplification patterns of groE in the various strains of B. abortus by PCR using BGroE primers. M: 1 kb DNA ladder marker, Lane 1: reference strain, B. abortus (biovar 1), Lane 2: B. abortus (RB51), Lane 3, 4, 5, 6 and 7: B. abortus isolates KB4, KB5, KB6, KB7 and KB8..

(22) Brucella abortus. ]Ú ªÒ~ Heat Shock Protein z^ groE F*¶~ "8* ª+ B*. 5 ö & '' 5 ~ ¸f çÿWj ¾æî. $ fº ~ çÿWj ¾æÚî. f ~ "VBj V. ~ ¢ W~º B~ jÖ B" j W~º B~ jÖ Bj Ö ;~ jv~&~ : 5 º 5 ªÒ" Îv ¢ ~~&. f ÚªÒ"f 5 f jvöB ~ ¸f çÿWj ¾æî $ fº ~ çÿWj ¾æÚî. 52 9 ** E. coli BL21(DE3)/pET29a-GroE~ GroESf GroEL . abortus S19 B. abortus lambda-2001 99.8~99.9% 99.0~99.1% . 68.3~69.1% E. coli (Table 2). groES groEL 10 kDa GroES 98 60 kDa GroEL 546 (Fig. 2 3), GroES B. abortus S19, B. abortus lambda-2001 100% (Fig. 2). GroEL B. abortus S19 98.0~100% B. abortus lambda-2001 . 66.6~67.7% E. coli (Table 2).. 49. W B* ç¢ «~V * IPTG Fê ê 0, 0.5, 1 5 2*ö E. coli¢ >{~ SDS-PAGE»b ªC ~& . Ö" Fê ê 0.5, 1 5 2* V· Î E. coli BL21(DE3)/pET29a-GroEöB GroESf GroEL Wb º;>º 13 kDa" 60 kDa V~ Z& ''. Table 2. Homology comparison of the nucleotide and amino acid sequences of GroEL of B. abortus isolates and reference strains Bacteria. Nucleotide sequence homology (%) S19. Amino acid sequence homology (%). lambda-2001. S19. lambda-2001. 1627/1641 (99.1) 1625/1641 (99.0) 1627/1641 (99.1) 1626/1641 (99.1) 1626/1641 (99.1). 545/546 (99.8) 543/546 (99.5) 546/546 (100) 544/546 (99.6) 544/546 (99.6). 537/546 (98.4) 535/546 (98.0) 538/546 (98.5) 536/546 (98.2) 536/546 (98.2). 1125/1647 370/548 (68.3) (67.7). 365/548 (66.6). Isolates. KB4 1640/1641* (99.9) KB5 1638/1641 (99.8) KB6 1640/1641 (99.9) KB7 1639/1641 (99.8) KB8 1639/1641 (99.8) E. coli. 1138/1647 (69.1). *No. of identity/No. of nucleotides or amino acids. Fig. 2. A comparison of the deduced amino acid sequences of 10 kDa GroES protein of B. abortus isolates compared with two B. abortus reference strains. The spots indicate identical residues.. Fig. 3. A comparison of the deduced amino acid sequences of 60 kDa GroEL protein of B. abortus isolates compared with two B. abortus reference strains. The spots indicate identical residues. The dashes indicate empty residues..

