This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http: //creativecommons.org/licenses/by- nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Copyright: © 2018 Korean Journal of Agrcultural Science
https://doi.org/10.7744/kjoas.20180057
FOOD & CHEMISTRY
Cytokine modulation in Raw 264.7
macrophages treated with ginseng fermented by Penibacillus MBT213
Ji Yoon Son
1, Gereltuya Renchinkhand
1, Hyoung Churl Bae
1, Seung-Hee Paik
2, Jo Yoon Lee
3, Myoung Soo Nam
1,*1
Laboratory of Milk Food Biochemistry and Biotechnology, College of Agriculture and Life Sciences, Chungnam National University, Daejeon 34134, Korea
2
Division of Food Service Industry, Yonam College, Cheonan 31005, Korea
3
College of Tourism & Health, Joongbu University, Geumsan 32713, Korea
*Corresponding author: [email protected]
Abstract
The fermentation of Panax ginseng yields many compounds including ginsenosides that have various biological functions. The objective of this study was to investigate the modulation of nitric oxide (NO), Interleukin (IL)-6 and tumor necrosis factor (TNF)-α in Raw 264.7 cells treated with ginseng fermented by Penibacillus MBT213. Nitric oxide production in the Raw 264.7 cells treated for 24 hours with fermented ginseng at 3, 7, and 14 days after the treatment decreased to 74, 43, and 36%, respectively, compared with the positive control. The production of IL-6 was inhibited in all the cells treated with fermented ginseng at 3, 7, and 14 days after the treatment except for the positive control. The TNF-α production in the Raw 264.7 cells treated with fermented ginseng for 6 hours at 3, 7, and 14 days after the treatment was about 40,000, 85,000 and 65,000 pg/mL, respectively. Moreover, the TNF-α production in the Raw 264.7 cells treated with fermented ginseng for 24 hours at 7 and 14 days after the treatment was about 160,000 and 180,000 pg/mL, respectively. However, TNF-α production was inhibited in the Raw 264.7 cells at 6 and 12 hours after the treatment with fermented ginseng. herefore, it was confirmed that the immunological activity of the Raw 264.7 macrophages was affected by the treatment with fermented ginseng. It was concluded that ginseng fermented by Paenibacillus MBT213 possesses a potential anti-inflammatory activity and could be used as an ingredient in functional foods and pharmaceutical products.
Keywords: ginseng, IL-6, NO, Paenibacillus, TNF-α
Introduction
인삼(
Panax ginseng Meyer
,Araliaceae
)의 뿌리는 항 당뇨병, 항 염증 및 항 알레르기 효과를 나타 내기 때문에 한국, 중국 및 기타 국가에서 약물로 오랫동안 사용되어 왔다(Kitagawa
,1987
;Attele et al
.,1999
). 또한 다양한 약리학적 활성 기능이 있는 인삼의 주요 성분은 사포닌(Cheng et al
.,2006
)은40
종 이상의ginsenosides
로 구성되어 있다. 다양한 세균에 의한ginsenosides
의ginsenoside Rg3
에OPEN ACCESS
Accepted: July 24.2018 Revised: July 15.2018 Received: May 30.2018 DOI:
Citation: Son JY, Renchinkhand G, Bae HC, Paik SH, Lee JY, Nam MS. 2018.
Cytokine modulation in Raw 264.7 macrophages treated with ginseng fermented by Penibacillus MBT213.
Korean Journal of Agricultural Science.
https://doi.org/10.7744/kjoas.20180057
대한 가수분해는 다양한 생리활성 효과를 증대시킬 수 있으며 주요
ginsenosides
(Rb1
과Re
)를 작은ginsenosides
(Rd
,F2
, 화합물-K
와Rh2
)로 효율적으로 전환시킬 수 있는 미생물이 발견되었다(Chi and Ji
,2005
).Ginsenoside Rd
는 인삼 뿌리에서80
% 이상의 성분인ginsenoside Rb1
,Rb2
,Rc
의 주요 가수분해 생성물이다(Kim et al
.,1987
;Son et al
.,2008
). 또한ginsenoside Rd
는 생물학적 활성이 높은ginsenoside Rg3
,Rh2
,F2
및Compund
-K
의 주요 전 구물질이다(Chi and Ji
,2005
;Cheng et al
.,2008
).Ginsenoside
중 미량의ginsenoside Rd
는 면역억제 활성(Wang et al
.,2012
), 항 염증 활성(Yang et al
.,2012
), 면역보조제 활성(Han and Rhew
,2013
;Kim
,2013
), 신경줄기세포의 증식 촉진 효과 (Lin et al
.,2012
;Palaniyandi et al
.,2015
)에 대한 연구가 진행되었다. 온화한 조건에서의 산 가수 분해(Han et al
.,1982
), 효 소 전환(Ko et al
.,2003
) 및 미생물 전환(Bae et al
.,2002
;Senthil et al
.,2009
)과 같은ginsenosides
를 생산하기 위해 다양한 형질전환 방법이 사용되어왔다. 이 방법들 중에서 효소전환은 특정ginsenosides
생산에 가장 바람직한 방법이다(Kim et al
.,2005
).Lactobacillus plantarum CRNB22
(Renchinkhand et al
.,2015
),Enterococcus faecalis CRNB
-A3
(Renchinkhand et al
.,2016
),Paecilomyces sp
.와 같은β
-glucosidase
를 생산하는 미생물을 이용하는 미생물 생물 전환 방법(Yan et al
.,2008
) 및Microbacterium sp
. (Cheng et al
.,2008
)는ginsenisides
를 생산하는데 사용되었다.대식세포(
macrophage
)는 탐식세포로 체내 이물질에 대하여 초기 면역 반응을 담당하고 유도한다. 활성화된 대식세포는 표적세포 살해뿐만 아니라, 세포 독성능이 있는Iinterleukin
(IL
)-6
,tumor necrosis factor
(TNF
)-α
,nitric oxide
(NO
) 같은 물 질을 분비한다. 본 연구는 인삼Paenibacillus MBT213
을 접종하여 발효시킨 인삼발효액을 마우스 대식세포인Raw 264
.7
에 처리하여 대식세포가 생산하는cytokine
의 발현 조절에 미치는 영향을 조사하기 위해 수행하였다.Materals and Methods
Fermented ginseng
충남 금산에서 생산한
6
년근 인삼을Renchinkhand et al
. (2017
)의 방법으로 발효시켜 시료로 사용하였다.Cell culture
수컷
BALB
/c mouse macrophage cell line
인Raw 264
.7
세포는KRIBB
(Daejeon
,Korea
)에서 분양 받았고Dulbecco
’s modified Eagle
’s medium
(DMEM
)에10
%fetal bovine serum
(FBS
;Gibco
,Rockville
,MD
,USA
), 과1
% (100 U
/mg
)penicillin
/streptomycin
(Sigma
,St
.Louis
,MO
,USA
)을 첨가하고,37
℃,5
%CO
2와 대기 습도가 유지되는 배양조건에서 배 양하였다.24
-well
(Sigma
,St
.Louis
,MO
,USA
)에4
×10
5CFU
/mL
조정하여24
시간 배양 후 인삼 발효액을50 μg
/mL
처 리하였다.Cell viability by water soluble tetrazolium (WST) assay
인삼 발효액이
Raw 264
.7
세포에 미치는 세포독성 여부 측정은96 well
에1
×10
4cells
/well
이 되도록 분주하고24
시간 배양 후0
,3
,7
,14
일 동안 발효시킨 인삼 발효액50 μg
/well
를 처리하여37
℃,5
%CO
2에서6
,12
,24
시간 배양 후WST assay
를 실시하였다.EZ
-Cytox WST assay reagent
(Daeil Lab Service Co
.,Ltd
.,Seoul
,Korea
)을10 µL
첨가하고2
시간 후에ELISA reader
를 이용하여450 nm
에서 흡광도를 측정하였다.Production of NO
Nitric oxide
의 생산량은 세포배양 상층액50 μL