(23) 50. BÏÁBæ'ÁËã>ÁB«ÆÁ;?ÁRsNÁ*Z;. Fig. 4. SDS-PAGE profile of the E. coli BL21(DE3)/ pET29a-GroE and E. coli BL21(DE3)/pET-29a. M: Molecular weight marker. Lane 1~4: E. coli BL21(DE3)/pET29aGroE, Lane 5~8: E. coli BL21(DE3)/pET-29a. IPTG induction: Lane 1 and 5; 0 hr, Lane 2 and 6; 0.5 hr, Lane 3 and 7; 1 hr, Lane 4 and 8; 2 hrs.. &V>î . &b E. coli BL21(DE3)/pET29aöBº 13 kDa" 60 kDaöB Z& &V>æ p~. (Fig. 4). E. coli BL21(DE3)/pET29a-GroE¢ Î îÖÊ .Ó" jßÚ¢ B GroE ßÚ¢ ~ Western blotj ~& . W>¾Ò nB .Ób >wÎ ãÖ E. coli BL21(DE3)/pET29a-GroEöB º GroELö >º 60 kDa" GroESö >º 13 kDaöB IPTG Fê ê 0.5, 1 5 2*öB Îv ; Z& &V>îb 14~15B~ jß Z& &V >î . $ & E. coli BL21(DE3)/pET-29aöBº 60 kDa" 13 kDaöBº Z& ìîb¾ 10~12B~ j ß Z& &V>î (Fig. 5). jßÚ¢ B. Fig. 6. Western blot analysis of the proteins expressed in E. coli BL21(DE3) with GroE-specific mouse serum. M: Molecular marker. Lane 1~4: E. coli BL21(DE3)/pET29aGroE, Lane 5~8: E. coli BL21(DE3)/pET-29a. IPTG induction: Lane 1 and 5; 0 hr, Lane 2 and 6; 0.5 hr, Lane 3 and 7; 1 hr, Lane 4 and 8; 2 hrs.. ßÚ¢ ¾Ò~ >¯ Western blot þöBº E. coli BL21(DE3)/pET29a-GroE~ ãÖ 13 kDa" 60 kDa öB IPTG Fê ê 0.5, 1 5 2*öB Îv ß Z & &V>îb, B* ;êº IPTG ¾Ò ê 1*ö B &Ë ;~² ¾æÒ . &öBº Z& &V> æ p~ (Fig. 6). ** 52 9~ ö9 IPTG ¾Ò ê 2*B E. coli BL21(DE3)/pET29aTable 3. Immunogenicity of the GroE protein expressed in E. coli BL21(DE3)/pET29a-GroE in mice. Groups. E. coli BL21(DE3)/ pET29a-GroE. 30. Control**. 5. Control(saline). 5. a). Fig. 5. Western blot analysis of the proteins expressed in E. coli BL21(DE3) with mouse serum hyperimmunized with E. coli BL21(DE3)/pET29a-GroE. M: Molecular marker. Lane 1~4: E. coli BL21(DE3)/pET29a-GroE, Lane 5~8: E. coli BL21(DE3)/pET-29a. IPTG induction: Lane 1 and 5; 0 hr, Lane 2 and 6; 0.5 hr, Lane 3 and 7; 1 hr, Lane 4 and 8; 2 hrs.. Serab) No. Agglutination Western of mice test blot immunizeda) −3 c) 1/50 1/100 10 10−4 10−5 −. −. +/+* +/+ +/−. −. −. −/− −/− −/−. −. −. −/− −/− −/−. The mice were immunized with the lysate of E. coli BL21(DE3)/pET29a-GroE mixed with incomplete Freund’s adjuvants. b) The specific sera were prepared by absorption with the lysates of E. coli BL21(DE3)/pET29a. c) Dilution rates of the pooled sera of 10 mice. The experiments were triplicated. * The reactivity for GroEL/GroES was represented. ** The mice were administered with incomplete Freund’s adjuvants only..

(24) Brucella abortus. ]Ú ªÒ"~ Heat Shock Protein z^ groE F*¶~ "8* ª+ B*. ~ ^

(25) ÏÂb ~ áf îÖÊ ß.Ó ö & B. abortus w÷>wj >¯ : Îv rW îb, Western blotb þ : .Ó\CV> 10 " 10 öBº GroEL 5 GroESöB ·W>w ¾æÒ , 10 öBº GroELf ·W Ò GroESº rWb ¾æÒ (Table 3). Incomplete Freund's adjuvantsf ">¢ 7« &f Îv rWî . GroE. −3. −4. −5. 8. ~ OÚö ·Ï~º ö>î 7 ~¾ rJê f ÚW " ^

(26) W j Fê~ & ^

(27) ÚöB Ã~º jº ¾ ¢

(28) ~ ®V H^ö 7º ö Wb *"> ® [3, 8, 16, 22]. Oliveira [17]f E. coli maltose binding proteinö [B Ò B. abortus GroELf ¸f >&~ IL-2 Öj Fê ®b, B. melitensis Rev. 1ö 6·B Vîc~ foodpad ö Ò GroELj R®j H ; æ; "">w j ¢bÎ º Ò j ~& . Ò Lin [16] f E. coliöB B*B Ò B. abortus GroEL W B. abortus S19 B îÖÊ .Ó" Western blot ª CöB ; ·W>wj ¾æÚ, W'j V. B. abortus~ GroELf ÚW " ^