와 동량의griess reagent
(Sigma
-Aldrich Co
.,St
.Louis
,MO
,USA
)를 혼 합하여15
분 반응 후540 nm
에서 흡광도를 측정하였다.Expression of Cytokine
인삼 발효액을 처리한
Raw 264
.7
세포의 염증관련cytokine
인IL
-6
,TNF
-α
의mRNA
의 발현은PCR
(Applied Biosystems
,Foster City
,CA
,USA
)로 수행하였다.Positive control
은Lipopolysaccharide
(LPS
) (Sigma
-Aldrich Co
.,St
.Louis
,MO
,USA
)1 μg
/mL
을 처리하였다. 배양한 세포를 회수하여1 mL TRizol
(Invitrogen Corporator
,Carlsbad
,CA
,USA
)을 넣고10
분 동안 방치한 후chloroform
을 넣고10
초 동안 격렬하게 흔든 다음15
,000
×g
에서15
분 동안 원심분리하고 상층액을 취 하여 동량의isopropanol
을 혼합하여 흔들어주었다.15
,000
×g
에서10
분 동안 원심분리하여 상층액을 제거하고pellet
은diethyl pyrocarbonate
(DEPC
)-DW 60 μL
에 녹여RT
-PCR
에 사용하였다.RT
-PCR kits
(Madison
,WI
,USA
)에Oligo dT
,dNTP mix
,Ribonuclease inhibitor
,M
-MLV Reverse Transcriptase
,M
-MLV RT 5X buffer
를 사용하여45
℃에서30
분,94
℃ 에서5
분 동안 반응시킨 후94
℃에서30
초 동안denaturation
시키고,55
-62
℃에서30
초 동안annealing
시킨 다음,72
℃에 서1
분 동안24
-27 cycle
반복한 뒤, 마지막extension
은72
℃에서5
분 동안PCR
(Applied Biosystems
,Foster
,CA
,USA
) 을 수행하였다.PCR
산물은2
%agarose gel
에 주입하고100 V
조건에서15
분 동안 전기영동을 수행하였다.RT
-PCR
에 사용한primer
는glutaldehyde
-3
-phosphate dehydrogenase
(GAPDH
):Forward
:ACAGTCTTCTGGGTGGCAGT
,Reverse
:CCATCACCATCTTCCAGGAG
;IL
-6
:Forward
:TGGAGTCACAGAAGGAGTGGCTAAG
,Reverse
:TCTGACCACAGTGAGGAATGTCCAC
;TNF
-α
:Forward
:ATGAGCACAGAAAGCATGATCCGC
,Reverse
:CCAAAGTAGACCTGCCCGGACTC
이다.Quantity of cytokine
Raw 264
.7
세포를24
-well
(Sigma
,St
.Louis
,MO
,USA
)에4
×10
5/mL
로 조정 후LPS
(Sigma Aldrich
)1 μg
/mL
을 처리 하고, 대조군과 인삼 발효 추출물3
,7
,14
일로 나누어 배양액을50 μg
/mL
을Raw 264
.7
에 처리하고,6
,12
,24
시간 배양 후 상층액을 모아enzyme
-linked immune
-sorbent assay
(ELISA
)kit
(BD Bioscience
,USA
)를 이용하여TNF
-α
와IL
-6
를 측정 하였다.Statistics
통계분석은
SAS version 9
.4
(SAS Institute Inc
.,USA
)을 이용하였고, 처리 평균간의 유의성은Duncan
's multiple range
test
를 이용하여p
<0
.05
수준에서 유의적 차이를 검정하였다.Results and Discussion
Cell viability
Human mast cell
(HMC
)-1
세포주에 발효시킨 인삼발효액을 처리하여WST assay
를 통하여 세포 독성을 조사한 결과는Fig
.1
에 나타난 바와 같다.WST
는 수용성의tetrazolium salt
가 살아있는 세포와 반응하여fomazan
을 생성하여 세포내의 모 든dehydrogenase
와 반응하여 세포의 상태를 명확하게 파악하는 것이 가능하다.Fig
.1
에 나타난 바와 같이 인삼발효액은Raw 264
.7
세포의 성장을 저해하는 독성이 없는 것으로 나타났다. 대조구을100
% 기준으로3
,7
,14
일 동안 배양한 인삼발 효액은 대조구보다 높은 생존율을 보임으로서 인삼발효액이 세포성장에 독성효과가 전혀 나타내지 않았다.Production of NO
마우스 대식세포에서 염증성 자극이나 면역학적 자극에 의하여 합성되고 다량의
NO
를 생성한다 (Stuehr and Marletta
,1985
).NO
는 침입한 미생물이나 종양 세포에 대한 독성을 갖는 방어물질로서 작용하고 (Hierholzer et al
.,1998
), 때로는 숙 주에 치명적인 결과를 초래할 수 있는 것으로 보고되고 있다 (McDaniel et al