(29) W j Fê~º 7º ö bîªj æ' : ® . ¾ jç GroE HSPs~ b' Wç 5 ' ·ÏV *ö & C&ææ pf 6 ôj ö & B & ºê> ® . öBº ÚöB ªÒB B. abortusb GroE¢ z^~º groE F*¶¢ PCR Ã ~, "V B" jÖ Bj «~ áÚê Ö"¢ Brucella R&"f jv ªC~&b, jÞ F *¶¢ E. coliö ~ GroE Wj B*~ GroES 5 GroEL¢ ·B > ®º V.¢ {ã~&. . BGroE primerº groESf groEL¢ þ Ã Ò > ®ê ·B~&b, BGroE(R) primeröº NcoI ¦*¢ ò Ú pET-29a plasmid vectorö groE¢ Î"' b Ò > ®ê ~& . PCR þöB R& "f ªÒ" Îv 2,077 bp~ ß DNA .Þ Ã Nj { > ®î . PCR Ã B DNA¢ pGEM-T plasmid vectorö subcloning~ NcoI BÎ² ¾Òö ~ áÚê 2.0 kb ~ DNA¢ pET-29a plasmid vectorö ã«~ pET29aGroE plasmid¢ ·B~& . pET-29a plasmid vectorº ;K T7 lac promoter¢ &æ ®b Ï' F*¶¢ ~~ö ã«~ E. coli BL21(DE3)öB /~º T7 B. abortus GroE HSPs , B. abortus GroES GroEL. 51. ö ~ *Ò> F*¶ º "ïÚö ê«>Ú ® ~ ~~ö *~~ ® ÚB ~ Î&ö ~ Fê B*j . > ® ê Jê>Ú ® $ ~ ¦*& j z^~º B " ¢~~V r ^ö ®jº jÖ B*>æ pº Ë6j &æ ®bæ þö Ï~& . $ groESf groEL f 90 bp ;ê~ Ò¢ v ®b '' B codon " «ö codonj &æ ® [9, 15]. pBR322 $º pUC plasmidöB 2B expression vectoröBº ~¾~ originb GroESf GroEL" ?f chaperonej ÿö B*Ò > ®º ©b rJ^ ®b, pET-29a plasmid vectorê GroESf GroELj ÿö B*Ò > ®. [10]. ¾ ºê ;B 5 B*~ ÎËj ¸V * pMal vector¢ Ï~¾ [14], ê^

(30) [1, 14]¢ Ï GroEL~ B*ö & ¢ >¯¢ ' B . þöB 297 bp~ groESf 1,641 bp V~ groEL ~ "VBj C®, ªÒ"f B. abortus S19 5 B. abortus lambda-2001f jv ªC~& . Ö" strain * GroESf GroEL~ "V 5 jÖ Bf ¸f ç ÿW" F*' W {>î (Figs. 2, 3 5 Table 2). $ E. coli~ groESf groEL~ jÖ Bj B. abortus" jv : 49.0~59.9% 5 66.6~69.1%~ ç ÿWj '' ¾æÚî, ß® GroEL~ jÖ º E. colif 67.9% ¢~~, Mycobacterium tuberculosis " 59% ç~ çÿW ®b, ¦f¢Ã~ OÚ ö "º f Roop [19] 5 Lin [16]~ W'" pf &W ® º;B . pET29a-GroE plasmid ;î*~B E. coli BL21 (DE3)/pET29a-GroE¢ V·~ IPTG Fê ê áÚ ê ^

(31) V·ö & SDS-PAGEf Western blot¢ > ¯~, GroESf GroEL ;~² B*>º ©j { > ®î, IPTG Fê ê 1~2* '; B** b 6>î . SDS-PAGEöB 10 kDa GroES& 13 kDa ;ê £* ² ¾æÂ ©f plasmid vectorö ®º S . Tag" fusion protein B*>îV r^¢ '>î . S . Tag" fusion proteinf B*B Wj ;B~¾ Western blotb ¦ï ãÖ >wWj ¸ º ÏF > ®j ©b 'B . Western blotö GroE ßÚº OB" ; ê¯Nö V¢ E. coli BL21(DE3)Úö VB j ß>w 6²> GroE Wö & ßW Ã& >º ©j Western blot þö ~ { > ®î. (Fig. 5 5 6). $ îÖÊö E. coli BL21(DE3)/pET29aRNA polymerase T7 RNA polymerase (λ DE3 lysogen) E. coli BL21(DE3) lacUV5 promoter IPTG . multicloning site NcoI methionin codon.

(32) 52. BÏÁBæ'ÁËã>ÁB«ÆÁ;?ÁRsNÁ*Z;. GroE¢ 7«~ áÚê .ÓöB ¸f >&~ GroES f GroEL Ú& Western blotöB {>Ú E. coli BL21(DE3)/pET29a-GroE& Î"'b GroE Wj B * º Ò j { > ®î . ¾ ²¦f¢ Ã þ&w÷>wÏ öö &Bº Ú&& *& ;>æ p~ (Table 3). f ?f Ö"º GroE HSPsº £ëWöB ¶" BV>º B. abortus lipopolysaccharides~ O side chain ööB FB>º w ÷Ú ^Bf W" ¢6"ö VB Ú¢ 6ê > ®º &Ë &n' ö¢ B F¯ " &NW ® 'B [2, 18, 19, 22]. GroE Wj Î"'b B*~ ;B > ®º Ê j »~, GroE~ öW" OÚV*ö & º&' & jº~ 'B .. Ö V. ~ OÚö ·Ï~º heat shock ~ ¢« GroE¢ z^~º groE(gorEL/groES) F*¶¢ »b Ã ~, "VB" jÖ B j «~ Brucella R&"f Ú ªÒ" *~ çÿWj jv ªC~& . $ groE¢ E. coliöB ~ B*B GroE W~ öWj þ~ á Úê Ö"º r" ? . (1) BGroE primers¢ Ï~ PCRj >¯ :, ^" B. abortus(biovar 1)f B. abortus RB51 Ò 5"~ ÚªÒ B. abortusöB 2,077 bp V~ DNA& Ã >î . PCRö ~ Ã B 2,077 bp~ DNA ¢ Ò pET29a-GroE plasmid¢ ·Â~&, ã« B groE F*¶¢ NcoI" EcoRI ¾Òf "VB ªC j Û {~&b, ;î*~B E. coli BL21(DE3)/ pET29a-GroE¢ ·B~& . (2) Ú ªÒ"~ groES 5 groEL F*¶~ "V Bj C®, ªÒ"f B. abortus S19 5 B. abortus lambda-2001f jv ªC~& . Ö" GroESº "V B" jÖ B 100% ¢~~&b, GroELf "VB 99.0~99.9%, jÖ B 98.0~100% ¸f çÿWj ¾æÚî . (3) SDS-PAGEf Western blot »b ;î*~B E. coli BL21(DE3)/pET29a-GroEöB GroESf GroEL W b ;>º £ 10 kDa" 60 kDa~ Z& {>î b, B*êº IPTG Fê ê 1~2*ö &Ë ¸ ~ . E. coli BL21(DE3)/pET29a-GroE ^

(33) ÏÂb B îÖÊ .ÓöB GroEL" GroESö >w~º ¸ f Ú& Western blotöB &V>îb, w÷Ú& º rWî .. B. abortus proteins PCR. ^^ò 1. Bae JE, Toth TE. Cloning and kinetics of expression of Brucella abortus heat shock proteins by baculovirus recombinants. Vet Microbiol 2000, 75, 199-204. 2. Bae JE, Schurig GG, Toth TE. Mice immune responses to Brucella abortus heat shock proteins. Use of baculovirus recombinant-expressing whole insect cells, purified Brucella abortus recombinant proteins, and a vaccinia virus recombinant as immunogens. Vet Microbiol 2002, 88, 189-202. 3. Baloglu S, Toth TE, Schurig GG, Sriranganathan N, Boyle SM. Humoral immune response of BALB/c mice to a vaccinia virus recombinant expressing Brucella abortus GroEL does not correlate with protection against a B. abortus challenge. Vet Microbiol 2000, 76, 193-199. 4. Blander SJ, Horwitz MA. Major cytoplasmic membrane protein of Legionella pneumophila, a genus common antigen and membrane of the HSP60 family of heat shock proteins, induces protective immunity in a guinea pig model of Legionnaires disease. J Clin Invest 1993, 91, 717-723. 5. Bukau B, Horwich AL. The Hsp70 and Hsp60 chaperone machines. Cell 1998, 92, 351-366. 6. Dubray G, Charriaut C. Evidence of three major polypeptide species and two major polysaccharide species in the Brucella outer membrane. Ann Rech Vet 1983, 14, 311-318. 7. Gallien P, Dorn C, Alban G, Staak C, Protz D. Detection of Brucella species in organs of naturally infected cattle by polymerase chain reaction. Vet Rec 1998, 142, 512-514. 8. Garin-Bastuji B, Bowden RA, Dubray G, Limet JN. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting analysis of smooth-lipopolysaccharide heterogeneity among Brucella biovars related to A and M specificities. J Clin Microbiol 1990, 28, 2169-2174. 9. Gor D, Mayfield JE. Cloning and nucleotide sequence of the Brucella abortus groE operon. Biochim Biophys Acta 1992, 1130, 120-122. 10. Hightower LE. Heat shock, stress proteins, chaperones, and proteotoxicity. Cell 1991, 66, 191-197. 11. Hubbard RD, Flory CM, Collins FM. Immunization of mice with mycobacterial culture filtrate proteins. Clin Exp Immunol 1992, 87, 94-98. 12. Hur JY, Kim JY, Song KH, Kim MC, Park CS, Kim.