.,1996
). 인삼을3
,7
,14
일 동안 발효한 인삼발 효액을6
,12
,24
시간 동안Raw 264
.7
세포에 처리하여NO
의 생산량을 측정한 결과는Fig
.2
와 같다.Raw 264
.7
세포에6
시간 배양에서는positive control
,negative control
,3
,7
,14
일 모두9
-13 μM
이 생산됨에 따라 시료 간의 차이가 없었다.12
시간 배양에서는6
시간 배양 보다positive control
과negative control
이13
-18 μM
로 약간 높게 생산되었고,3
,7
,14
일 배양 액에서는6
시간 배양과 동일한9
-13 μM
이 생산됨에 따라6
시간과12
시간 배양에는 시료 간의 차이가 거의 없었다. 반면24
시간 배양인 경우는positive control
은35 μM
인데 비해,3
일,7
일,14
일 배양액의NO
생산량은 각각9
,20
,22
.5 μM
로 나타 나positive control
과 비교하면 각각74
,43
,36
%로 현저하게 감소하였다. 이러한 결과는 인삼발효액이NO
의 생산을 억제 하여 염증 반응에 관련된 물질을 조절하는 효과가 있는 것으로 사료된다. 이는Raw 264
.7
세포에 현삼 메탄올 추출물을 처 리하여18
시간과24
시간 동안 배양 후NO
의 생산량을 측정한 결과 유의성 있게 억제되었다는Byun et al
., (2005
)의 보고와 동일하였다. 이와 같이 인삼 발효 시간이 길어짐에 따라NO
생산은 증가하였는데 이는ginsenoside Rb1
이Rd
로 전환되는 양이 증가 (Renchinkhand et al
.,2017
)한 영향과 또 다른 대사산물이Raw 264
.2 cell
에서NO
의 생산에 영향을 미치는 것으 로 사료된다.Fig. 1. Effect of fermented ginseng by Penibacillus MBT213 on the cell viability water soluble
tetrazolium (WST)-1 in Raw 264.7 cells for 6, 12, 24 h at 37℃. Fermented ginseng by Penibacillus MBT213 were treated to Raw 264.7 cells for 3, 7, 14 days. Each bar represents the average ± SECytokine expression and production
IL
-6
는B
세포가 항체 생산을 위해plasma
세포로 분화되는 마지막 단계를 활성화시켜 항체 분비를 촉진한다. 또한 염증 반응에서IL
-6
는 항상 증가한다 (Delgado et al
.,2003
).Raw 264
.7
세포에Penibacillus MBT213
으로 배양한 인삼발효액을 처리한IL
-6
와TNF
-α
의 발현은Fig
.3
에 나타난 바와 같다.IL
-6
는3
,7
,14
일 동안 발효시킨 인삼발효액을6
,12
,24
시간 처 리한 결과positive control
은 처리 시간에 비례하여 강하게 발현을 하였지만negative control
과3
,7
,14
일 배양액에서 발현 되지 않았다. 이는 인삼발효액이Raw 264
.7
세포에 작용하여IL
-6
의 발현을 강하게 억제하는 것으로 사료된다.TNF
-α
는 대식세포와 비만세포에서 분비되는데 암세포에 세포독성을 나타내며 만성염증반응과 관련이 있다 (Delgado et al
.,2003
).3
,7
,14
일 동안 발효시킨 인삼발효액을6
,12
,24
시간 처리한positive control
은 처리 시간에 비례하여TNF
-α
가 발 현하였는데24
시간 처리에서 가장 강하게 발현한 반면,3
,7
,14
일 동안 발효시킨 인삼발효액을6
시간 처리시에는 아주 미약 하게 발현되었고,12
시간 처리시에는 약하게,24
시간 처리시에는 강하게 발현되었다. 이는 인삼발효액이Raw 264
.7
세포에 처리했을 때TNF
-α
의 발현은 처리 시간에 따라 매우 민감하게 나타났다. 이와 같은 결과는 인삼발효액이6
시간과12
시간보Fig. 3. The expression of tumor necrosis factor (TNF)-α and Iinterleukin (IL)-6 in Raw 264.7 cells
by fermented ginseng by Penibacillus MBT213 for 6, 12, 24 h at 37℃. Fermented ginseng by Penibacillus MBT213 were treated to Raw 264.7 cells for 3, 7, 14 days. GAPDH, glutaldehyde-3- phosphate dehydrogenase; LPS, Lipopolysaccharide.Fig. 2. The production quantity of nitric oxide (NO) in Raw 264.7 cells by fermented ginseng