(34) Brucella abortus. 13.. 14.. 15.. 16.. 17.. ]Ú ªÒ~ Heat Shock Protein z^ groE F*¶~ "8* ª+ **. TY, Kim JH, Jun MH. Sequence analysis of the omp2b gene encoding 36 kDa outer membrane protein of B. abortus isolates. Korean J Vet Public Health 2003, 27, 7-16. Kim JH, Chang KS, Kim S, Kim JY, Jun MH. Detection of Brucella spp. using polymerase chain reaction. J Vet Sci CNU 1999, 7, 13-24. Leclerq S, Harms JS, Rosinha GM, Azevedo V, Oliveira SC. Induction of a th1-type of immune response but not protective immunity by intramuscular DNA immunisation with Brucella abortus GroEL heatshock gene. J Med Microbiol 2002, 51, 20-26. Lin J, Adams LG, Ficht TA. Characterization of the heat shock response in Brucella abortus and isolation of the genes encoding the GroE heat shock proteins. Infect Immun 1992, 60, 2425-2431. Lin J, Adams LG, Ficht TA. Immunological Response to the Brucella abortus GroEL Homolog. Infec Immun 1996, 64, 4396-4400. Oliveira SC, Harms JS, Banai M, Splitter GA. Recombinant Brucella abortus proteins that induce proliferation and gamma-interferon secretion by CD4+ T cells from Brucella-vaccinated mice and delayed type hypersensitivity in sensitized guinea pigs. Cell Immunol 1996, 172, 262-268.. 53. 18. Roop RM, Fletcher TW, Sriranganathan NM, Boyle SM, Schurig GG. Identification of an Immunmoreactive Brucella abortus HtrA Stress Response Protein Homolog. Infect Immun 1994, 62, 1000-1007. 19. Roop RM, Price ML, Dunn BE, Boyle SM, Sriranganathan N, Schurig GG. Molecular cloning and nucleotide sequence analysis of the gene encoding the immunnoreactive Brucella abortus Hsp60 protein, BA60K. Microb Pathog 1992, 12, 47-62. 20. Sambrook J, Russell DW. Molecular Cloning a Laboratory Manual. pp. 5.4-5.39, 3rd ed. Cold Spring Harbor Laboratory Press, New York, 2001. 21. Stevens MG, Olsen SC, Pugh GW, Mayfield JE. Role of immune responses to a GroEL heat shock protein in preventing brucellosis in mice vaccinated with Brucella abortus strain RB51. Comp Immun Microbiol Infect Dis 1997, 20, 147-153. 22. Toth TE, Cobb JA, Boyle SM, Roop MR, Schurig GG. Selective humoral immune response of Balb/C mice to Brucella abortus proteins expressed by vaccinia virus recombinants. Vet Microbiol 1995, 45, 171-183. 23. Woolford J. Chaperoning ribosome assembly. Mol Cell 2002, 10, 8-10. 24. Young RA, Elliott TJ. Stress proteins, infection, and immune surveillance. Cell 1988, 59, 5-8..

(35)