by Penibacillus MBT213 for 6, 12, 24 h at 37℃ of fermented ginseng by Penibacillus MBT 213 were treated to Raw 264.7 cells for 3, 7, 14 days. Each bar represents the average ± SD of three independent experiments. Lipopolysaccharide (LPS) (1 μg/mL) treatment alone served as a positive control. Level of significance was identified statistically compare with control using Duncan's multiple range test (*p < 0.05).다
24
시간 처리시에Raw 264
.7
세포에 더 크게 영향을 미치기 때문으로 사료된다.Raw 264
.7
세포에서IL
-6
와TNF
의 생산 량을 측정한 결과는Fig
.4
와 같다.Fig
.3
의 발현과 동일하게IL
-6
의 생산은3
,7
,14
일 동안 발효시킨 인삼발효액을6
,12
,24
시간 처리한 결과positive control
은 처리 시간에 비례하여 많이 생산하였지만negative control
과3
,7
,14
일 배양액에서는 아주 적은 량을 생산하였다.Raw 264
.7
세포에3
,7
,14
일 동안 발효한 인삼발효액을6
,12
,24
시간 처리한positive control
은 처리 시간에 비례하여TNF
-α
가 생산되었는데,24
시간 처리에서 가장 많이 생산된 반면,3
,7
,14
일 동안 발효시킨 인삼발효액을6
시간 처리시에는40
,000 pg
/mL
정도 생산되었고,12
시간 처리시에는7
일과14
일 인삼발효액에서 각각85
,000 pg
/mL
과65
,000 pg
/mL
정도 생산되었고,24
시간 처리시에는7
일과14
일 인삼발효액에서 각각160
,000 pg
/mL
과180
,000 pg
/mL
정도 생산되었다. 이러 한 결과는 인삼발효액을Raw 264
.7
세포에 처리했을 때TNF
-α
의 억제는 처리 시간이 짧을 때 효과가 있는 것으로 사료된 다.IL
-6
의 발현과 생산은 인삼 발효 시간에 관계없이 강하게 억제하는 것으로 조사되었는데, 이는ginsenoside Rb1
이Rd
로 전환된 것과 또 다른 대사산물의 양에 상관없이IL
-6
의 발현과 생산에 영향을 미치는 것으로 사료된다. 한편, 인삼 발효 시간 이 길어짐에 따라TNF
-α
의 발현과 생산은 증가하는 것으로 조사되었는데 이는ginsenoside Rb1
이Rd
로 전환되는 양이 증 가 (Renchinkhand et al
.,2017
)한 영향과 또 다른 대사산물이Raw 264
.2 cell
에서TNF
-α
의 발현과 생산에 영향을 미치는 것 으로 사료된다.한편, 유익한 미생물을 이용한 발효 인삼의
ginsenoside
전환에 대해Renchinkhand et al
., (2016
)은Enterococcus faecalis CRNB
-A3
를 접종하여 발효시킨 인삼의ginsenoside
의 분포는Rb1
이Rg3
(epimer S
/R
)와Rg5
로 전환되었음을 보고하였고,Microbacterium sp
.GS514
로 발효시킨ginsenoside Rb1
은Rg3
로 전환되었다고Cheng et al
. (2008
)이 보고하였다. 또한Chi and Ji
(2005
)는ginsenoside Rb1
을Bifidobacterium sp
.Int 57
과Bifidoacterium sp
.SJ32
로 발효시키면compound
-K
(Rb1
→Rd
→F2
→compound
-K
) 로 전환되었음 보고하였다.Conclusion
Fig. 4. The production quantity of tumor necrosis factor (TNF)-α and Iinterleukin (IL)-6 in Raw
264.7 cells by fermented ginseng by Penibacillus MBT213 for 6, 12, 24 h at 37℃. Fermented ginseng by Penibacillus MBT 213 were treated to Raw 264.7 cells for 3, 7, 14 days. Each bar represents the average ± SD of three independent experiments. Lipopolysaccharide (LPS) (1 μg/mL) treatment alone served as a positive control. Level of significance was identified statistically compare with control using Duncan's multiple range test (*p < 0.05).
였고,
TNF
-α
의 생산 억제효과는6
시간과12
시간으로 처리시간이 짧을 때였다. 따라서Paenibacillus MBT213
에 의해 발효 된 인삼발효액은 항염증기능이 있어 기능성 식품과 의약품 소제로 산업에 적용가능 할 것이라 사료된다.Acknowledgements
본 연구는
2016
년 충남대학교CNU
연구지원사업(과제번호:2016
-1356
-01
)의 지원에 의해 수행되었으며 이에 감사드립 니다.References
Attele as, wu JA, Yuan CS. 1999. Ginseng pharmacology: Multiple constituents and multiple actions.
Biochemical Pharmacology 58:1685-1693.
Bae EA, Han MJ, Cho MK, Park SY, Kim DH. 2002. Metabolism of 20(S) and 20(R) ginsenoside Rg3 by human intestinal bacteria and its relation to in vitro biological activities. Biological and Pharmaceutical Bulletin 25:58-63.
Byun SH, Yang CH, Kim SC. 2005. Inhibitory effect of Scrophulariae Radix extract on TNFα, IL-1β, IL-6 and Nitric Oxide production in lipopolysaccharide-activated Raw 264.7 cells. Korean Journal of Herbology 20:7-16. [in Korean]
Cheng LQ, Kim MK, Lee JW, Lee YJ, Yang DC. 2006. Conversion of major ginsenoside Rb(1) to ginsenoside F(2) by Caulobacter leidyia. Biotechnology Letters 28:1121-1127.
Cheng L-Q, Na JR, Bang MH, Kim MK, Yang DC. 2008. Conversion of major ginsenoside Rb1 to 20(S)- ginsenoside Rg3 by Microbacterium sp. GS514. Phytochemistry 69:218-224.
Chi H, Ji GE. 2005. Transformation of ginsenosides Rb1 and Re from panax ginseng by food microorganisms. Biotechnology Letter 27:765-771.
Delgado AV, McManus AT, Chambers JP. 2003. Production of tumor necrosis factor-alpha, interleukin 1-beta, interleukin 2, and interleukin 6 by rat leukocyte subpopulations after exposure to substance P.
Neuropeptides 37:355-361.
Han BH, Park MH, Han YN, Woo LK, Sankawa U, Yahara S, Tanaka O. 1982. Degradation of ginseng saponins under mild acidic conditions. Planta Medica 44:146-149.
Han YM, Rhew KY. 2013. Ginsenoside Rd induces protective anti-Candida albicans antibody through immunological adjuvant activity. International Immunopharmacology 17:651-657.
Hierholzer C, Harbrecht B, Menezes JM, Kane J, MacMicking J, Nathan CF, Peitzman AB, Billiar TR, Tweardy DJ. 1998. Essential role of induced nitric oxide in the initiation of the inflammatory response after hemorrhagic shock. The Journal of Experimental Medicine 187:917-28.
Kim KK, Lee JW, Lee KY, Yang DC. 2005. Microbial conversion of major ginsenoside Rb(1) to pharmaceutically active minor ginsenoside Rd. Journal of Microbiology 43:456-462.
Kim MW, Ko SR, Choi KJ, Kim SC. 1987. Distribution of saponin in various sections of Panax ginseng root
and changes of its contents according to root age. Korean Journal of Ginseng Science 11:10-16. [in Korean]
Kim BJ. 2013. Involvement of melasatin type transient receptor potential 7 channels in ginsenoside Rd- induced apoptosis in gastric and breast cancer. Journal of Ginseng Research 37:201-209.
Kitagawa I, Taniyama T, Shibuya H, Noda T, Yoshikawa M. 1987. Chemical studies on crude drug processing. V. On the constituents of ginseng radix rubra (2): Comparison of the constituents of white ginseng and red ginseng prepared from the same Panax ginseng root. Yakugaku Zasshi 107:495-505.
[in Japan]
Ko SR, Choi K, Uchida K, Suzuki Y. 2003. Enzymatic preparation of ginsenosides Rg2, Rh1, and F1 from proto-panaxatriol-type ginseng saponin mixture. Planta Medica 69:285-286.
Lin T, Liu Y, Shi M, Liu X, Li L, Liu Y, Zhao G. 2012. Promotive effect of ginsenoside Rd on proliferation on neural stem cells in vivo and in vitro. Journal of Ethnopharmacology 142:754-761.
McDaniel ML, Kwon G, Hill JR, Marshall CA, Corbett JA. 1996. Cytokines and nitric oxides in islet inflammation and diabetes. Proceedings of the Society for Experimental Biology and Medicine 211:24- 32.
Stuehr DJ, Marletta MA. 1985 Mammalian nitrate biosynthesis: Mouse macrophages produce nitrite and nitrate in response to Escherichia coli lipopolysaccharide. Proceedings of the National Academy of Sciences of the United States of America 82:7738-42.
Palaniyandi SA, Damodharan K, Lee KW, Yang SH, Suh JW. 2015. Enrichment of ginsenoside Rd in Panax ginseng extract with combination of enzyme treatment and high hydrostatic pressure. Biotechnology Bioprocess Engineering 20:608-613.
Renchinkhand G, Cho SH, Urgamal M, Park Y-W, Nam JH, Bae HC, Song GY. Nam MS. 2017. Characterization of Paenibacillus sp. MBT213 isolated from raw milk and its ability to convert ginsenoside Rb1 into ginsenoside Rd from Panax ginseng. Korean Journal for Food Science of Animal Resources 37:735-742.
Renchinkhand G, Park YW, Cho SH, Song GY, Bae HC, Choi SJ, Nam MS. 2015. Identification of β-glucosidase activity of Lactobacillus plantarum CRNB22 in Kimchi and its potential to ginsenoside Rb1 from Panax ginseng. Journal of Food Biochemistry 39:155-163.
Renchinkhand G, Park YW, Song GY, Cho SH, Choi SJ, Urgamal M, Bae HC, Cho, J-W, Nam MS. 2016.
Identification of β-glucosidase activity of Enterococcus faecalis CRNB-A3 in Airag and its potential to convert ginsenoside Rb1 from Panax ginseng. Journal of Food Biochemistry 40:120-129.
Senthil K, Veena V, Mahalakshmi M, Pulla R, Yang DC, Parvatham R. 2009. Microbial conversion of major ginsenoside Rb1 to minor ginsenoside Rd by Indian fermented food bacteria. African Journal of Biotechnology 8:6961-6966.
Son JW, Kim HJ, Oh DK. 2008. Ginsenoside Rd production from the major ginsenoside Rb1 by β-glucosidase from Thermus caldophilus. Biotechnology Letters 30:713-716.
Wang L, Zhang Y, Chen J, Li S, Wang Y, Hu L, Wang L, Wu Y. 2012. Immunosuppressive effects of
Yan Q, Zhou W, Li XW, Feng MQ, Zhou P. 2008. Purification method improvement and characterization of a novel ginsenoside-hydrolyzing β-glucosidase from Paecilomyces Bainier sp. 229. Bioscience Biotechnology Biochemistry 72:352-359.
Yang XL, Guo TK, Wang YH, Huang YH, Liu X, Wang XX, Li W, Zhao X, Wang LP, Yan S, Wu D, Wu YJ. 2012.
Ginsenoside Rd attenuates the inflammatory response via modulating p38 and JNK signaling pathways in rats with TNBS-induced relapsing colitis. International Immunopharmacology 12:408- 414.